spacer gif spacer gif spacer gif spacer gif spacer gif
QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 13 August 2008
doi: 10.1242/dev.026377

Development 135, 3093-3101 (2008)
Published by The Company of Biologists 2008
This Article
Right arrow Summary Freely available
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamada, Y.
Right arrow Articles by Williams, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamada, Y.
Right arrow Articles by Williams, J. G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

A new family of transcription factors

Yoko Yamada*, Hong Yu Wang*, Masashi Fukuzawa, Geoffrey J. Barton and Jeffrey G. Williams{dagger}

School of Life Sciences, University of Dundee, Dundee DD1 5EH, UK.


Figure 1
View larger version (28K):
[in this window]
[in a new window]

  		Fig. 1. CudA binding to the cotC promoter as determined by ChIP analysis. (A) Chromatin from Ax2 and cudA-null (cudA-) Dictyostelium cells was immunoprecipitated with or without anti-CudA (aCudA) or anti-STATa (aSTATa) antibody and analysed by PCR. (B) Fluorescence intensities from three ChIP experiments performed as above were normalised against the sample marked with an asterisk; bars indicate ±s.d.

 

Figure 2
View larger version (13K):
[in this window]
[in a new window]

  		Fig. 2. Promoter structure of cotC and domain structure of CudA and CudA-like proteins. (A) Schematic of the Dictyostelium cotC promoter. The positions of the three oligonucleotides (A, B and C), the three CA-rich elements (CAEs; binding sequences for the transcription factor GBF) and the regulatory TA-rich region are indicated. (B) Domain structures of Dictyostelium CudA, Entamoeba ECudA and Arabidopsis AtSHB.

 

Figure 3
View larger version (53K):
[in this window]
[in a new window]

  		Fig. 3. Analysis of in vitro binding of ECudA to oligonucleotide B. A band shift analysis was performed using a control E. coli extract (-) and an extract of E. coli cells expressing ECudA (+), with oligonucleotide B as the probe and with the indicated amounts of unlabelled oligonucleotide B as competitor.

 

Figure 4
View larger version (34K):
[in this window]
[in a new window]

  		Fig. 4. Scanning mutation analysis of in vitro binding of ECudA to oligonucleotide B. Scanning mutation analysis of ECudA binding was performed as described in the text using oligonucleotide B. The sequence of the inserted mutation was GCGCGC. Each of the 11 mutant forms was used as competitor in a band shift assay with oligonucleotide B as the probe.

 

Figure 5
View larger version (28K):
[in this window]
[in a new window]

  		Fig. 5. Mutational analysis of ECudA binding to the cotC dyad. (A) The WT 20-mer competitor oligonucleotide (CACTGTGAGAATTTTCTATT) encompasses the interrupted dyad (underlined); the C and G within the dyad sequence are swapped in the Minv competitor. WT and Minv were used in band shift assays with oligonucleotide B and ECudA. The assays were performed using Cy5-labelled probes and the intensity of the unshifted probe bands and of the shifted (retarded) bands was measured. (B) The competition efficiency with 100 pmol of competitor is calculated as the ratio, in percentage terms, of the retarded signal to the total (retarded + unretarded) signal. This is a compilation of data from three experiments and the percentage is expressed ±s.d. (C) Point mutation analysis of ECudA binding to multimeric forms of the dyad using the dimeric competitor oligonucleotides, WT' and Minv', that contain tandem repeats of the 14-mer encompassing the dyad sequence. A tetramer of the WT' form (4xWT') was also used that contains two tandemly arrayed copies of the dimer.

 

Figure 6
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 6. Demonstration that CudA binds to the ECudA dyad element. CudA purified from Dictyostelium nuclear extracts using wild-type and mutant versions of the 4-fold multimerised 14-mer element, defined using ECudA, was analysed by western blotting. Non-specific binding was determined in a parallel purification using beads (no DNA). Results from three experiments are compiled in the bar chart. The amount of bound CudA is shown as amount bound, after subtracting non-specific binding and relative to the WT sequence with the indicated s.d. values.

 

Figure 7
View larger version (36K):
[in this window]
[in a new window]

  		Fig. 7. Yeast two-hybrid analysis of CudA homodimerisation. The CudA prey is constitutively expressed and in the presence of galactose as an inducer (in Gal+ medium) the bait is also expressed. The test bait is CudA and the STATa SH2 domain is used as a negative control bait. Because there is an interaction between bait and prey, i.e. homodimerisation of CudA, lacZ expression is activated and is detected with X-Gal. Staining was for 3 days at 30°C. The same bait and prey combinations were tested by growth selection using a leu marker and gave identical results (data not shown).

 

Figure 8
View larger version (41K):
[in this window]
[in a new window]

  		Fig. 8. Mutational analysis of the cotC promoter. (A) Deletion analysis. A 5' to 3' deletion series with a start point at nucleotide -659 (relative to the cap site) was constructed and fused to the lacZ gene at a point 30 nucleotides downstream from the cotC initiation codon. The constructs were used to prepare stable transformants in Ax2 and cudA-null cells and analysed as pooled populations. Note the shorter staining time used for the -659 construct. (B) Point mutation analysis. Site-directed mutagenesis was used to generate a construct with a 5' end point at nucleotide -457 and with a structure similar to that described in A. This construct, and the control wild-type construct, were analysed as in A but only in Ax2 cells.

 

Figure 9
View larger version (37K):
[in this window]
[in a new window]

  		Fig. 9. CudA homologues and the evolution of STAT proteins. (A) The core region of the Dictyostelium CudA protein compared with related proteins. Amoebozoan species of origin: D.d., Dictyostelium discoideum; E.h., Entamoeba histolytica; H.v., Hartmanella vermiformis; P.p., Physarum polycephalum. The alignment of the core domain of CudA with proteins of similar sequence was produced by AMPS (Barton, 1994Go), followed by manual adjustment in Jalview (Clamp et al., 2004Go). Accession numbers are shown only for those proteins for which no publication is available; ECudA is AAC41578. The alignment is coloured according to the ClustalX colour scheme (Thompson, et al., 1997Go). Residues are coloured by their physico-chemical properties as well as by how frequently they occur at each position. Thus, residues are only coloured if they show similarity to a notional `consensus'. Negatively charged residues are in purple; hydrophobic residues in blue; positively charged residues in red; and polar residues in green. Since glycine and proline have special properties, they are separately coloured in orange and mustard, respectively. The secondary structure prediction produced by JPred/JNet (Cuff and Barton, 2000Go) is shown below the alignment. The green arrows within the `jnetpred' line represent predicted β-strands. The bar chart and numbers labelled `JNETCONF' show the prediction confidence on a scale of 0-9. The `Conservation' line highlights positions in the alignment where the physico-chemical properties of the amino acids are most highly conserved. The two red lines above the sequence show the positions of the mutations introduced to assess the importance of the two regions in DNA binding. (B) Dendrogram for the sequences shown in A. The sequences were compared pairwise and a Z-score calculated from 100 randomisations using AMPS (Barton and Sternberg, 1987Go).

 

Figure 10
View larger version (34K):
[in this window]
[in a new window]

  		Fig. 10. Mutational evidence that the ECudA core region is the DNA-binding domain. His-tagged ECudA, either wild-type (WT) or mutated in the two positions indicated in Fig. 9A (LSS, RVISK) and described in the text, was analysed by band shift using the 4-fold multimerised 14-mer element as a probe. In the bar chart, the averaged results of four experiments are quantitated and presented with the s.d.

 

Figure 11
View larger version (26K):
[in this window]
[in a new window]

  		Fig. 11. A model for the evolution of STATs and their DNA binding sites. The model proposes an ancestral, constitutively dimeric protein (GAA). It has a GAA-binding half site and binds DNA co-operatively. This latter feature favoured the evolution of tandem, dyad-binding sites of the form (GAAnTTC)n. The junctions between these sites (shown at A) constitute potential binding sites for a protein recognising the reversed order sequence TTCnGAA. STAT proteins are proposed to have arisen, by the recruitment of a site of tyrosine phosphorylation (Y) and an SH2 domain (SH2), to bind such junctional sequences.

 

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



© The Company of Biologists Ltd 2008