|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||

Program in Molecular Biology, Sloan-Kettering Institute, Memorial
Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021, USA
*
Present address: Graduate Program at Vanderbilt University, Cell Biology
Department, Vanderbilt University, Nashville, TN 37232-2175
Author for correspondence (e-mail:
m-baylies{at}ski.mskcc.org
)
Accepted 14 June 2001
| SUMMARY |
|---|
|
|
|---|
Loss of function analyses, misexpression and dosage experiments, and biochemical studies indicate that heterodimers of Twist and Daughterless repress genes required for somatic myogenesis. We propose that these two opposing roles explain how modulated Twist levels promote the allocation of cells to the somatic muscle fate during the subdivision of the mesoderm. Moreover, this work provides a paradigm for understanding how the same protein controls a sequence of events within a single lineage.
Key words: Muscle, Myogenesis, daughterless, Tethered dimers, Twist, Drosophila melanogaster
| INTRODUCTION |
|---|
|
|
|---|
Twist belongs to a family of transcription factors characterized by the
basic-helix-loop-helix (bHLH) motif (Murre et al.,
1989a
; Thisse et al.,
1988
). These factors
participate in many developmental decisions, including sex determination,
neurogenesis, segmentation and myogenesis (for review see Jan and Jan,
1993
). The HLH region mediates
protein dimerization whereas the basic region is necessary for HLH dimers to
contact DNA (Murre et al.,
1989a
; Murre et al.,
1989b
). Different classes of
bHLH proteins act as either positive or negative transcriptional regulators;
for example, in Drosophila, members of the achaete-scute
complex are thought to heterodimerize with the Daughterless (Da) protein, bind
to specific DNA sequences and activate target genes that promote neurogenesis
(Campuzano et al., 1985
;
Cabrera and Alonso, 1991
;
Cronmiller et al., 1988
; Caudy
et al., 1988a
; Caudy et al.,
1988b
), while Hairy is thought
to exclusively form homodimers that repress transcription (Rushlow et al.,
1989
; Ohsako et al.,
1994
). Moreover, individual
bHLH homodimers and heterodimer combinations differ in DNA binding affinity,
target preference site and inferred biological activities, suggesting that
partner choice is a key regulation point (Jones,
1990
; Kadesch,
1993
).
Several lines of experimentation suggest that Twist forms dimers that have
distinct functions during development. Genetic studies have revealed two
twist alleles (twistv50 and
twistry50) that are temperature sensitive only when in
trans with one another. Neither allele is temperature sensitive by
itself or over a deficiency, but
twistv50/twistry50 survive at 18°C and die
at 29°C (Thisse et al.,
1987
). This suggests that the
two mutant proteins form a temperature sensitive dimer. Temperature shift
experiments indicate that this homodimer functions early, to direct
specification of mesoderm (Thisse et al.,
1987
; Leptin et al.,
1992
), and during allocation
of somatic muscle (Baylies and Bate,
1996
). These results also
suggest that Twist homodimers are capable of activating mesodermal and somatic
muscle specific genes.
In vertebrates, the Twist protein is a negative regulator of
differentiation in several lineages, including myogenesis and osteogenesis
(Hopwood et al., 1989
; Wolf et
al., 1991
; Fuchtbauer,
1995
; Gitelman,
1997
; Wang et al.,
1997
; Chen and Behringer,
1995
; Howard et al.,
1997
; el Ghouzzi et al.,
1997
; Maestro et al.,
1999
). Mouse Twist inhibits
myogenesis by titrating E proteins and by forming heterodimeric complexes that
block DNA binding of E heterodimers with myogenic bHLH transcription factors
like MyoD (Spicer et al.,
1996
; Hebrok et al.,
1997).
Here, we show that, depending on dimer partner, Twist acts either as an
activator or a repressor of somatic muscle development. We present evidence
that Twist homodimers activate early mesoderm as well as the later allocation
of mesodermal cells into the somatic muscle fate. Consistent with Da being
expressed in the mesoderm (Cronmiller and Cummings,
1993
), analysis of Da loss of
function, dosage experiments with Twist and biochemical experiments indicate
that heterodimers of Twist and Da repress somatic myogenesis. Hence dimer
partners in vivo provide a key regulatory interaction which modifies Twist
behavior throughout the development of the mesoderm. This work thus provides a
model for understanding how a single transcription factor regulates multiple
events in a single lineage in vivo.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Transgenic lines carrying UAS-twist-twist and
UAS-twist-da linked dimers were generated by injection of yw
embryos, according to published procedures (Rubin and Spradling,
1982
; Spradling and Rubin,
1982
). Six and seven
independent transformant lines, respectively, were obtained and expanded into
homozygous stocks.
Constructs
For in vitro transcription/translation reactions, pNB40 or pCDNA3
containing twist (provided by N. Brown) and da (provided by
M. Caudy) cDNAs were used. To create a truncated Twist (bHLHTwist),
twist cDNA was digested with BamHI and then religated in
frame, eliminating amino acids 141-331. To construct Twist-Twist and Twist-Da
linked dimers, pCDNA3 containing a flexible polypeptide linker was used
(provided by M. Markus and R. Benezra; M. Markus,
2000
; Neuhold and Wold,
1993
). The N-terminal Twist
monomer was amplified by PCR and cloned as a blunt-ended fragment into pCDNA3,
in frame with the flexible linker. The C-terminal Twist (or Da) monomer was
also amplified by PCR and cloned in frame after the linker (see Figs
1B,
7C). Construct integrity was
verified by sequencing. For P-element transformation, the tethered dimers were
subcloned into pUAST (Brand and Perrimon,
1993
). For tissue culture
experiments, full-length twist cDNA was subcloned as a 1.7 kb
HindIII-NotI fragment into pCDNA3, which contains the CMV
promoter (Invitrogen). da cDNA and the linked dimers were subcloned
into the same vector.
|
|
DNA binding assays
The Twist binding site from rhomboid (rho;
GATCCCTCG-CATATGTTGAA) containing a canonical E-box (bold letters) was
the probe in mobility shift experiments (Ip et al.,
1992
). The Da oligonucleotide
(GATCCCTCGCACCTGTTGAA) was derived from the rho site and was
engineered to match known Da binding sites (Ohsako et al.,
1994
). The mutated
oligonucleotide for competition assays was GATCCCTCGAGTATGTTGAA.
Oligonucleotides were annealed and labeled with digoxigenin, using the DIG gel
shift kit (Roche Molecular Biochemicals). To test labeling efficiency, a dot
blot was performed according to the manufacturer's protocol.
In vitro translated protein products (Promega TnT Kit) were incubated in 2
mM DTT at 37°C for 10 minutes (Markus,
2000
). After a 5 minute
equilibration to 25°C, protein products were added to 50 fmol of 3'
digoxigenin-labeled oligonucleotide probe. A typical 25 µl reaction mixture
contained 1 µg poly d(I-C), 2 mM MgCl2, 25 mM Hepes pH 7.5, 100
mM NaCl, 0.1% Igepal CA-630, 12% glycerol (v/v). The mixture was separated by
electrophoresis at 10 Volts/cm through 5% polyacrylamide gel
(acrylamide-bisacrylamide, 29:1-3.3%) in 0.25x TBE. The gel was
transferred to a nylon membrane (Roche Molecular Biochemicals) using a
semi-dry transfer. The membrane was developed following the manufacturer's
protocol.
Determination of apparent dissociation constants
Apparent Kds were determined by gel shift analysis of Twist, Da
and Twist/Da heterodimers in which equivalent amounts of input protein were
mixed with a range of DNA concentrations of E-box oligonucleotides and binding
was determined. A Hill plot [(free oligonucleotide) versus (bound
oligonucleotide/1-bound oligonucleotide)] was prepared with the apparent
Kd being equal to the X-intercept.
Cell culture and transfections
For transfection assays, the expression vector pCDNA3 containing twist,
da, twist-twist or twist-da was used. A reporter construct
containing a 175 bp Mef2 enhancer (Cripps et al.,
1998
) was subcloned upstream
of the luciferase gene in the pGL2 Basic Vector (Promega). Equal
molar amounts of plasmids containing twist, da, twist-twist or
twist-da were cotransfected with 3 µg reporter plasmid and 3 µg
actin-lacZ plasmid to control for transfection efficiency (a gift
from T. Lieber). The DNA concentration for each transfection was equalized by
addition of pBluescript plasmid to a final concentration of 20 µg.
Schneider Line 2 cells (SL2; a gift from T. Lieber) were maintained at 25°C in Schneider's Drosophila medium (M3) supplemented with 12.5% fetal calf serum (FCS) and 1% penicillin/streptomycin solution. The day before transfection, cells were seeded at approx. 80% confluence into 12-well tissue culture plates (Falcon 3043). Cells were transfected with a ratio of 1:3 nucleic acid/DOSPER (Roche Molecular Biochemicals) mixture. After a 15 minute incubation at 25°C, the mixture was added drop by drop to the cultures. 24 hours later, the medium was removed, 2 ml of fresh M3 containing 12.5% FCS and antibiotics were added, and the cells incubated for a further 24 hours prior to harvesting.
Transfected cells were harvested by scraping attached cells into culture medium and collecting all adherent and non-adherent SL2 cells by centrifugation. The cells were washed twice with 5 ml 1x PBS (phosphate-buffered saline), resuspended in 250 µl 1x lysis buffer (125 mM Tris pH 7.8, 10 mM EDTA, 10 mM DTT, 50% glycerol, 5% Triton X-100), and incubated at 25°C for 10 minutes. Cells were lysed by freezing and thawing. 30 µl of lysate from each transfection was assayed for Luciferase activity in a luminometer (LUMAT LB 9501; Berthold) using Luciferase assay reagent (Roche Molecular Biochemicals). 5 µl of lysate was measured for absorbance at 574 nm to determine the amount of ß-galactosidase activity using the substrate chlorophenol-red-ß-D-galactopyranoside monosodium salt. The data shown are mean values of at least three independent, triplicated transfections and are expressed as the fold activation obtained in each sample over luciferase activity generated by addition of pCDNA3 (control). Luciferase activity is normalized against ß-galactosidase activity. Each construct was titrated to determine the linear range of activity. Selected points shown.
Immunocytochemistry
Embryos for immunocytochemistry were harvested at 25°C, following
standard techniques for whole mounts (Rushton et al.,
1995
). Antibody dilutions were
as follows: anti-myosin (1:1000; Keihart and Feghali, 1986); anti-Twist
(1:5000; provided by S. Roth); anti-Even-skipped (1:800; provided by J.
Reinitz and D. Kosman); anti-Fasciclin III (Fas III; also known as Fas3
(FlyBase); 1:100; Developmental Studies Hybridoma Bank, University of Iowa);
anti-zfh1 (1:1000; provided by Z. Lai);
anti-Krüppel (1:2000; provided by J. Reinitz and
D. Kosman); anti-ß-galactosidase (1:1000; Promega); anti-Heartless
(1:2000; provided by A. Michelson); anti-S59; and anti-Bagpipe (1:500;
provided by M. Frasch).
Double staining for anti-ß-galactosidase and the appropriate second antibody were performed in the rescue experiment and whenever blue balancers were present. To compare intensity of staining for the da1 experiments, wild-type embryos were mixed with the mutant embryo collection and processed together under identical conditions. Biotinylated secondary antibodies were used in combination with the Vector Elite ABC kit (Vector Laboratories, CA). For detection of Bap-antibody, we used a biotinylated secondary antibody and fluorescein (FICT)-labeled streptavidin. Specimens were embedded in Araldite. Images were captured using a DXC-970MD camera (Sony). Different focal planes were combined into one picture using Adobe Photoshop software.
| RESULTS |
|---|
|
|
|---|
Twist homodimers promote mesoderm and somatic muscle formation
We next tested whether Twist homodimers are functional in vivo. To increase
formation of Twist homodimers, we physically linked two monomers by a flexible
glycine-serine polylinker, which results in an increase in local concentration
of these proteins and, therefore, favors dimer formation (Neuhold and Wold,
1993
). This
"tethered" dimer strategy has been used successfully by several
groups including Neuhold and Wold (Neuhold and Wold,
1993
) and Sigvardsson et al.
(Sigvardsson et al., 1997
) to
determine the function and specificity of MyoD and E homodimers and
heterodimers. Fig. 1B shows the
configuration of the tethered Twist homodimer. The two Twist genes are joined
in a head to tail arrangement. This tethered form of Twist bound the
rho E-boxes and promoted activation of a Mef2 muscle
enhancer reporter construct (Cripps et al.,
1998
) in tissue culture,
similarly to unlinked Twist dimers (Fig.
1C,D). Hence, both in in vitro assays and in tissue culture, the
linked homodimers of Twist are capable of mimicking aspects of Twist
function.
We then assayed whether this tethered form can replicate Twist's ability to
induce mesoderm/somatic muscle in vivo. Previous studies have shown that
over-expression of Twist in ectoderm and mesoderm leads to ectopic muscle
formation (Baylies and Bate,
1996
). Like the Twist monomer,
over-expression of the tethered Twist dimer in the ectoderm led to a dramatic
transformation of ectodermal cells into mesoderm and somatic muscle. We
detected expression of muscle specific proteins such as myosin heavy chain
(Mhc) in the most external cell layer. Many of the Mhc-expressing cells were
multinucleate, a hallmark of somatic muscle formation
(Fig. 2A,G,M; cf. Baylies and
Bate, 1996
). In addition,
ectodermal tissues such as the nervous system and the epidermis were not
produced in these embryos (not shown; cf. Baylies and Bate,
1996
).
|
Over-expression of Twist monomers or tethered Twist homodimers in the
mesoderm, using twist-GAL4, converted non-somatic mesoderm into
somatic muscle. Ectopic multinucleated somatic muscles were detected dorsally
where the heart normally forms and around the gut and central nervous system.
For clarity, we show ventral views demonstrating the presence of these ectopic
syncytial Mhc-positive muscles (Fig.
2B,H,N). Since individual muscles are seeded by a special set of
myoblasts, the founder cells (for review see Baylies et al.,
1998
), we asked whether more
founder cell gene expression could be detected. Consistent with the ectopic
formation of somatic muscles, we found an increase in founder gene expression
such as Krüppel (Kr), both
dorsally (Fig. 2C,I,O) and
around the gut (Fig. 3).
Concomitant with the gain in cells adopting a somatic muscle fate, a loss in
cells contributing to other mesodermal tissues was found. Progenitors of the
visceral muscles and fat body, marked by Bagpipe (Bap) expression, were
reduced (Fig. 2F,L,R) as well
as the number of visceral muscle progenitors expressing Fas III
(Fig. 2E,K,Q). We likewise
detected a decrease in both pericardial and cardial cells that contribute to
the heart (Fig. 2D,J,P). The
migration of the mesoderm was normal under these conditions (data not shown).
Moreover, we find enhanced activation of the Mef2 enhancer-reporter
construct when the linked dimer was expressed (data not shown). Hence
over-expression of tethered Twist homodimers mimicked the effects of
over-expression of Twist monomers in both the ectoderm and mesoderm.
|
The most stringent test for activity of Twist homodimers is whether
tethered Twist dimers can substitute for endogenous Twist during mesoderm and
somatic muscle development. To express tethered Twist dimers or Twist monomers
in twist null mutant embryos, we used the GAL4/UAS system, which has
been successfully used by Ranganayakulu et al. (Ranganayakulu et al.,
1998
) to drive the expression
of tin in tin mutant embryos. Moreover, Staehling-Hampton et
al. (Staehling-Hampton et al.,
1994
) showed
twist-GAL4 driven expression of Decapentaplegic (Dpp) led to the
induction of a target gene, bap, as the ventral furrow forms.
Expression of Twist monomers in embryos null for twist (e.g.,
twist-GAL4, twistID96/twistID96; UAS-Twist or
twist-GAL4; twist-GAL4
twistID96/twistID96;UAS-twist) completely rescued
mesodermal development. The rescued embryos developed, hatched and
subsequently gave rise to fertile adults.
Fig. 4 shows that tethered
Twist homodimers, expressed under similar conditions, rescued early mesodermal
defects associated with loss of endogenous twist. Genes that fail to
be expressed in twist mutant embryos, including Htl
(Fig. 4E,J,O) and Mef2
(data not shown) were induced in these embryos. Mesoderm migration occurred,
yet subsequent mesodermal differentiation was abnormal. Somatic muscles formed
but with an aberrant pattern (Fig.
4A,F,K). Visceral muscle progenitors were missing
(Fig. 4D,I,N), as well as the
majority of both pericardial and cardial heart cells
(Fig. 4C,H,M). Instead
multinucleated somatic muscles were found dorsally where the heart normally
develops (Fig. 4B,G,L) and
around the gut (not shown). Thus, the two early functions of Twist,
specification of mesoderm and allocation of somatic mesoderm, were rescued by
the tethered dimer. However, the somatic muscle mispatterning and the severe
reduction of visceral and heart muscle suggested that tethered homodimer
expression failed to completely rescue all Twist functions during mesoderm
development. This failure was not due simply to low levels of tethered dimer
expression since somatic muscle allocation, which requires high levels of
Twist (cf. Baylies and Bate,
1996
), was rescued by this
construct. Moreover, different UAS insertions give similar results. We
conclude that Twist homodimers can execute two roles of Twist, the induction
of mesoderm-specific genes and specification of the somatic muscle
lineage.
|
Twist forms heterodimers with Daughterless, a ubiquitously expressed
bHLH protein required for mesoderm development
As described above, the tethered Twist homodimers cannot completely rescue
the twist null phenotype, raising the possibility that other Twist
dimer forms are required for proper development. In this regard, vertebrate
tissue culture experiments showed that Drosophila Twist can also
heterodimerize with E proteins inhibiting muscle-specific gene activation
(Spicer et al., 1996
).
The Drosophila E protein homologue, Daughterless, like its
vertebrate counterparts, is expressed ubiquitously and participates in a
number of developmental processes (Cronmiller and Cummings,
1993
; Cline,
1989
; Caudy,
1988a
; Caudy,
1988b
; Cronmiller et al.,
1988
). We first investigated
whether loss of Da had any effect on myogenesis. Reduction of both maternal
and zygotic levels of Da had drastic consequences for mesodermal development.
Twist expression was reduced during mesoderm induction and was nearly absent
during mesodermal subdivision (Fig. 5E,J
and D,I). Genes such as Htl, Mef2, and zfh1 were
detected but at lower levels (data not shown). Despite these alterations, the
mesoderm migrated properly; however, further mesodermal development is
impaired. For example, somatic muscle development was severely suppressed,
with embryos showing reduced numbers of aberrantly placed, Mhc-positive
syncytial muscles (Fig. 5A,F).
Heart development was also repressed (Fig.
5B,G), although not as dramatically as visceral mesoderm
(Fig. 5C,H). Since the maternal
and zygotic loss of Da function gave such a drastic mesodermal phenotype, we
decided to analyze the mesodermal phenotype of embryos lacking only the
zygotic Da.
|
Mesodermal differentiation was less dramatically affected in zygotic null da mutant embryos. For example, visceral muscle developed normally (Fig. 6F,L), whereas losses in both pericardial and cardial cells were detected in a low percentage of embryos (Fig. 6E,K). In contrast, somatic muscles showed greater defects. These alterations, although detectable in every embryo, varied from segment to segment. We found both duplications of somatic muscles (Fig. 6A,G) and losses (Fig. 6B,H), suggesting a possible role for Da in the patterning of somatic muscles. These changes in the final muscle pattern could be correlated with increases and losses in founder cell gene expression. For example, we detected more Kr cells (data not shown) as well as losses in S59 (Slouch) expression in some clusters (Fig. 6D,J). In addition, we found ectopic Even-skipped (Eve) expression (Fig. 6C,I), suggesting that in these da mutant embryos, more somatic mesoderm is being allocated. Considering both sets of Da loss-of-function data, we conclude that Da plays a critical role at all stages in myogenesis: in mesoderm specification (through induction of high Twist levels), during mesoderm subdivision (as witnessed by founder gene expression in ectopic locations), and in the patterning of the somatic muscles (as shown by duplications and losses of somatic muscles).
|
Since Da could partner any number of bHLH proteins that are present at these different stages of mesodermal development (i.e. L'scute, Nautilus, etc.), we next asked whether Twist could physically interact with Da and what the outcome of this interaction would be.
Mobility shift experiments performed by mixing Twist and Da proteins
produced DNA-protein complexes with intermediate mobility, indicative of
heterodimer formation (Fig.
7A). DNA binding assays performed with two different E boxes, one
a canonical Da binding site (CACCTG) (Ohsako et al.,
1994
) and the other the Twist
binding site from rho (CATATG) (Ip et al.,
1992
) indicated different
binding affinities for Twist and Da dimers. Whereas the Twist/Da heterodimers
had approximately equal affinity for either site, the apparent Kd
for Twist homodimer's favored site (CATATG) was an order of magnitude
greater than for the Da site (CACCTG) (4.2x10-7 M
versus 1.3x10-6 M respectively), even though the flanking
sequences for both sites are the same (Fig.
7A).
Expression of Da alone or in combination with Twist in SL2 cells led to little activation of the Mef2 reporter construct (Fig. 7B). Competition experiments in which Da levels were increased while Twist levels were held constant showed a decrease in reporter gene activation (not shown). These data indicate that Da did not activate the Mef2 mesoderm-specific reporter and Da reduced Twist's ability to activate the reporter. Repression by Da could be achieved either by competing for E box binding as Da homodimers or by forming heterodimers with Twist. These Twist/Da heterodimers can lead to the reduction in reporter activation by competition for the target E box as well as titration of Twist monomers.
Since the in vitro experiments indicated that Twist and Da were able to form dimers and that these dimers repressed the activity of a gene required for myogenesis, we next sought in vivo evidence for Twist and Da interactions. Flies heterozygous for twist or da showed no mutant phenotype. However, when the zygotic dose of da was reduced by half while one copy of Twist was misexpressed in the mesoderm, we find greater losses in gut and heart forming mesoderm (Fig. 8K,L) as compared to misexpressing one copy of Twist in a wild-type background (Fig. 8E,F). This effect was enhanced further using two copies of Twist (Fig. 8H,I and N,O). In addition, we found more ectopic somatic muscle in these da heterozygous embryos (Fig. 8A,D,G,J,M). Conversely, overexpression of Da in the mesoderm of wild-type embryos had little to no effect on mesodermal development (data not shown). However, if we reduced the dose of Twist by half, while overexpressing Da in the mesoderm, we saw a dramatic suppression of somatic muscle fate (Fig. 9F). No increase in other mesodermal tissues was found (Fig. 9H,I). Taken together, both the in vitro data and the dosage experiments indicate that Twist and Da do physically interact and that the function of this heterodimer is to repress somatic muscle development.
|
|
Linked Twist-Da heterodimers repress myogenesis in vivo
To test directly whether the Twist/Da heterodimer repress myogenesis in
vivo, we made a tethered Twist-Da dimer. This construct, which linked the two
proteins in a head to tail fashion, is shown in
Fig. 7C. Mobility shift
analysis indicated that the tethered dimers bind E boxes similarly to
heterodimers formed by Twist and Da monomers
(Fig. 7D). Consistent with
previous results with the Mef2-enhancer reporter construct,
transfection of the tethered dimer failed to activate this enhancer in SL2
cells (Fig. 7B). Competition
experiments in which Twist or tethered Twist-Twist levels were held constant
with increasing amounts of Twist-Da showed decreased activation, suggesting
that Twist-Da heterodimers compete with Twist homodimers for E box binding
(not shown). These in vitro experiments showed that tethered Twist-Da
heterodimers function similarly to untethered Twist/Da heterodimers.
Transgenic flies in which the tethered Twist-Da heterodimers were over-expressed in the mesoderm using twist-GAL4 revealed an extreme muscle phenotype. The somatic musculature is greatly reduced, with the remaining muscles showing defects in patterning and size (compare Fig. 9A,F,K). The tethered Twist-Da dimer produced defects that are generally more severe than overexpression of Da alone in the twist heterozygous background, with fewer intact Mhc-positive syncytial cells. Other mesodermal tissues, such as visceral muscle, are initially unaffected by over-expression of Da or tethered Twist-Da heterodimers, as measured by Bap expression (Fig. 9D,I,N). However, mild defects in the later differentiation of these tissues were found, presumably due to prolonged expression of the protein in our experiments (Fig. 9C,H,M).
Since Mhc expression gives a late readout of myogenesis, we determined when somatic muscle development first went awry in these embryos. Fig. 9 shows that the defect caused by over-expression of Da or tethered Twist-Da occurred just after the allocation of mesodermal cells to the somatic muscle fate. The number of founder cells, marked by Kr expression is decreased in the Twist-Da or Da over-expression embryos (Fig. 9B,G,L). In addition, the earliest marker of individual muscle formation, lethal of scute (L'sc), was significantly reduced or absent in these embryos (data not shown). Consistent with the transient transfection assays, we also saw reduction in Mef2-reporter activation in vivo (Fig. 9E,J,O), indicating that steps which initiate programs common to all somatic muscles such as fusion, regulation of the contractile apparatus, etc, were also suppressed in these embryos. Although cells were accurately allocated to the somatic mesodermal pathway as measured, for example, by Twist expression in the Da over-expression experiments, the subsequent differentiation of these cells was blocked. Earlier mesodermal events (prior to subdivision) such as migration are unaffected under these conditions (data not shown). We conclude that the earliest somatic muscle defect associated with tethered Twist-Da heterodimer or Da over-expression occurred just after mesodermal cells were allocated to somatic myogenesis. We find a repression of somatic muscle differentiation at a time when Twist homodimers activate this process.
| DISCUSSION |
|---|
|
|
|---|
Different partner, different function
Unlike previous reports where functions of an HLH protein are attributed
exclusively to a heterodimer (i.e. Achaete (Ac)/Da; Cabrera and Alonso,
1991
) or homodimer forms (i.e.
Hairy/Hairy; Ohsako et al.,
1994
), we find distinct
activities associated both with Twist homodimers and Twist/Da heterodimers.
The only other bHLH protein to which distinct functions have been linked to
different dimer forms is the ubiquitously expressed vertebrate E proteins. E
homodimers act uniquely in B cells to promote transcriptional activation from
the IgH enhancer in the heavy chain locus, whereas heterodimers of E with
other tissue-specific bHLHs such as MyoD activate transcription of target
genes (Kadesch, 1992
;
Sigvardsson et al., 1997
). Our
results suggest that alternate functions for dimer pairs maybe a more general
phenomenon, extending to tissue-specific bHLH proteins as well.
Previous data suggest that Twist functions to induce mesoderm and the
somatic myogenic program (Leptin,
1991
; Baylies and Bate,
1996
). We interpret our data as
showing that Twist homodimers are responsible for activation of early
mesodermal and somatic myogenic programs. Domain mapping suggests that an
amino-terminal region of Twist is required for transcriptional activation (I.
C. and M. K. B., unpublished). Experiments are in progress to determine how
this domain functions in transcriptional activation and to assess why one
domain is not sufficient for activation when Twist is dimerized with Da. One
possibility is that pairing of this region recruits co-activators essential
for Twist activation and this region is masked upon dimerization with another
HLH protein.
Like the vertebrate E proteins, Da functions in many different processes
during fly development (Cline,
1989
; Jan and Jan,
1993
). We show here that Da
also plays a significant role during mesodermal development. In particular, Da
is responsible primarily for inducing high levels of Twist (also shown by
Gonzalez-Crespo and Levine,
1993
). Since levels of Twist
are so critical to mesodermal development, many effects seen in the
da maternal and zygotic loss-of-function could be explained by this
reduction in Twist levels. Similar reductions in heart, visceral muscle and
somatic muscle tissues can be detected in embryos carrying hypomorphic Twist
alleles either over a deficiency or over themselves as well as in embryos
carrying the temperature sensitive allelic combination of twist grown
at the nonpermissive temperature prior to gastrulation (Thisse et al.,
1987
; Leptin et al.,
1992
; Baylies unpub.).
However, the data also suggest that Da performs additional roles in the
mesoderm, both in the allocation and patterning of cells of the heart and
somatic muscle. In this regard, it is interesting that other bHLH proteins
including dHand, L'scute, and Nautilus are expressed in the heart and/or
somatic muscles and may partner Da to execute these functions (Carmena et al.,
1995
; Moore et al.,
2000
; Michelson et al.,
1990
; Paterson et al.,
1991
).
Dimers of Da with tissue-specific proteins critical for neurogenesis, such
as the achaete-scute family members, have been detected both in vitro
and in embryo extracts. Genetic analyses suggest that Da/Ac and Da/Sc dimers
are required for activation of genes essential for neural fate
(Dambly-Chaudiere et al.,
1988
; Cabrera and Alonso,
1991
). Two activation domains
have been predicted in Da (Quong et al.,
1993
) and confirmed in SL2
cells (K. G. and M. K. B., unpublished), supporting Da's role as a
transcriptional activator. Dimers of Da and Emc, an HLH with no basic domain
(Ellis et al., 1990
; Garrell
et al., 1990
), have also been
detected. These Da/Emc dimers fail to bind DNA and lead to the effective
decrease in available Da monomers (Martinez et al.,
1993
; Cabrera et al.,
1994
; Van Doren et al.,
1991
). In this report, we
present another function for Da as a partner for Twist: Twist/Da heterodimers
result in repression of somatic myogenesis genes. This repressive role for Da
is unlike any previously described Da roles. Although Da, like Twist, is an
activating protein in other contexts, dimerization of Twist/Da in the mesoderm
leads to repression.
Repression by Da can be mediated by several mechanisms. First, Da homodimers compete for binding to mesoderm/somatic muscle E boxes. Second, Da monomers compete with Twist monomers to form heterodimers. Third, both our in vitro and in vivo experiments indicate that Twist/Da heterodimers also compete with Twist homodimers for DNA binding to E boxes. These modes of competition effectively reduce activator Twist homodimer levels, consistent with reduction in the Mef2-enhancer reporter activity that we detect both in tissue culture and in vivo upon tethered Twist/Da heterodimer expression. Our data also indicate that Twist homodimers have a greater affinity for the Twist E box compared to Twist/Da heterodimers or Da homodimers. Whether this difference is significant in vivo awaits further tests, but the results do highlight how different dimer partners alter binding affinity, and as a result, the eventual fate of the cell.
Opposing functions for Twist in a developmental context: Twist
activity during the Subdivision of the mesoderm
We suggest that these data clarify how Twist acts during subdivision of the
mesoderm. At stage 10, in response to transcriptional regulators such as
Sloppy paired and Even skipped as well as signals from the overlying ectoderm
such as Wingless, the uniform expression of Twist modulates into regions of
high and low expression within each segment (Azpiazu et al.,
1996
; Riechmann et al.,
1997
; Bate and Rushton,
1993
). Da is expressed
uniformly in the mesoderm at this time. The region that maintains high Twist
levels subsequently give rise to somatic muscles whereas the region that has
lower Twist levels gives rise to tissues such as visceral muscle, fat body,
gonadal mesoderm and some glia cells (Dunin-Borokowski et al.,
1995
; Baylies and Bate,
1996
) The heart is derived from
the region that initially expresses high levels of Twist; however these cells
lose Twist expression, an event necessary for the execution of heart fate
(this work, Baylies and Bate
1996
). Expressing high Twist
levels in cells destined to become visceral muscle, for example, blocks
visceral muscle differentiation and promotes somatic muscle. Reduction of
Twist levels in cells normally expressing high Twist levels blocks somatic
myogenesis (Baylies and Bate,
1996
).
We now provide several possible mechanisms to explain these observations and illustrate the in vivo roles for the two opposing activities of Twist homodimers and Twist/Da heterodimers (Fig. 10). Regions that normally express lower Twist levels do not form somatic muscles owing to higher concentrations of Twist/Da heterodimers as compared to Twist homodimers. These heterodimers repress transcription of promuscle genes, such as l'sc as well as founder cell genes such as Kr, thereby prohibiting somatic muscle development. Other differentiation programs for visceral muscle or fat body development can proceed unaffected. We find no evidence that Twist/Da heterodimers promote visceral mesoderm or fat body fate through the direct activation of targets such as Fas III. Regions that normally express higher Twist levels do form somatic muscle owing to higher concentrations of Twist homodimers as compared to Twist/Da heterodimers. Dimer competition, then, restricts the developmental potential of mesodermal cells, by not allowing Twist homodimers to convert all mesodermal cells into somatic muscle.
|
These conclusions are consistent with the observations that increasing
Twist/Da levels, either by overexpression of Da or the tethered Twist-Da
heterodimer, repress the earliest steps in somatic myogenesis. These are the
same steps that are activated by Twist homodimers. For example, L'sc
expression, which marks clusters of equipotential cells that segregate the
muscle founder cells (Carmena et al.,
1995
), is drastically reduced
or absent upon an increase of Twist/Da heterodimers. This indicates an early
failure in the somatic muscle program. Likewise we see failure in subsequent
steps; for example, few founder cells as well as few identifiable muscles are
detected. We interpret these failures in muscle development as an outcome of
the initial block in the differentiation pathway. We have not, however,
eliminated the possibility that overexpression of Da or of Twist-Da could
directly repress these subsequent steps. Gal4 lines that drive expression at
later stages of muscle development or in particular subsets of muscle cells
(i.e., the S59-expressing founder cells) could provide insight into this
alternative.
We also have not ruled out the possibility that Twist forms dimers with HLH
proteins in addition to Da. Although our in vitro results indicate that Twist
does not dimerize with mesodermal HLH proteins such as Emc or L'sc
(unpublished), Twist may dimerize with new HLH proteins predicted from the
genome sequence (Moore et al.,
2000
). These dimers may be
required for the accurate patterning of the somatic muscles.
Twist and the HLH network in vertebrates multiple functions
through dimerization?
Tissue culture experiments reveal that vertebrate Twist and in particular,
mouse Twist, repress myogenesis induced by members of the MyoD family. Spicer
et al. (Spicer et al., 1996
)
concluded that the form of mouse Twist that mediates this repression is a
heterodimer between Twist and the Da homologue, E protein. This mouse Twist/E
heterodimer mediates repression by blocking E box binding by MyoD, by
titrating E protein and by inhibiting MEF2 transactivation. Thus, evolution
has conserved one activity for Twist that spans both fly, mouse and perhaps
human a repressive activity in the form of Twist/Da (E).
Data from Twist knockout mice (Chen and Behringer,
1995
) or from patients with
Saethre-Chozten syndrome, which is caused by mutations in human Twist (Howard
et al., 1997
; el Ghouzzi et
al., 1997
), fail to provide
any evidence of an activator role for vertebrate Twist during skeletal
myogenesis. However, an activator role for vertebrate Twist, be it in an
homodimeric form or with an unknown partner, cannot be ruled out for Twist's
activity in neural crest, limb or for its newly described role as an apoptosis
inhibitor. Our data suggest that vertebrate Twist homodimers can readily be
detected in mobility shift assays using E boxes that are favored by
Drosophila Twist homodimers (manuscript in prep). The sequence of
this particular subset of E boxes may predict targets of Twist homodimers both
in fly and in vertebrates.
In Drosophila, there is only one Twist; in mice, Twist belongs to
a family of closely related bHLH genes, including Twist, Scleraxis, Dermo 1
and Paraxis (Cserjesi et al.,
1995
; Li et al.,
1995
; Burgess et al.,
1995
). These additional family
members have overlapping patterns of expression. For example, Twist and
Scleraxis are both expressed in the early mesoderm as well as the sclerotome
(Fuchtbauer, 1995
; Stoetzel et
al., 1995
; Gitelman,
1997
; Brown et al.,
1999
). Hence in vertebrates,
there is added complexity for dimerization between Twist and E protein
families. These various homodimer and heterodimer forms provide more potential
for regulating "Twist" activities. Our work with
Drosophila Twist lends support to the notion that cell fate is the
sum of the activities of a complex number of HLH proteins rather than the
omniscient activity of just one protein.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Anant, S., Roy, S. and VijayRaghavan, K., (1998) Twist and Notch negatively regulate adult muscle differentiation in Drosophila. Development 125,1361 -1369.[Abstract]
Azpiazu, N. and Frasch, M. (1993).
tinman and bagpipe: Two homeo box genes that determine cell
fates in the dorsal mesoderm of Drosophila. Genes Dev.
7,1325
-1340.
Azpiazu, N., Lawrence, P., Vincent, J. P. and Frasch, M.
(1996). Segmentation and specification of the Drosophila
mesoderm. Genes Dev. 10,3183
-3194.
Bate, M. (1990). The embryonic development of
larval muscles in Drosophila. Development
110,791
-804.
Bate, M., Rushton, E. and Currie, D. A. (1991). Cells with persistent twist expression are the embryonic precursors of adult muscles in Drosophila. Development 113, 79-89.[Abstract]
Bate, M. and Rushton, E. (1993). Myogenesis and muscle patterning in Drosophila. C. F. Acad. Sci. III. 316,1047 -1061.
Baylies, M. K. and Bate, M. (1996). twist, A myogenic switch in Drosophila.Science 272,1481 -1484.[Abstract]
Baylies, M. K., Bate, M. and Ruiz-Gomez, M. (1998). Myogenesis, a View from Drosophila.Cell 93,921 -927.[Medline]
Baylies, M. K., Martinez-Arias, A. and Bate, M. (1995). wingless is required for the formation of a subset of muscle founder cell during Drosophila embryogenesis. Development 121,3829 -3837.[Abstract]
Beiman, M., Shilo, B. Z. and Volk, T. (1996).
Heartless, a Drosophila FGF Receptor homolog, is essential for cell
migration and establishment of several mesodermal lineages. Genes
Dev. 10,2993
-3002.
Bodmer, R. (1993). The gene tinman is required for specification of the heart and visceral muscles in Drosophila. Development 118,719 -729.[Abstract]
Bour, B., O'Brien, M. A., Lockwood, W., Goldstein, E. S.,
Bodmer, R., Taghert, P., Abmayr, S. M. and Nguyen, H. T.
(1995). Drosophila MEF2, a transcription factor that is
essential for myogenesis. Genes Dev.
4,1322
-1331.
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]
Brown, D., Wagner, D., Li, X., Richardson, J. and Olson, E. (1999). Dual role of the basic helix-loop-helix transcription factor scleraxis in mesoderm formation and chondrogenesis during mouse embryogenesis. Development 126,4317 -4329.[Abstract]
Burgess, R., Cserjesi, P., Ligon, K. and Olson, E. (1995). Paraxis, a basic helix-loop-helix protein expressed in paraxial mesoderm and developing somites. Dev. Biol. 168,296 -306.[Medline]
Cabrera, C. V. and Alonso, M. C. (1991). Transcriptional activation by heterodimers of the achaete-scute and daughterless gene products of Drosophila. EMBO J. 10,2965 -2973.[Medline]
Cabrera, C. V., Alonso, M. C. and Huikeshoven, H. (1994). Regulation of scute function by extramachrochaete in vitro and in vivo. Development 120,3595 -3603.[Abstract]
Campuzano, S., Carramolino, L., Cabrera, C., Ruiz-Gomez, M., Villares, R., Boronat, A. and Modolell, J. (1985). Molecular genetics of the achaetescute gene complex of Drosophila melanogaster. Cell 40,327 -338.[Medline]
Carmena, A., Bate, M. and Jimenez, F. (1995). lethal of scute, a proneural gene, participates in the specification of muscle progenitors during Drosophila embryogenesis. Genes Dev. 9,549 -561.
Caudy, M., Grell, E., Dambly-Chaudiere, C., Ghysen, A., Jan, L.
and Jan, Y. (1988a). The maternal sex determination gene
daughterless has zygotic activity necessary for the formation of the
peripheral neurons in Drosophila. Genes Dev.
2, 843-852.
Caudy, M., Vaessin, H., Brand, M., Tuma, R., Jan, L. and Jan, Y. (1988b). daughterless, a Drosophila gene essential for both neurogenesis and sex determination, has sequence similarities to myc and the achaete-scute complex. Cell 55,1061 -1067.[Medline]
Chen, Z. and Behringer, R. (1995).
twist is required in head mesenchyme for cranial neural tube
morphogenesis. Genes Dev.
9, 686-699.
Cline, T. (1989). The affairs of daughterless and the promiscuity of developmental regulators. Cell 59,231 -234.[Medline]
Cripps, R., Black, B., Zhao, B., Lien, C. Schulz, R. and Olson,
E. (1998). The myogenic regulatory gene Mef2 is a direct
target for transcriptional activation by Twist during Drosophila
myogenesis. Genes Dev.
12, 422-434
Cripps, R. and Olson, E. (1998b) Twist is required form muscle template splitting during adult Drosophila myogenesis. Dev. Biol. 203,106 -115.[Medline]
Cronmiller, C. and Cummings, C. (1993). The daughterless gene product in Drosophila is a nuclear protein that is broadly expressed throughout the organism during development. Mech. Dev. 42,159 -169.[Medline]
Cronmiller, C., Schedl, P. and Cline, T.
(1988). Molecular Characterization of daughterless, a
Drosophila sex determination gene with multiple roles in development.
Genes Dev. 2,1666
-1676.
Cox, V. and Baylies, M. (2001). Investigating somatic muscle specification through analysis of the twist promoter. A. Dros. Res. Conf. 42,673A .
Cserjesi, P., Brown, D., Ligon, K., Lyons, G., Copeland, N., Gilbert, D., Jenkins, N. and Olson, E. (1995). Scleraxis, a basic helix-loop-helix protein that prefigures skeletal formation during mouse embryogenesis. Development 121,1099 -1110.[Abstract]
Currie, D. and Bate, M. (1991). Development of adult abdominal muscles in Drosophila: Adult myoblasts express twist and are associated with nerves. Development 113,91 -102.[Abstract]
Dambly-Chaudiere, C., Ghysen, A., Jan, L. and Jan, Y. (1988). The determination of sense organs in Drosophila: Interactions of scute with daughterless. Wilhelm Roux's Arch. Dev. Biol. 197,419 -423.
Dunin-Borokowski, O., Brown, N. and Bate, M. (1995). Anterior-posterior subdivision and the diversification of the mesoderm in Drosophila. Development 121,4183 -4193.[Abstract]
Ellis, H. M., Spann, D. and Posakony, J. (1990). Extramacrochaete, a negative regulator of sensory organ development in Drosophila, defines a new class of helix-loop-helix proteins. Cell 61,27 -38.[Medline]
Ephrussi, A., Church, G., Tonegawa, S. and Gilbert, W. (1985). B lineage-specific interactions of an immunoglobulin enhancer with cellular factors invivo. Science 250,1104 -1111.
Fernandes, J., Bate, M. and VijayRaghavan, K. (1991). Development of the indirect flight muscles of Drosophila. Development 113, 67-77.[Abstract]
Fuchtbauer, E. (1995). Expression of Mtwi during post-implantation development of the mouse. Dev. Dyn. 204,316 -322.[Medline]
Garrell, J. and Modellel, J. (1990). The Drosophila extramacrochaete locus, an antagonist of proneural genes, that like these genes, encodes a helix-loop-helix protein. Cell 61,39 -48.[Medline]
el Ghouzzi, V., Le Merrer, M., Perrin-Schmitt, F., Lajeunie, E., Benit, P., Renier, D., Bourgeois, P., Bolcato-Bellemin, AL., Munnich, A. and Bonaventure, J. (1997). Mutations of the TWIST gene in the Saethre-Chotzen syndrome. Nature Genet. 15, 42-46.[Medline]
Gisselbrecht, S., Skeath, J., Doe, C. and Michelson, A.
(1996). Heartless encodes a fibroblast growth factor receptor
involved in the directional migration of early mesodermal cells in the
Drosophila embryo. Genes Dev.
10,3003
-3017.
Gitelman, I. (1997). Twist protein in mouse embryogenesis. Dev. Biol. 189,205 -214.[Medline]
Gonzalez-Crespo, S. and Levine, M. (1993).
Interactions between dorsal and helix-loop-helix proteins initiate the
differentiation of the embryonic mesoderm and neuroectoderm in Drosophila.Genes Dev. 7,1703
-1713.
Hebrok, M., Wurtz, K. and Fuchtbauer, E. (1994). M-Twist is an inhibitor of muscle differentiation. Dev. Biol. 165;527 -544.[Medline]
Hopwood, N., Pluck, A. and Gurdon, J. (1989). A Xenopus mRNA related to Drosophila twist is expressed in response to induction in the mesoderm and the neural crest. Cell 59,893 -903.[Medline]
Howard, T. D., Paznekas, W., Green, E., Chiang, L., Ma, N., Ortiz de Luna, R., Garcia Delgado, C., Gonzalez-Ramos, M., Kline, A. and Jabs, E. (1997). Mutations in TWIST, a basic helix-loop-helix transcription factor, in Saethre-Chotzen syndrome. Nature Genet. 15,36 -41,[Medline]
Ip, Y. T., Park, R., Kosman, K., Bier, E. and Levine, M.
(1992). The dorsal gradient morphogen regulates stripes of
rhomboid expression in the presumptive neuroectoderm of the
Drosophila embryo. Genes Dev.
6,1728
-1739.
Jan, Y. and Jan, L. (1993). HLH proteins, fly neurogenesis, and vertebrate myogenesis. Cell 75,827 -830.[Medline]
Jones, N. (1990). Transcriptional Regulation by Dimerization: Two Sides to an Incestous Relationship. Cell 61,9 -11.[Medline]
Kadesch, T. (1992). Helix-loop-helix proteins in the regulation of immunoglobulin gene transcription. Immunol. Today 13,31 -36.[Medline]
Kadesch, T. (1993). Consequences of Heteromeric Interactions among Helix-loop-helix proteins. Cell Growth Diff. 4,49 -55.[Medline]
Kierhart, D. and Feghali, R. (1986).
Cytoplasmic myosin from Drosophila melanogaster. J. Cell
Biol. 103,1517
-1525.
Leptin, M. (1991). Twist and snail as positive
and negative regulators during Drosophila mesoderm development.
Genes Dev. 5,1568
-1576.
Leptin, M., Casal, J., Grunewald, B. and Reuter, R. (1992). Mechanisms of early Drosophila mesoderm formation. Development Supplement23 -31.
Li, L., Cserjesi, P. and Olson, E. (1995). Dermo-1: a novel twist-related bHLH protein expressed in the developing dermis. Dev. Biol. 172,280 -292.[Medline]
Lilly, B., Shao, B., Ranganayakulu, G., Paterson, B., Schulz, R. and Olson, E. (1995). Requirement of MADS domain transcription factor D-MEF2 for muscle formation in Drosophila.Science 267,1404 -1407.
Maestro, R., Dei Tos, A., Hamamori, Y., Krasnokutsky, S.,
Sartorelli, V., Kedes, L., Doglioni, C., Beach, D. and Hannon, G.
(1999). Twist is a potential oncogene that inhibits apoptosis.
Genes Dev. 13,2207
-2217.
Markus, M. (2000). E protein Homodimers, Regulation by Redox and Repression. Doctoral Thesis, Cornell University.
Martinez, C., Modolell, J. and Garrell, J.
(1993). Regulation of the proneural gene achaete by
helix-loop-helix proteins. Mol. Cell. Biol.
13,3514
-3521.
Michelson A.M., Abmayr S.M., Bate M., Arias A.M. and Maniatis,
T. (1990) Expression of a MyoD family member prefigures
muscle pattern in Drosophila embryos. Genes Dev.
4,2086
-2097.
Moore, A., Barbel, S., Jan, L. and Jan, Y.-N.
(2000) A genomewide survey of basic helix-loop-helix factors in
Drosophila. Proc. Natl. Acad. Sci. USA
97,10436
-10441.
Murre, C., McCaw, P. and Baltimore, D. (1989a). A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell 56,777 -783.[Medline]
Murre, C., McCaw, P., Vaessin, H., Caudy, M., Jan, L., Jan, Y., Cabrera, C., Buskin, J., Hauschka, S., Lassar, A., Weintraub, H. and Baltimore, D. (1989b). Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence. Cell 58,537 -544.[Medline]
Neuhold, L. and Wold, B. (1993). HLH Forced Dimers: Tethering MyoD to E47 generates a dominant positive myogenic factor insulated from negative regulation by Id. Cell 74,1033 -1042.[Medline]
Ohsako, S., Hyer, J., Pannganiban, G., Oliver, I. and Caudy,
M. (1994). Hairy functions as a DNA-binding helix-loop-helix
repressor of Drosophila sensory organ formation. Genes
Dev. 8,2743
-2755.
Paterson, B. M., Walldorf, U, Eldridge, J., Dubendorfer, A.,
Frasch, M. and Gehring W. J. (1991). The Drosophila homologue
of vertebrate myogenic-determination genes encodes a transiently expressed
nuclear protein marking primary myogenic cells. Proc. Natl. Acad.
Sci. USA 88,3782
-3786.
Quong, M., Massari, M., Zwart, R. and Murre, C.
(1993). A new transcriptional-activation motif restricted to a
class of helix-loop-helix proteins is functionally conserved in both yeast and
mammalian cells. Mol. Cell. Biol.
13,792
-800.
Ranganayakulu, G., Elliott, D., Harvey, R. and Olson, E. (1998). Divergent roles for NK-2 class homeobox genes in cardiogenesis in flies and mouse. Development 125,3037 -3048.[Abstract]
Riechmann, V., Irion, U., Wilson, R., Grosskortenhaus, R. and Leptin, M. (1997). Control of cell fates and segmentation in the Drosophila mesoderm. Development 124,2915 -2922.[Abstract]
Rubin, G. and Spradling, A. (1982). Genetic
transformation of Drosophila with transposable element vectors.
Science 218,348
-53
Rushton, E., Drysdale, R., Abmayr, S., Michelson, A. and Bate, M. (1995). Mutations in a novel gene, myoblast city, provide evidence in support of the founder cell hypothesis for Drosophila muscle development. Development 121,1979 -1988.[Abstract]
Rushlow, C., Hogan, A., Pinchin, S., Howe, K., Lardelli, M. and Ish-Horowicz, D. (1989). the Drosophila hairy protein acts in both segmentation and bristle patterning and has homology to N-myc. EMBO J. 8,3095 -3103.[Medline]
Shen, C. P. and Kadesch, T. (1995). B-cell-specific DNA binding by an E47 homodimer. Mol. Cell. Biol. 15,4518 -4524.[Abstract]
Shishido, E., Higashijima, S., Emori, Y. and Saigo, K. (1993). Two FGF-receptor homologues of Drosophila one is expressed in mesodermal primordium in early Embryos. Development 117,751 -761.[Abstract]
Shishido, E., Ono, N., Kojima, T. and Saigo, K. (1997). Requirements of DFR1/Heartless, a mesoderm-specific Drosophila FGF-receptor, for the formation of heart, visceral and somatic muscles, and ensheathing of longitudinal axon tracts in CNS. Development 124,2119 -2128.[Abstract]
Sigvardsson, M., O'Riordan, M. and Grosschedl, R. (1997). EBF and E47 collaborate to induce expression of the endogenous immunoglobulin surrogate light chain genes. Immunity 7,25 -36.[Medline]
Simpson, P. (1983). Maternal-zygotic gene interactions during formation of the dorsoventral pattern in Drosophila embryos. Genetics 105, 31-40.
Spicer, D., Rhee, J., Cheung, W. and Lassar, A. (1996). Inhibition of myogenic bHLH and MEF2 transcription factors by the bHLH twist. Science 254,1385 -1387.
Spradling A. and Rubin, G. (1982).
Transposition of cloned P elements into Drosophila germ line
chromosomes. Science
218,341
-347.
Staeling-Hampton, K., Hoffmann, F., Baylies, M., Rushton, E. and Bate, M. (1994). dpp induces mesodermal gene expression in Drosophila. Nature 372,783 -786.[Medline]
Stoetzel, C., Weber, B., Bourgeois, P., Bolcato-Bellemin, A., Perrin-Schmidt, F. (1995). Dorso-ventral and rostro-caudal sequential expression of M-twi in the postimplantation murine embryo. Mech. Dev. 51,251 -263.[Medline]
Taylor, M. V., Beatty, K., Hunter, H. and Baylies, M. (1995). Drosophila MEF2 is regulated by twist and is expressed in both the primordia and differentiated cells of the embryonic somatic, visceral and heart musculature. Mech. Dev. 50, 29-41.[Medline]
Thisse, B., El Messal, M. and Perrin-Schmidt, F.
(1987). The twist gene: Isolation of a
Drosophila gene necessary and sufficient for establishment of the
dorsoventral pattern. Nucleic Acids Res.
15,3439
-3453.
Thisse, B., Stoetzel, C., Gorostiza-Thisse, C. and Perrin-Schmidt, F. (1988). Sequence of the twist gene and nuclear localization of its protein in endomesodermal cells of early Drosophila embryos. EMBO J. 7,2175 -2183.[Medline]
Van Doren, M., Ellis, H. and Posakony, J. (1991). The Drosophila extramacrochaete protein antagonizes sequence-specific DNA binding by daughterless/achaete-scute protein complexes. Development 113,245 -255.[Abstract]
Wang, S., Coljee, V., Pignolo, R., Rotenberg, M., Cristafalo, V. and Sierra, F. (1997). Cloning of the human Twi gene: Its expression is retained in adult mesodermally derived tissues. Gene 187,83 -92.[Medline]
Wodarz, A., Hinz, U., Engelbert, M. and Knust, E. (1995). Expression of crumbs confers apical character on plasma membrane domains of ectodermal epithelia of Drosophila.Cell 82,67 -76[Medline]
Wolf, C., Thisse, C., Stoetzel, C., Thisse, B., Cerlinger, P. and Perrin-Schmidt, F. (1991). The M-twi gene of Mus is expressed in subsets of mesodermal cells and is closely related to the Xenopus X-twi and the Drosophila Twi genes. Dev. Biol. 143,363 -373.[Medline]
This article has been cited by other articles:
![]() |
M. B. Breslin, M. Zhu, and M. S. Lan NeuroD1/E47 Regulates the E-box Element of a Novel Zinc Finger Transcription Factor, IA-1, in Developing Nervous System J. Biol. Chem., October 3, 2003; 278(40): 38991 - 38997. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Stathopoulos and M. Levine Linear signaling in the Toll-Dorsal pathway of Drosophila: activated Pelle kinase specifies all threshold outputs of gene expression while the bHLH protein Twist specifies a subset Development, March 9, 2003; 129(14): 3411 - 3419. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Corsi, T. M. Brodigan, E. M. Jorgensen, and M. Krause Characterization of a dominant negative C. elegans Twist mutant protein with implications for human Saethre-Chotzen syndrome Development, January 6, 2002; 129(11): 2761 - 2772. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||