|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
1 Institut de Génétique et Biologie Moléculaire et Cellulaire, CNRS/INSERM/ULP, BP 163, 67404 Illkirch cedex, CU de Strasbourg, France
2 Max Planck Institute for Cell Biology and Genetics, Dresden. c/o Department of Neurobiology University of Heidelberg Im Neuenheimer Feld 364 D-69120 Heidelberg, Germany
*Author for correspondence (e-mail: thisse{at}igbmc.u-strasbg.fr)
Accepted 26 March 2001
| SUMMARY |
|---|
|
|
|---|
Key words: BMP, Sprouty4, FGF3, FGF8, FGFR, ERK, MAPK, Ras, Morpholino, Zebrafish
| INTRODUCTION |
|---|
|
|
|---|
Studies in vertebrates have revealed the existence of at least 20 different FGFs that are characterized by the presence of a conserved 120 amino acid core region. FGFs elicit their cellular response through the binding to transmembrane tyrosine kinase FGF receptors (FGFRs). The four existing FGFR genes encode seven receptor isoforms with different binding affinities for the various FGFs (Ornitz et al., 1996
). Moreover binding of FGFs to heparan sulfate proteoglycans is crucial for efficient receptor stimulation (Lin et al., 1999
). FGF binding induces the dimerisation of FGFRs, therefore allowing the transphosphorylation of several cytoplasmic tyrosine residues. This modification leads to the recruitment and phosphorylation of the lipid-anchored protein FRS2, which then interacts with the SH2 domain-containing adaptor protein Grb2 (Kouhara et al., 1997
). Grb2 then allows the binding of the guanine nucleotide exchange factor Sos, which mediates the activation of the membrane-bound monomeric G-protein Ras (Lowenstein et al., 1992
). This in turn induces the activation of a kinase cascade comprising Raf, mitogen-activated protein kinase (MAPK) and MAPK kinase (MEK), the last member of which finally enters the nucleus and phosphorylates target transcription factors (Sternberg and Alberola-Ila, 1998
).
Recent genetic studies in Drosophila have led to the isolation of the novel gene sprouty (spry) which antagonizes FGF signaling during tracheal morphogenesis (Hacohen et al., 1998
). Subsequent work has revealed that Spry not only interferes with signaling by FGFRs, but also with signaling by the epidermal growth factor (EGF) receptor, torso and sevenless receptor tyrosine kinases (RTK) (Casci et al., 1999
; Kramer et al., 1999
; Reich et al., 1999
). Spry has been suggested to act as general antagonist of RTK-induced Ras signaling through the interaction with the docking protein Drk (the Drosophila Grb2 homolog) and the GTPase Gap1, which acts as an inhibitor of Ras activation (Casci et al., 1999
).
Studies in vertebrates have revealed the existence of several spry homologs in mouse and chicken. These genes are expressed in regions of ongoing FGF signaling and can be induced locally through the implantation of beads soaked in recombinant FGF proteins (Chambers et al., 2000
; Minowada et al., 1999
). Moreover, studies of mouse lung development suggest that, as in Drosophila, Spry acts as an inhibitor of branching morphogenesis (Tefft et al., 1999
).
In the course of a large-scale in situ hybridization screen of embryonic gene expressions, we have identified a zebrafish sprouty4 homolog, owing to its coexpression with fgf8 and fgf3. We show that Fgf8 and Fgf3 act in vivo to induce the expression of Spry4, which antagonizes their activity by acting downstream of FGFR1.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids
Fragments of zebrafish cDNA coding for FGFR1, FGFR2, FGFR3 and used as probe for in situ were as described (Poss et al., 2000
). Constructs encoding constitutively activated FGFR1 and FGFR4 have already been described (Umbhauer et al., 2000
).
Whole-mount MAPK immunostaining
Embryos were fixed for 24 hours in 4% PFA at 4°C, dehydrated by 10 minute incubations in 25, 50, 75 and 100% ethanol and stored in 100% ethanol at –20°C. For antibody staining, embryos were rehydrated by 10 minute incubations in 75, 50 and 25% ethanol, washed five times for 5 minutes in PBT (phosphate-buffered saline (PBS) 1x, 0,1% Tween 20) and preadsorbed for several hours at room temperature by incubation in PBTSB (PBT, 10% sheep serum, 10 mg/ml bovine serum albumin). Embryos were then incubated overnight at 4°C with a 1:10,000 dilution in PBTSB of an anti-activated-MAPK antibody coupled to alkaline phosphatase (Sigma, A3713). Unbound antibody was washed off with eight 15 minute washes in PBT. For the staining reaction, embryos were processed as for whole-mount in situ hybridization.
mRNA and morpholino injections
The spry4 open reading frame (ORF) was PCR amplified using the primers ATCGATTGAGGAACACGACCTACA and CTCGAGGAA-GGTCCTGCAAACCAT, and subcloned into the ClaI/XhoI sites of pCS2+. For fgf3 (Kiefer et al., 1996
), the ORF was amplified by RT-PCR using the primers GAATTCATTCCAGCGAGATTTTGCCG and TCTAGACCATCTGTGTCAAGAGAGAG, and subcloned into the EcoRI/XbaI sites of pCS2+. For microinjection plasmids were linearized with NotI and sense RNA transcribed with SP6 RNA polymerase using the mMessage mMachine Kit (Ambion).
Morpholinos (Gene Tools) were resuspended in sterile water, stored at –20°C as a 4 mM stock solution and diluted before use to the appropriate concentration. The sequences of the morpholinos used are:
fgf8, GAGTCTCATGTTTATAGCCTCAGTA;
nacre, CATGTTCAACTATGTGTTAGCTTCA;
fgf3, CATTGTGGCATGGCGGGATGTCGGC; and
spry4, GGAACCCTTGACTCCATCTGTAGGT.
For both mRNA and morpholino injections, embryos were dechorionated using Pronase and injected with either RNA or morpholinos diluted in 0.2% Phenol Red and 0.1 M KCl, using an Eppendorf 5426 microinjector.
Bead implantations and inhibitor treatment
Bead implantations was performed as described (Reifers et al., 2000
). FGF8b- or PBS-soaked control beads were implanted in indicated brain regions of wild-type embryos at the 14 somite stage, the embryos were fixed at 24 hours prior to in situ hybridization. For pharmacological inhibition of FGFR activity, wild-type embryos were treated with 40 mM SU5402 (Calbiochem; Mohammadi et al., 1997
) in embryo medium at 28.5°C in the dark.
| RESULTS |
|---|
|
|
|---|
The zebrafish Spry cDNA codes for a 310 amino acid protein. It is most closely related to mouse Sprouty4, the two proteins displaying 65.7% overall amino acid similarity while showing less than 50% amino acid similarity with the mouse or human Spry1, Spry2 and Spry3 (Minowada et al., 1999
). Phylogenetic analysis further confirms that our clone encodes a zebrafish Sprouty4 homolog (Fig. 1). Alignment of the peptide sequence of the sprouty genes reveals the existence of three domains of particularly extensive conservation (Fig. 1). Most prominent among these is the C-terminal 130 amino acid cysteine-rich domain, which constitutes the distinctive feature of Spry proteins and has been shown to be sufficient for the localization of Spry at the plasma membrane (Casci et al., 1999
). In zebrafish Spry4 this domain contains 25 cysteine residues, 17 of which are found at conserved positions in all Spry proteins.
In addition, the alignment of the vertebrate family members highlights the existence of two short stretches of similar amino acids corresponding to the positions 37-56 and 106-120 of zebrafish Spry4 (Fig. 1). The second of these stretches is remarkably rich in serine (nine out of 15 residues).
While the initial characterization of Drosophila Spry suggested a secretion of the protein (Hacohen et al., 1998
), subsequent studies favour an intracellular mode of action (Casci et al., 1999
). Our analysis of Spry protein sequences using the Wickonsin Package from GCG did not detect any potential signal peptide for secretion in zebrafish Spry4 or in any of the other vertebrate Sprys. In contrast to this, this same program predicted the existence of a signal peptide at the N terminus of Drosophila Spry.
Correlation between spry4, fgf8 and fgf3 expression patterns
Analysis of spry4 expression revealed a striking correlation with the expression domains of fgf8 and fgf3 (Fig. 2). The expression of both fgf8 and spry4 begins at sphere stage, shortly after the activation of the zygotic genome. Transcripts first become detectable at the dorsal margin of the blastoderm (Fig. 2A,B), with spry4 appearing slightly later and in a larger domain. During late blastula, the expression of spry4 (Fig. 2D) and fgf8 extends towards lateral and ventral marginal territories. A similar marginal expression is also observed for fgf3 (Fig. 2C). During gastrulation, fgf8 and spry4 are expressed along a dorsoventral gradient at the margin, the spry4 expression extending more ventrally than fgf8 (Fig. 2E,F). After midgastrulation spry4 starts to be expressed in the primordium of the ventral diencephalon, in which fgf3 transcripts also accumulate (Fig. 2G,H). At the end of gastrulation spry4 colocalizes with fgf8 in the midbrain-hindbrain boundary (MHB) region, but appeared in this domain slightly later than fgf8 (not shown).
Throughout the segmentation period, fgf8 and spry4 are continuously expressed in the telencephalon, a region where fgf3 is also detectable (Fig. 2I-L). fgf8 and spry4 are continuously expressed at the MHB, and display similar transient expressions in the hindbrain (Fig. 2I,J) and in the heart primordia (not shown). Posteriorly, fgf8 and spry4 are expressed in the paraxial mesoderm, fgf8 being expressed in the somites, as well as in the anterior aspect of the unsegmented paraxial mesoderm (Fig. 2M), while spry4 is restricted to the already formed somites (Fig. 2N).
From 24 to 48 hours of development, spry4 is coexpressed with fgf8 in the anterior telencephalon, the epiphysis, the optic stalk and the isthmic region (Fig. 2O,P). In addition, it displays a strong expression in branchial arches similar to fgf3 (Fig. 2Q,R).
By our detailed analysis it appears that in most cases spry4, fgf8 and fgf3 expression domains overlap, with the expression of spry4 being somewhat more widespread. However, in a few instances, fgf8 and spry4 are expressed in adjacent or in complementary domains.
In the otic region, fgf8 is expressed in the posterior vesicular epithelium, while spry4 is detected in a few cells outside of the vesicle (Fig. 2S,T). Adjacent expressions of fgf8 and spry4 are furthermore observed in the hypophysis, as well as the forming pectoral fins. Although fgf8 is expressed in the adenohypophysis, spry4 is detected in adjacent neurohypophysal cells (Fig. 2U-V). In the fin buds, fgf8 transcripts are localized to the apical ectodermal ridge (AER), whereas spry4 is expressed in the underlying mesenchyme (Fig. 2W,X). A similar situation is observed in the caudal fin (not shown).
spry4 expression is dependent on FGF signaling
The strong correlation observed between the expression territories of spry4, fgf8 and fgf3 suggests that spry4 expression may be under the control of the FGF signaling pathway.
To investigate whether spry4 is an in vivo target of Fgf8, its expression was analysed in the acerebellar (ace) mutation that inactivates the fgf8 gene, causing in homozygous embryos loss of MHB and cerebellum (Brand et al., 1996
; Reifers et al., 1998
). Expression of spry4 is never activated at the isthmic primordium and the anterior hindbrain in ace mutant embryos (Fig. 3A,B). During early somitogenesis, expression in the fore- and hindbrain is strongly reduced, while the MHB expression is absent (Fig. 3C,D). At 30 hours of development, expression of spry4 at the MHB, the dorsal diencephalon, the nasal and facial ectoderm is absent (Fig. 3E,F). Beside the expression domains in the neuroectoderm, spry4 transcript levels are reduced in the somites and the tail bud of mutant embryos at early segmentation stage (not shown).
As spry4 expression domains correlate with the presence of fgf3 (Fig. 2) we investigated whether Fgf3 was indeed required for spry4 expression. As no mutation that inactivates fgf3 is yet available, we took advantage of a novel technology: gene knock-down by morpholino oligonucleotide microinjection (Nasevicius and Ekker, 2000
). Morpholinos are chemically modified antisense oligonucleotides that inhibit the translation of target mRNAs by binding to their 5' untranslated region and interfering with ribosomal positioning (Summerton, 1999
). In order to validate this strategy, we first tested if we could phenocopy the ace phenotype. After injection of 0.4 pmol of a morpholino directed against fgf8 (@fgf8), 65% of the embryos displayed a loss of the cerebellum. This defect is extremely similar to the ace phenotype (Fig. 4A,B).
To rule out the possibility that this phenotype was generated in a nonspecific manner, we injected a second oligonucleotide directed against the microphtalmia-related gene affected in the zebrafish pigmentation mutant nacre (Lister et al., 1999
). Injection of 2 pmol of the nacre morpholino induced the complete loss of neural crest derived pigmentation in 80% of the embryos (Fig. 4D) and its partial reduction in the remaining 20%. In contrast to this, retinal pigmentation was unaffected, similar to what is observed in genetic nacre loss-of-function mutants (Fig. 4D). Injection of 10 pmol of the nacre morpholino (25 times the amount used for fgf8) produced embryos with minor posterior defects without any alteration of MHB (not shown), demonstrating the specificity of morpholino-induced gene inactivation.
After injection of fgf3 morpholinos, embryos appeared morphologically normal until early somitogenesis. By 15 hours of development, embryos started however to display a general necrosis that caused their death (not shown). This situation prevented us from analysing the requirement of Fgf3 for spry4 expression at later stages, notably in the forming branchial arches. We were, however, able to study the effect of impaired Fgf3 signaling on spry4 expression at gastrula and early somitogenesis.
At late gastrulation stages, spry4 and fgf3, but not fgf8, are co-expressed in the ventral forebrain primordium (Fig. 4E). Microinjection of 0.4 pmol fgf3 morpholino was found to abolish spry4 expression in this domain (Fig. 4F). In addition, marginal spry4 expression appeared slightly reduced. This may be a late consequence of the interference with the earlier action of Fgf3 in the marginal blastoderm.
Loss of Fgf8 function in ace mutant leads to the partial reduction of spry4 expression in the telencephalic region of five somite stage embryos (Fig. 4H). To investigate whether persistent Fgf3 signaling could be responsible for the residual spry4 expression, we inhibited the function of both Fgf8 and Fgf3 by morpholino injection. Injection of 0.4 pmol fgf8 morpholino led to a reduction of telencephalic spry4 expression comparable with that observed in ace mutant (Fig. 4H,I). Co-injection of the same amount of fgf8 morpholino with 0.4 pmol fgf3 morpholino induced a complete disappearance of spry4 expression (Fig. 4J). Taken together, our experiments demonstrate that spry4 expression is also dependent on Fgf3 signaling in several regions of the embryo.
Embryos in which both Fgf8 and Fgf3 function have been inhibited still display residual spry4 expression in the tail bud (not shown). To further study the requirement of additional FGF signals for the expression of spry4, we analysed its expression in embryos where FGF signaling has been blocked pharmacologically. We therefore treated wild-type embryos with SU5402, a potent inhibitor of FGFR1 function (Mohammadi et al., 1997
). As SU5402 blocks FGFR1 activity by binding to a region that is conserved in all four FGFRs (Johnson and Williams, 1993
), it probably blocks all FGF signals. Wild-type embryos that have been inhibitor treated show a loss of spry4 expression in all territories at all analyzed stages (from blastula to 24 hours post fertilization(hpf)), as illustrated in Fig. 4K,L. Use of SU5402 therefore demonstrates that other FGFs are responsible for the remaining expression of spry4 in the tail bud of embryos in which both fgf8 and fgf3 have been inhibited by morpholino injection.
Loss-of-function experiments, as well as mutant analysis, therefore showed that Fgf8 and Fgf3 activity are required for spry4 expression. Using gain-of-function experiments, we further investigated whether Fgf3 and Fgf8 were sufficient to elicit ectopic spry4 expression.
Microinjection of 25 pg fgf3 mRNA, into the yolk of two-cell stage embryo results in a massive induction of spry4 throughout the blastoderm of blastula or gastrula (Fig. 5A,B). Similarly, microinjection of 5 pg fgf8 mRNA induced the widespread expression of spry4 throughout the embryo (Fig. 5C). Finally, microinjection of fgf3 (not shown) or fgf8 mRNA into a central blastomere at the 16-cell stage (which gives rise to clones located at the animal region of gastrula) resulted in the localized expression of spry4 at the animal pole, far from its endogenous expression domain (compare Fig. 5D with 5A).
We also locally applied Fgf8-soaked beads during somitogenesis. The implanted Fgf8 bead caused a very strong ectopic induction of spry4 expression around the bead (Fig. 5E,F). Taken together these results clearly show that both Fgf3 and Fgf8 are sufficient to induce spry4 expression.
Misexpression of Spry4 mimics acerebellar phenotype
Using gain-of-function experiments, we investigated the effect of Spry4 on embryonic development. Two classes of defects were obtained depending on the amount of spry4 mRNA injected: an acerebellar phenotype at low doses and a ventralization phenotype at higher doses (see below).
At 250 pg spry4 mRNA, 1% of injected embryos displayed a morphology strikingly similar to the ace/fgf8 loss-of-function mutant phenotype, which is characterized by a loss of cerebellum (Fig. 6A,B). Moreover, as for ace the size of the otic vesicle is reduced. Therefore these observations suggest that Spry4 acts as a Fgf8 antagonist. The low penetrance of the ace-like phenotype may reflect the poor stability of the injected RNA, because Fgf8 is required not for the initiation but for the maintenance of the MHB (Reifers et al., 1998
). This suggests that an earlier phenotype may exist, but due to the degradation of spry4 mRNA and persistent fgf8 expression, most of the embryos recovered to wild type. This hypothesis is supported by the analysis of the expression of two early MHB markers, engrailed 2 and pax2.1, known to be the first MHB markers affected in ace mutant (Reifers et al., 1998
). Expression of these two genes at early somitogenesis in embryos injected with 250 pg of spry4 mRNA appeared narrower at the MHB for 75% (engrailed 2, 57/76) and 77% (pax2.1, 65/84) (Fig. 6D,F) compared with wild type (Fig. 6C,E). This narrowing of the expression territory at the MHB is identical to that observed in ace mutant embryos at early somitogenesis.
As spry4 is the earliest marker known to be expressed at the MHB during gastrulation and because its transcription is under the control of FGF signaling (see Figs 3-5), it was used as a probe to look for an earlier defect in MHB formation. We injected embryos with mRNA comprising only the coding region of spry4 and then revealed the effect of this injection at late gastrula by in situ hybridization using the 3'UTR of spry4. Under these conditions we observed a strong reduction of spry4 expression (Fig. 6H), reflecting the inhibitory effect of Spry4 on Fgf8 signaling. However, at later segmentation stages, spry4 expression recovers to wild-type levels (not shown).
In order to improve the penetrance of ace-like phenotype induced by spry4, we decreased the endogenous Fgf8 dosage. Embryos obtained from crosses between ace heterozygous fish and wild type were injected with spry4 mRNA. Under these conditions, 50% of embryos carried only one copy of fgf8. In this sensitized background, loss of cerebellum phenotype, analyzed morphologically at 30 hpf, increased from 1% to 13% (16/123) of the injected embryos. We then tested whether Spry4 could cooperate with an fgf8 morpholino to induce ace-like phenotype. The injection of 0.2 pmol fgf8 morpholino on its own induces a loss of the cerebellum in only 2% of the embryos. Co-injection of the same amount of fgf8 morpholino with 250 pg spry4 mRNA leads to 36% (36/101) of ace-like phenotype. Taken together, these results show that Spry4 antagonizes the activity of Fgf8 during MHB formation.
Misexpression of Spry4 ventralizes the embryo
Although low amounts of spry4 mRNA leads to loss of MHB formation, injection of higher amounts (1 ng) leads to ventralization phenotypes. 42% (70/167) of the embryos showed an expansion of ventral hematopoietic derivatives (Fig. 6J), which is indicative of a weak ventralization. A further 18% (30/167) of injected embryos displayed a reduction of head and notochord as well as a strong increase in hematopoietic derivatives, which are characteristic of a strong ventralization (Fig. 6K,L), or even a complete lack of morphologically recognizable dorsoventral polarity (6%, 10/167, not shown). Finally, 34% (57/167) of injected embryos did not show any dorsoventral patterning defects but displayed various cephalic malformations.
We have previously shown that Fgf8 is involved in the control of the expression of BMPs by inhibiting their expression on the dorsal side of the embryo (Fürthauer et al., 1997
). As a consequence, the ventralization phenotype resulting from spry4 overexpression is the expected phenotype for a FGF antagonist. As Fgf8 mediates its effect on the dorsoventral patterning by controlling the BMP expression, we analysed the expression pattern of BMP2b at blastula stage in embryos injected with spry4. For 1 ng of spry4 mRNA, we observed a strong dorsal expansion of BMP2b expression (Fig. 6N) compared with wild type (Fig. 6M). Similar results were obtained for the expression of BMP4 and BMP7 (not shown). As the result of the extension of BMP expression, genes specifically expressed in presumptive epidermis, such as CG1061, which encodes a forkhead domain-containing protein (M. F., B. T. and C. T., unpublished), appeared to be strongly upregulated (compare Fig. 6P with Fig. 6O, wild type).
Spry4 loss-of-function phenotype
We next investigated the effect of Spry4 loss of function in zebrafish development by inhibiting its expression with morpholino oligonucleotides. Injection of 1 pmol spry4 morpholino (94%, 51/54) led to embryos with an enlargement of dorsolateral paraxial somitic territories (Fig. 7A,B). This is indicative of a weak dorsalization phenotype consistent with an upregulation of FGF signaling at early developmental stages. This interpretation was further supported by the effect of spry4 loss of function on BMP2b expression. Upon injection of the same amount of spry4 morpholino, the expression of BMP2b at the shield stage appeared strongly reduced (but not abolished) in the ventral blastoderm (Fig. 7C,D).
Analysis of various neural markers at early somitogenesis reveals that spry4 loss of function causes a strong enlargement of the telencephalon, visualized by expression of emx1 (Fig. 7E,F). This enlargement of the telencephalic territory may be at the origin of facial outgrowths observed at late developmental stages (Fig. 7G,H). Fgf8 has been shown to direct outgrowth and patterning of the surface ectoderm that overlies the facial primordia in the mouse (Meyers et al., 1998
). As a consequence, the phenotype we observed in the zebrafish may result from excessive FGF signaling in the facial mesenchyme.
In conclusion, both our gain- and loss-of-function studies provide evidence that Spry4 affects embryonic development through a modulation of FGF signaling.
Spry4 antagonizes Fgf8 and Fgf3 activity in vivo
We have previously shown that localized misexpression of Fgf8 on the ventral side of the embryo induces the formation of a partial secondary axis by the local inhibition of BMP gene expression (Fürthauer et al., 1997
). Performing the same experiment with Fgf3 gave the same result. To demonstrate the antagonistic effect of Spry4 on Fgf8 and Fgf3, we designed a functional assay in order to inhibit, by overexpression of spry4, the formation of a secondary axis resulting from ventral misexpression of Fgf8 or Fgf3 (Fig. 8A).
Two batches of embryos were injected with 200 pg mRNA encoding either β-galactosidase or Spry4. These injections were performed into the yolk of two-cell stage embryos to ensure a widespread RNA distribution. At the 16-cell stage, both sets of embryos were further co-injected into one marginal blastomere with 5 pg fgf8 (or 25 pg fgf3) and 100 pg eGFP mRNA (Fig. 8B). At shield stage, the dorsal side of the embryo was identified by the thickening resulting from the involution of dorsal mesendoderm. We selected the embryos for which the clone of Fgf8- or Fgf3-overexpressing cells lay in the ventral half of the blastoderm (Fig. 8A). When grown at 24 hours, 69.4% of the β-galactosidase/fgf8-injected embryos (50/72) displayed either a dorsalized phenotype or the formation of a partial secondary axis (Fig. 8C). In contrast, the frequency of Fgf8-induced phenotypes was reduced to 4.6% (3/65) in spry4-injected embryos (Fig. 8C). For fgf3, we found that the frequency of Fgf3-induced phenotypes dropped from 58.2% (32/55) to 11.2% (8/71) in presence of Spry4 (Fig. 8D). This establishes clearly that Spry4 is able to antagonize Fgf8 and Fgf3 activity.
Spry4 rescues the dorsalization induced by misexpression of constitutively activated FGFR1
FGFs exert their effects by activating cell-surface receptor tyrosine kinases. Four different FGF receptors have been identified so far and only two of them, fgfr1 and fgfr4, are expressed at early developmental stages in zebrafish (M. F., C. T. and B. T., unpublished). FGFR1 is expressed maternally and its transcripts are widely distributed at blastula stage. During gastrulation, fgfr1 is expressed in anterior neural plate and in segmental plate mesoderm. At beginning of somitogenesis, fgfr1 transcripts are observed in the whole head ectoderm with a stronger accumulation at the level of the telencephalon and at the MHB. In MHB, FGFR1 is the only FGF receptor to be expressed (M. F., C. T. and B. T., unpublished). fgfr4 expression starts at blastula stage in the animal pole region. During gastrulation expression is observed in prechordal plate and in anterior neural plate with a clearing in the expression pattern at the level of the presumptive MHB, as well as at the level of telencephalon and eye field (Thisse et al, 1995
). The other two FGF receptors are not expressed before the end of gastrulation. FGFR2 transcripts first appear at early somitogenesis in newly formed somites, while FGFR3 starts to be expressed shortly after gastrulation in presumptive posterior diencephalon and anterior spinal chord (M. F., C. T. and B. T., unpublished). Based on the expression territories of these four FGF receptors, FGFR1 appeared to be the best candidate for the receptor transducing the signal of Fgf8 and Fgf3 at early developmental stages.
To investigate whether Fgf8 and Fgf3 indeed act by stimulating FGFR1, we performed the misexpression of a constitutively activated form of FGFR1 (CA-FGFR1, Umbhauer et al., 2000
). This form was generated by fusing a mutated torso extracellular domain with the FGFR1 intracellular domain, thereby inducing a ligand-independent dimerization and activation of the receptor. Injection of 60 pg of CA-FGFR1 mRNA resulted in a strong dorsalization of the embryo (94%, 91/97), a phenotype that was undistinguishable from the dorsalization induced by overexpression of fgf8 or fgf3 (Fig. 8E). Conversely, injection of 60 pg of mRNA coding for the CA-FGFR4 (Umbhauer et al., 2000
) into embryos at the two-cell stage resulted in various developmental defects unrelated to phenotypes induced upon overexpression of fgf8 or fgf3. This result therefore provides functional evidence that transduction of the Fgf8 and Fgf3 signal is mediated by FGFR1 at early developmental stages.
Spry4 acts downstream of FGFR1
To investigate at which level Spry4 interferes with FGF signaling, we tested its ability to rescue a CA-FGFR1-induced dorsalization. Coinjection of CA-FGFR1 with increasing doses of spry4 mRNA progressively rescued this dorsalization phenotype. For 125 pg spry4 mRNA, only 29% (32/109) embryos remain dorsalized while using 250 pg led to a complete rescue of the dorsalization phenotype. This clearly demonstrates that spry4 antagonizes the FGF signaling mediated through FGFR1.
Stimulation of FGFR1 ultimately leads to the phosphorylation of the extracellular-regulated protein kinases (ERK) 1 and 2 (Umbhauer et al., 2000
). We therefore took advantage of the use of an antibody recognizing the activated form of ERK (Gabay et al., 1997
) to estimate the effect of Spry4 on MAPK activity. In accordance with an activation of ERK after the stimulation of FGFR1, localized misexpression of CA-FGFR1 induces ectopic activation of MAPK at blastula stage (Fig. 8F) whereas activated MAPK is barely detectable in wild-type control embryos (not shown). Conversely, localized injection of 250 pg spry4 mRNA caused a local inhibition of MAPK activation at mid-gastrula stages (Fig. 8G), when the MAPK is ubiquitously activated in wild-type embryos (not shown).
Our results therefore demonstrate that spry4 interferes with FGF signaling by acting downstream of FGFR1, leading to a subsequent downregulation of MAPK activity.
| DISCUSSION |
|---|
|
|
|---|
Most frequently, a sharp fgf expression domain correlates with a more widespread spry4 transcription (such as in Fig. 2O,P). As Fgf8 is a secreted protein, we suggest that diffusion of growth factors away from the cells that produce it may be at the origin of the expression of spry4 in cells that lack fgf8 transcripts. The extent of spry4 expression may therefore provide a molecular readout of the range of FGF signaling activity during embryonic development. In addition, we have found that following the implantation of Fgf8-secreting beads, the intensity of induced spry4 expression diminishes as the distance from the bead increases (Fig. 5E,F), suggesting that the induction occurs in a dose-dependent manner. Consistent with this, a dorsoventral expression gradient of fgf8 at the margin of the gastrula correlates with a similarly graded distribution of spry4 transcripts (Fig. 2E,F).
In contrast to the usual situation, spry4 and fgf8 are expressed in complementary rather than overlapping domains in the hypophysis and the pectoral and caudal fins (Fig. 2U-X). fgf8 transcripts localize to the adenohypophysis (Fig. 2U), while spry4 is detected in adjacent neurohypophysal cells (Fig. 2V). An analysis of FGFRs expression in this domain has allowed us to identify the adenohypophysis as a source and the neurohypophysis as a target of FGF signaling: none of the four zebrafish FGFRs is expressed in the adenohypophysis, whereas FGFR2 is detectable in the neurohypophysis (not shown). The lack of a functional FGF signal transduction machinery provides therefore a straightforward explanation for the absence of spry4 expression in Fgf8-producing adenohypophysal cells. Similarly, the predominant expression of FGFRs in the mesenchymal aspect of the fins suggests that the AER represents a source rather than a target of FGF signaling, explaining thereby its lack of spry4 expression (Thisse et al., 1995
; Poss et al., 2000
; M. F., C. T. and B. T., unpublished).
Induction of spry4 by FGF family members
In ace homozygous mutant embryos, spry4 transcripts are undetectable at the MHB at all developmental stages. As Fgf8 has been shown to be required for the maintenance of this region, it is important to note that spry4 expression is already abolished at the early developmental stages (Fig. 3) when other MHB markers, like pax2.1 and engrailed 2 are still expressed (Reifers et al., 1998
). The absence of spry4 expression in this territory is therefore directly related to the impairment of Fgf8 signaling, and not just a secondary consequence of the loss of the isthmic region.
In contrast, a complete loss of spry4 expression in the telencephalon requires the simultaneous inhibition of both Fgf3 and Fgf8 (Fig. 4I,J). These two growth factors appear to act redundantly in the forebrain, at least as far as the induction of their common target gene spry4 is concerned.
Loss of Fgf8 function does not affect the expression of spry4 in the neurohypophysis and the fin bud mesenchyme, suggesting that spry4 induction there is mediated mainly by other factors. Consistent with this, spry4-expressing cells in the neurohypophysis are surrounded not only by fgf8-expressing adenohypophysal cells but also by Fgf3-producing cells in the ventral hypothalamus (not shown).
In the mouse embryo, inactivation of Fgf8 has been shown to cause a complete loss of spry4 expression, suggesting that Fgf8 may be its unique inducer (Minowada et al., 1999
). In contrast to this, we have shown that zebrafish spry4 responds to signaling by several FGF family members.
Drosophila spry has been shown to respond not only to FGF signaling, but also to activation of the EGF, torso and sevenless receptor tyrosine kinases (Casci et al., 1999
). To investigate whether FGFR-independent pathways are important for spry4 expression, we have used the pharmacological inhibitor SU5402 (Fig. 4K,L). Nevertheless, in addition to FGF signaling, SU5402 also affects signaling by the vascular endothelial growth factor (Vegf) receptor (Mohammadi et al., 1997
). Zebrafish Vegf is, however, unlikely to act as an inducer of spry4, as neither Vegf itself nor its receptor (Flk1) display extensive co-expression with spry4 (Liang et al., 1998
; Liao et al., 1997
). As FGF inhibitor treatment results in a complete loss of spry4 expression, this shows that spry4 responds only to FGF signaling.
Antagonistic effect of spry4 on Fgf8 and Fgf3 signaling
The first member of the Sprouty family was initially isolated in Drosophila as an antagonist of FGF signaling during tracheal morphogenesis. Correlation between expression patterns of fgf8, fgf3 and spry4 suggest that members of Spry family in vertebrate may have a similar FGF antagonistic function. We tested functionally this hypothesis using gain- and loss-of-function experiments. By microinjection of low amount of spry4 mRNA we were able to generate phenotypes similar to loss of fgf8 function (as observed in acerebellar mutation or after fgf8 morpholino injection), which are characterized by the lack of cerebellum and the reduction of otic vesicle size (Fig. 6B). Injection of higher amount of spry4 mRNA gave rise to ventralization phenotype, which reflects alteration of dorsoventral patterning (Fig. 6I-L). This phenotype coincides with the role of Fgf8 at early developmental stages that we previously showed to be dorsal inhibitor of BMP gene expression (Fürthauer et al, 1997
). In accordance with this observation, overexpression of Spry4 results in a dorsal expansion of BMP expression patterns (Fig. 6M,N). Nevertheless, while Fgf8 overexpression induces a dorsalisation of the embryo (Fürthauer et al., 1997
), the loss of Fgf8 function in ace mutant embryos is accompanied only by minor dorsoventral patterning defects (Reifers et al., 1998
). fgf3 is co-expressed with fgf8 at blastula stages, and its overexpression also induces a similar dorsalization of the embryo (not shown). This suggests that the two factors act redundantly during the early stages of dorsoventral patterning. The ventralized phenotype that results from Spry4 overexpression could therefore be due to the simultaneous inhibition of the dorsalizing activity of both Fgf8 and Fgf3 and possibly also other FGFs expressed at gastrula stage (Draper et al, 1999
). This interpretation is further reinforced by our loss-of-function experiments. Indeed, inhibition of spry4 activity through morpholino oligonucleotide injection gives rise to weak dorsalization phenotypes. This can easily be interpreted as a local upregulation of fgf8 and fgf3 signaling that results from the decrease of their feedback inhibitor. These two sets of experiments therefore strongly suggest that Spry4 acts as a functional FGF inhibitor during embryonic development. We therefore designed a functional assay to prove the antagonistic effect of Spry4 on Fgf8 and Fgf3. We showed that Spry4 is able to prevent formation of a partial secondary axis mediated by the ventral overexpression of Fgf8 or Fgf3 (Fig. 8). This establishes for the first time in vertebrates that a member of the Spry family acts in vivo as a functional antagonist of FGF signaling.
FGFR1 transduces the Fgf8 and Fgf3 signal
Signaling by Fgf8 and Fgf3 at early developmental stages can be mediated by only two of the four FGF receptors (FGFR1 and FGFR4) because the other begin to be expressed after the end of gastrulation. While in vitro binding assays strongly suggest that Fgf8 has a higher affinity for FGFR4 than for FGFR1 (Ornitz et al, 1996
), the similar phenotypes observed after the targeted inactivation of Fgf8 (Sun et al., 1999
) or of FGFR1 (Yamaguchi et al., 1994
) in the mouse suggest that FGFR1 is more likely to be the receptor that mediates the FGF8 signaling at early developmental stages in vivo.
In this study we have shown that overexpression of constitutively activated forms of FGFR1 and FGFR4 gives rise to different phenotypes. Only CA-FGFR1 induces a strong dorsalization similar to a misexpression of Fgf8 or Fgf3 (Fig. 8E). Therefore, in zebrafish, FGFR1 is likely to be the receptor that mediates the Fgf8 and Fgf3 activity at early developmental stages.
Implication of FGFR1/Ras signaling in dorsoventral patterning
In Xenopus, numerous studies have revealed that the FGFR1/Ras/Raf/MEK/MAPK signaling cascade is implicated in the induction of mesoderm in response to FGF signals (Whitman and Melton, 1992
; MacNicol et al., 1993
; Umbhauer et al., 1995
; Umbhauer et al, 2000
). Although our results are in perfect agreement with the involvement of FGFR1 in a signaling pathway leading to activation of MAPK, the contribution of this signaling pathway to early embryonic development appears to be different in the two species: in zebrafish, the Fgf8/Fgf3/FGFR1/Ras signaling pathway is not implicated in mesoderm induction, but rather affects the dorsoventral patterning of the embryo through an early inhibition of ventral BMP expression.
Models of growth factor inhibition
Recent years have led to the isolation of a growing number of growth factor inhibitors (Capdevila and Belmonte, 1999
). In some instances, signaling molecules and their inhibitors are expressed in complementary domains. For example, the BMP antagonists chordin and noggin 1 are expressed on the dorsal side of the zebrafish embryo and inhibit the activity of ventrally expressed BMPs (Fürthauer et al., 1999
; Miller-Bertoglio et al., 1997
). The secretion of BMPs and their antagonists from opposite sides of the embryo results in the formation of a gradient of growth factor activity that ultimately establishes the dorsoventral patterning of the embryo.
In contrast to this, spry4 and fgf8 are most frequently expressed in overlapping domains. A similar co-expression is observed for the activin/nodal antagonist antivin, and the zebrafish nodal-related genes cyclops and squint (Thisse et al., 2000
). spry4 and antivin are expressed in response to induction by FGF or activin/nodal signaling, respectively, showing that they act as feedback-inhibitors. The co-expression of a growth factor and its antagonist may affect cell communication in two different ways. First, the differential diffusion of a growth factor and its antagonist may be involved in the shaping of a morphogen gradient, a mechanism that has been shown to pattern the anteroposterior axis of the zebrafish embryo by activin/nodal signaling (Thisse et al., 2000
). Alternatively, the delayed induction of an inhibitor by its cognate growth factor may ensure a temporal limitation of growth factor responsiveness of the target cell population. For example, the pseudoreceptor BAMBI blocks signaling through transforming growth factor β receptors, inducing thereby the desensitization of the embryonic cells to BMP/activin signaling (Onichtchouk et al., 1999
).
The strikingly dynamic evolution of spry4 expression in response to Fgf8 and Fgf3 could be important for both a temporal or a spatial limitation of FGF signaling. Future studies will address the relative importance of these two possibilities.
|
|
|
|
|
|
|
|
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Amaya, E., Musci, T. J. and Kirschner, M. W. (1991). Expression of a dominant negative mutant of the FGF receptor disrupts mesoderm formation in Xenopus embryos. Cell 66, 257-270.[Medline]
Brand, M., Heisenberg, C. P., Jiang, Y. J., Beuchle, D., Lun, K., Furutani-Seiki, M., Granato, M., Haffter, P., Hammerschmidt, M., Kane, D. A. et al. (1996). Mutations in zebrafish genes affecting the formation of the boundary between midbrain and hindbrain. Development 123, 179-190.[Abstract]
Capdevila, J., and Belmonte, J. C. (1999). Extracellular modulation of the Hedgehog, Wnt and TGF-beta signalling pathways during embryonic development. Curr. Opin. Genet. Dev. 9, 427-433.[Medline]
Casci, T., Vinos, J. and Freeman, M. (1999). Sprouty, an intracellular inhibitor of Ras signaling. Cell 96, 655-665.[Medline]
Chambers, D., Medhurst, A. D., Walsh, F. S., Price, J. and Mason, I. (2000). Differential display of genes expressed at the midbrain – hindbrain junction identifies sprouty2: an FGF8-inducible member of a family of intracellular FGF antagonists. Mol. Cell. Neurosci. 15, 22-35.[Medline]
Draper B. W., Phillips, J. B., Stock, D. W. and Kimmel, C. B. (1999). FGF signaling and mesodermal patterning in the zebrafish embryo. Dev. Biol. 210,151-180.[Medline]
Fernig, D. G. and Gallagher, J. T. (1994). Fibroblast growth factors and their receptors: an information network controlling tissue growth, morphogenesis and repair. Prog. Growth Factor Res. 5, 353-377.[Medline]
Fürthauer, M., Thisse, B. and Thisse, C. (1999). Three different noggin genes antagonize the activity of bone morphogenetic proteins in the zebrafish embryo. Dev. Biol. 214, 181-196.[Medline]
Fürthauer, M., Thisse, C. and Thisse, B. (1997). A role for FGF-8 in the dorsoventral patterning of the zebrafish gastrula. Development 124, 4253-4264.[Abstract]
Gabey, L., Seger, R. and Shilo, B. Z. (1997). In situ activation pattern of Drosophila FGF receptor pathway during development. Science 277, 1103-1106.
Hacohen, N., Kramer, S., Sutherland, D., Hiromi, Y. and Krasnow, M. A. (1998). sprouty encodes a novel antagonist of FGF signaling that patterns apical branching of the Drosophila airways. Cell 92, 253-263.[Medline]
Johnson, D. E. and Williams, L. T. (1993). Structural and functional diversity in the FGF receptor multigene family. Adv. Cancer Res. 60, 1-41.[Medline]
Kiefer, P., Strahle, U. and Dickson, C. (1996). The zebrafish Fgf-3 gene: cDNA sequence, transcript structure and genomic organization. Gene 168, 211-215.[Medline]
Kishimoto, Y., Lee, K. H., Zon, L., Hammerschmidt, M. and Schulte-Merker, S. (1997). The molecular nature of zebrafish swirl: BMP2 function is essential during early dorsoventral patterning. Development 124, 4457-4466.[Abstract]
Kouhara, H., Hadari, Y. R., Spivak-Kroizman, T., Schilling, J., Bar-Sagi, D., Lax, I. and Schlessinger, J. (1997). A lipid-anchored Grb2-binding protein that links FGF-receptor activation to the Ras/MAPK signaling pathway. Cell 89, 693-702.[Medline]
Kramer, S., Okabe, M., Hacohen, N., Krasnow, M. A. and Hiromi, Y. (1999). Sprouty: a common antagonist of FGF and EGF signaling pathways in Drosophila. Development 126, 2515-2525.[Abstract]
Lamb, T. M. and Harland, R. M. (1995). Fibroblast growth factor is a direct neural inducer, which combined with noggin generates anterior-posterior neural pattern. Development 121, 3627-3636.[Abstract]
Liang, D., Xu, X., Chin, A. J., Balasubramaniyan, N. V., Teo, M. A., Lam, T. J., Weinberg, E. S. and Ge, R. (1998). Cloning and characterization of vascular endothelial growth factor (VEGF) from zebrafish, Danio rerio. Biochim. Biophys. Acta 1397, 14-20.[Medline]
Liao, W., Bisgrove, B. W., Sawyer, H., Hug, B., Bell, B., Peters, K., Grunwald, D. J. and Stainier, D. Y. (1997). The zebrafish gene cloche acts upstream of a flk-1 homologue to regulate endothelial cell differentiation. Development 124, 381-389.[Abstract]
Lin, X., Buff, E. M., Perrimon, N. and Michelson, A. M. (1999). Heparan sulfate proteoglycans are essential for FGF receptor signaling during Drosophila embryonic development. Development 126, 3715-3723.[Abstract]
Lister, J. A., Robertson, C. P., Lepage, T., Johnson, S. L. and Raible, D. W. (1999). nacre encodes a zebrafish microphthalmia-related protein that regulates neural-crest-derived pigment cell fate. Development 126, 3757-3767.[Abstract]
Lowenstein, E. J., Daly, R. J., Batzer, A. G., Li, W., Margolis, B., Lammers, R., Ullrich, A., Skolnik, E. Y., Bar-Sagi, D. and Schlessinger, J. (1992). The SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signaling. Cell 70, 431-442.[Medline]
MacNicol, A. M., Muslin, A. J. and Williams, L. T. (1993). LT.Raf-1 kinase is essential for early Xenopus development and mediates the induction of mesoderm by FGF. Cell 73, 571-583.[Medline]
Martin, G. R. (1998). The roles of FGFs in the early development of vertebrate limbs. Genes Dev. 12, 1571-1586.
Metzger, R. J. and Krasnow, M. A. (1999). Genetic control of branching morphogenesis. Science 284, 1635-1639.
Meyers, E. N., Lewandoski, M. and Martin, G. R. (1998). An Fgf8 mutant allelic series generated by Cre- and Flp-mediated recombination. Nat. Genet. 18, 136-141.[Medline]
Miller-Bertoglio, V. E., Fisher, S., Sanchez, A., Mullins, M. C. and Halpern, M. E. (1997). Differential regulation of chordin expression domains in mutant zebrafish. Dev. Biol. 192, 537-550.[Medline]
Minowada, G., Jarvis, L. A., Chi, C. L., Neubuser, A., Sun, X., Hacohen, N., Krasnow, M. A. and Martin, G. R. (1999). Vertebrate Sprouty genes are induced by FGF signaling and can cause chondrodysplasia when overexpressed. Development 126, 4465-4475.[Abstract]
Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh, B. K., Hubbard, S. R. and Schlessinger, J. (1997). Structures of the tyrosine kinase domain of fibroblast growth factor receptor in complex with inhibitors. Science 276, 955-960.
Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene knockdown in zebrafish. Nat. Genet. 26, 216-220.[Medline]
Onichtchouk, D., Chen, Y. G., Dosch, R., Gawantka, V., Delius, H., Massague, J. and Niehrs, C. (1999). Silencing of TGF-beta signalling by the pseudoreceptor BAMBI. Nature 401, 480-485.[Medline]
Ornitz, D. M., Xu, J., Colvin, J. S., McEwen, D. G., MacArthur, C. A., Coulier, F., Gao, G. and Goldfarb, M. (1996). Receptor specificity of the fibroblast growth factor family. J. Biol. Chem. 271, 15292-15297.
Partanen, J., Schwartz, L. and Rossant, J. (1998). Opposite phenotypes of hypomorphic and Y766 phosphorylation site mutations reveal a function for Fgfr1 in anteroposterior patterning of mouse embryos. Genes Dev. 12, 2332-2344.
Poss, K. D., Shen, J., Nechiporuk, A., McMahon, G., Thisse, B., Thisse, C. and Keating, M. T. (2000). Roles for fgf signaling during zebrafish fin regeneration. Dev. Biol. 222, 347-358.[Medline]
Reich, A., Sapir, A. and Shilo, B. (1999). Sprouty is a general inhibitor of receptor tyrosine kinase signaling. Development 126, 4139-4147.[Abstract]
Reifers, F., Bohli, H., Walsh, E. C., Crossley, P. H., Stainier, D. Y. and Brand, M. (1998). Fgf8 is mutated in zebrafish acerebellar (ace) mutants and is required for maintenance of midbrain-hindbrain boundary development and somitogenesis. Development 125, 2381-2395.[Abstract]
Reifers, F., Walsh, E. C., Leger, S., Stainier, D. Y. and Brand, M. (2000). Induction and differentiation of the zebrafish heart requires fibroblast growth factor 8 (fgf8/acerebellar). Development 127, 225-235.[Abstract]
Sternberg, P. W. and Alberola-Ila, J. (1998). Conspiracy theory: RAS and RAF do not act alone. Cell 95, 447-450.[Medline]
Summerton, J. (1999). Morpholino antisense oligomers: the case for an RNase H-independent structural type. Biochim. Biophys. Acta 1489, 141-158.[Medline]
Sun, X., Meyers, E. N., Lewandoski, M. and Martin, G. R. (1999). Targeted disruption of Fgf8 causes failure of cell migration in the gastrulating mouse embryo. Genes Dev. 13, 1834-1846.
Tefft, J. D., Lee, M., Smith, S., Leinwand, M., Zhao, J., Bringas, P., Jr, Crowe, D. L. and Warburton, D. (1999). Conserved function of mSpry-2, a murine homolog of Drosophila sprouty, which negatively modulates respiratory organogenesis. Curr. Biol. 9, 219-222.[Medline]
Thesleff, I. and Sharpe, P. (1997). Signalling networks regulating dental development. Mech. Dev. 67, 111-123.[Medline]
Thisse, B., Thisse, C. and Weston, J. A. (1995). Novel FGF receptor (Z-FGFR4) is dynamically expressed in mesoderm and neurectoderm during early zebrafish embryogenesis. Dev. Dyn. 203, 377-391.[Medline]
Thisse, B., Wright, C. V. and Thisse, C. (2000). Activin- and Nodal-related factors control antero-posterior patterning of the zebrafish embryo. Nature 403, 425-428.[Medline]
Umbhauer, M., Marshall, C. J., Mason, C. S., Old, R. W. and Smith, J. C. (1995). Protein, nucleotide mesoderm induction in Xenopus caused by activation of MAP kinase. Nature. 376, 58-62.[Medline]
Umbhauer, M., Penzo-Mendez, A., Clavilier, L., Boucaut, J. and Riou, J. (2000). Signaling specificities of fibroblast growth factor receptors in early Xenopus embryo. J. Cell Sci. 113, 2865-2875.[Abstract]
Whitman, M. and Melton, D. A. (1992).Involvement of p21ras in Xenopus mesoderm induction. Nature 357, 252-254.[Medline]
Yamaguchi, T. P., Harpal, K., Henkemeyer, M. and Rossant, J. (1994). fgfr-1 is required for embryonic growth and mesodermal patterning during mouse gastrulation. Genes Dev. 8, 3032-3044.
This article has been cited by other articles:
![]() |
N. A. Sanek, A. A. Taylor, M. K. Nyholm, and Y. Grinblat Zebrafish zic2a patterns the forebrain through modulation of Hedgehog-activated gene expression Development, November 15, 2009; 136(22): 3791 - 3800. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Edwin, K. Anderson, C. Ying, and T. B. Patel Intermolecular Interactions of Sprouty Proteins and Their Implications in Development and Disease Mol. Pharmacol., October 1, 2009; 76(4): 679 - 691. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. de Pater, L. Clijsters, S. R. Marques, Y.-F. Lin, Z. V. Garavito-Aguilar, D. Yelon, and J. Bakkers Distinct phases of cardiomyocyte differentiation regulate growth of the zebrafish heart Development, May 15, 2009; 136(10): 1633 - 1641. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-J. Kwak, B. T. Phillips, R. Heck, and B. B. Riley An expanded domain of fgf3 expression in the hindbrain of zebrafish valentino mutants results in mis-patterning of the otic vesicle Development, March 13, 2003; 129(22): 5279 - 5287. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Amacher, B. W. Draper, B. R. Summers, and C. B. Kimmel The zebrafish T-box genes no tail and spadetail are required for development of trunk and tail mesoderm and medial floor plate Development, March 9, 2003; 129(14): 3311 - 3323. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Reim and M. Brand spiel-ohne-grenzen/pou2 mediates regional competence to respond to Fgf8 during zebrafish early neural development Development, March 4, 2003; 129(4): 917 - 933. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lim, P. Yusoff, E. S. M. Wong, S. Chandramouli, D.-H. Lao, C. W. Fong, and G. R. Guy The Cysteine-Rich Sprouty Translocation Domain Targets Mitogen-Activated Protein Kinase Inhibitory Proteins to Phosphatidylinositol 4,5-Bisphosphate in Plasma Membranes Mol. Cell. Biol., November 15, 2002; 22(22): 7953 - 7966. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. B. David, L. Saint-Etienne, M. Tsang, T. F. Schilling, and F. M. Rosa Requirement for endoderm and FGF3 in ventral head skeleton formation Development, January 10, 2002; 129(19): 4457 - 4468. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kudoh, M. Tsang, N. A. Hukriede, X. Chen, M. Dedekian, C. J. Clarke, A. Kiang, S. Schultz, J. A. Epstein, R. Toyama, et al. A Gene Expression Screen in Zebrafish Embryogenesis Genome Res., December 1, 2001; 11(12): 1979 - 1987. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||