spacer gif spacer gif spacer gif spacer gif spacer gif
QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

doi: 10.1242/10.1242/dev.00429

This Article
Right arrow Summary Freely available
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lakowski, B.
Right arrow Articles by Baumeister, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lakowski, B.
Right arrow Articles by Baumeister, R.

Two suppressors of sel-12 encode C2H2 zinc-finger proteins that regulate presenilin transcription in Caenorhabditis elegans

Bernard Lakowski*, Stefan Eimer, Christine Göbel, Andreas Böttcher, Babett Wagler and Ralf Baumeister{dagger}

ABI, Department of Biochemistry, Laboratory of Molecular Neurogenetics, Ludwig-Maximilians-Universitaet, Schillerstr. 44, D-80336 Munich, Germany
* Present address: Department of Neuroscience, Pasteur Institute, Paris, France



View larger version (45K):

[in a new window]
  		Fig. 2. The positional cloning of spr-3. (A) By three-factor mapping, spr-3 was mapped to the interval between dpy-23(e840) and lon-2, outside of the duplication mnDp32 (see Table S1 at http://dev.biologists.org/supplemental/) Note that spr-3 was previously mapped between dpy-3 and unc-2, close to unc-2 (Wen et al., 2000Go). (B) Rescue of spr-3. spr-3 was rescued by the cosmid F46H6 but not the partially overlapping cosmid C07A12, both shown by thick bars. The cosmid C07A12 extends further to the right. ORFs on F46H6 are named and indicated by lines with arrows. Two spr-3 alleles generated by UV/TMP mutagenesis are large rearrangements. byDf1 deletes 31 kb of the cosmid F46H6, while by136 is a complex rearrangement that affects the promoter of C07A12.5. By injecting a series of restriction fragments, subclones and PCR products (see thick bars below F46H6) the minimal rescuing region was narrowed down to a 4.1 kb fragment (using RB950 CAGTATACAACTACGCTCTCC and RB951 ATCCAACACTCCTAAGTCCG), which contains only the C07A12.5 open reading frame. The number of lines that were rescued is indicated on the right for each construct. (C) Northern blot with RNA from N2, sel-12(ar171) and 7 spr-3 alleles in a sel-12(ar171) background probed with a spr-3 cDNA. No message is detectable in strains harboring either of the two large rearrangements, byDf1 or spr-3(by136).

 


View larger version (71K):

[in a new window]
  		Fig. 4. The expression pattern of spr-3. (A) The stage-specific expression of the spr-3 transcript with ama-1 shown as a control; E, eggs; L1-L4, first to fourth larval stages; A, adult. (B,C) An spr-3::EGFP promoter fusion is expressed broadly throughout the animal. spr-3 is expressed uniformly in eggs (B) and very broadly in the adult (C) with strong expression in the pharynx. (D,E) Expression of a GST-Myc tagged spr-3 Baculovirus construct expressed in insect Sf9 cells and detected with a fluorescein-isothiocyanate coupled goat-anti-mouse secondary antibody. (D) Fluorescent and (E) propidium iodide staining of the same cells.

 


View larger version (50K):

[in a new window]
  		Fig. 5. The cloning of spr-4. (A) The genetic position of spr-4 (see Table S1 at http://dev.biologists.org/supplemental/). (B) Physical map near C09H6.1. spr-4 was mapped close to but to the right of byP7 (SNP v120a11.s1{at}186). The extent of the 12 kb PvuII rescuing fragment is shown. (C) The predicted SPR-4 protein aligned with the 5' end of C28G1.4 and the 3' end of G28G4.4. Identical amino acids are highlighted in black and similar amino acids are highlighted in gray. The 18 putative C2H2 zinc fingers of SPR-4 are underlined, and regions that could act as nuclear localization signals are boxed. The two amino acids present only in the alternatively spliced form of SPR-4 are overlined and labeled at. Mutations are indicated with an asterisk. (D) Alignment of SPR-4 with REST (Homo sapiens). Identical amino acids are highlighted in black and similar amino acids are highlighted in gray.

 


View larger version (14K):

[in a new window]
  		Fig. 1. Mutations in spr-3 and spr-4 potently suppress the egg-laying defect of sel-12 mutants. The percentage of animals that exhibit a protruding vulva (Pvl, black bar), an egg-laying defect (Egl, gray bar) and that die of internal hatching (Bag, white bar) are shown for the wild-type (N2), sel-12 and three separate alleles each of spr-3 and spr-4 in a sel-12(ar171) background. Number of animals examined: N2, 100; ar171, 95; by108, 97; by109, 99; by110, 99; by105, 92; by130, 95; by132, 87.

 


View larger version (51K):

[in a new window]
  		Fig. 3. The structure of SPR-3 from C. elegans and C. briggsae. (A) The determined structure of C. elegans SPR-3 and the 3' end of the C. briggsae homolog. Black boxes indicate the location of the predicted C2H2 zinc fingers and gray boxes indicate the locations of sequences that might act as nuclear localization signals. In the region confirmed, the structure of the C. elegans and C. briggsae transcripts are very similar. (B) An alignment of the C. elegans and partial C. briggsae sequences of SPR-3. Also shown is a region 5' of the determined sequence of the C. briggsae SPR-3 that is similar to the zinc fingers 1 and 2 of the C. elegans spr-3 gene, and is predicted to be part of the C. briggsae spr-3 gene. Identical amino acids are highlighted in black and similar amino acids are indicated in gray. Predicted zinc fingers are underlined and regions containing sequences that could act as nuclear localization signals are boxed. The positions of point mutations are shown with an asterisk. (C) Alignment of the zinc-finger regions of SPR-3 with REST (Homo sapiens). Identical amino acids are highlighted in black and similar in gray. Gaps in the alignment are indicated by hyphens and gaps between segments of SPR-3 are indicated by blank spaces.

 


View larger version (54K):

[in a new window]
  		Fig. 6. The stage-specific expression of sel-12, spe-4 and hop-1 transcripts. Stages are as for Fig. 4A. (A) The stage-specific expression of hop-1 and spe-4 from the same blot, with ama-1 as an equal loading control. (B) The stage-specific expression of sel-12 with ama-1 as a loading control. (C) The relative expression of the various presenilin genes from A and B after correction for equal loading.

 


View larger version (35K):

[in a new window]
  		Fig. 7. Mutations in spr-3 and spr-4 de-repress the expression of the hop-1 message at the L1 stage. Expression of the hop-1 message with ama-1 loading control in the L1 stage for N2 (wild type), sel-12(ar171), four spr-5 alleles (by101, by119, by128, by139), one spr-4 allele (by130) and three spr-3 alleles (by108, by135, by136). All Spr mutants are in a sel-12(ar171) background. Fold expression of hop-1 compared with N2 is given, after correction for equal loading. The first six lanes are reproduced, with permission, from Eimer et al. (Eimer et al., 2002bGo). Preliminary experiments with 5 µg/lane RNA gave qualitatively similar results. See Fig. S1 at http://dev.biologists.org/supplemental/ for additional spr-3 alleles.

 




© The Company of Biologists Ltd 2003