spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Movies
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lawson, N. D.
Right arrow Articles by Weinstein, B. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lawson, N. D.
Right arrow Articles by Weinstein, B. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 128, 3675-3683 (2001)
© 2001 The Company of Biologists Limited

Notch signaling is required for arterial-venous differentiation during embryonic vascular development

Nathan D. Lawson1, Nico Scheer2, Van N. Pham1, Cheol-Hee Kim1, Ajay B. Chitnis1, Jose A. Campos-Ortega2 and Brant M. Weinstein1,*

1 Laboratory of Molecular Genetics, NICHD, NIH, Bethesda, MD, 20892, USA
2 Institut für Entwicklungsbiologie, Universität zu Köln, 50923 Cologne, Germany

*Author for correspondence (e-mail: bw96w{at}nih.gov)

Accepted July 5, 2001


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Recent evidence indicates that acquisition of artery or vein identity during vascular development is governed, in part, by genetic mechanisms. The artery-specific expression of a number of Notch signaling genes in mouse and zebrafish suggests that this pathway may play a role in arterial-venous cell fate determination during vascular development. We show that loss of Notch signaling in zebrafish embryos leads to molecular defects in arterial-venous differentiation, including loss of artery-specific markers and ectopic expression of venous markers within the dorsal aorta. Conversely, we find that ectopic activation of Notch signaling leads to repression of venous cell fate. Finally, embryos lacking Notch function exhibit defects in blood vessel formation similar to those associated with improper arterial-venous specification. Our results suggest that Notch signaling is required for the proper development of arterial and venous blood vessels, and that a major role of Notch signaling in blood vessels is to repress venous differentiation within developing arteries.

Movies available on-line

Key words: Artery, Notch, Vein, Zebrafish


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The differentiated identity of arterial and venous blood vessels was thought to arise in response to hemodynamic forces such as blood pressure and the direction of blood flow. However, recent data suggest that molecular differences between arterial and venous endothelial cells are apparent well before the onset of circulation. The transmembrane ligand ephrin-B2 is expressed in an artery-specific fashion within both extraembryonic and embryonic blood vessels before circulation (Adams et al., 1999; Wang et al., 1998). Homozygous targeted disruption of ephrin-B2 results in defective remodeling of the yolk sac vascular plexus and decreased branching of cranial capillaries, as well as abnormal sprouting of intersomitic vessels and decreased vascularization of the neural tube. Expression of a tau-lacZ transgene recombined into the ephrin-B2 locus is maintained in arterial endothelial cells in the absence of functional ephrin-B2 (Wang et al., 1998), suggesting that it is not necessary for the initial specification of arterial fate. EphB4, the proposed receptor for ephrin-B2 within the cardiovascular system, is expressed at higher levels on venous endothelial cells (Adams et al., 1999; Gerety et al., 1999; Wang et al., 1998) and mice lacking EphB4 exhibit vascular abnormalities similar to mice lacking ephrin-B2 (Gerety et al., 1999). These observations suggest that establishing arterial and venous identity is a crucial step during embryonic vascular development. However, despite the functional relevance of artery and vein restricted expression of ephrin-B2 and EphB4, respectively, little is known about the upstream factors that are responsible for defining the differences between arteries and veins. It has recently been reported that mice lacking the activin receptor-like kinase-1 (ACVRL1) fail to express ephrin-B2 within their arterial vessels, suggesting a possible role for TGFß signaling during this process (Urness et al., 2000).

A number of signaling pathways have known roles in cell fate determination, including the Notch pathway. Notch is a large transmembrane receptor that is important in a wide array of developmental contexts for specifying cell populations with different fates and for defining the boundaries between them (Irvine, 1999; Muskavitch, 1994). In vertebrates, Notch signaling is required for normal neurogenesis, somite formation and lymphoid cell development (Chitnis et al., 1995; Conlon et al., 1995; Dornseifer et al., 1997; Ellisen et al., 1991; Pui et al., 1999; Takke et al., 1999). A variety of evidence suggests that Notch has an important role during blood vessel development. In the mouse, Notch1, 2 and 4 are expressed within endothelial cells (Del Amo et al., 1992; Uyttendaele et al., 1996; Zimrin et al., 1996). Targeted disruption of Notch4 shows that it is dispensable for vascular development (Krebs et al., 2000), while expression of an activated form of Notch4 within the endothelium disrupts normal vascular development (Uyttendaele et al., 2001) and mice lacking Notch1 display defects in angiogenic remodeling (Krebs et al., 2000). There is also evidence of a role for Notch signaling in vessel homeostasis. CADASIL (Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy), a human disease characterized by early adult onset stroke and dementia, is caused by mutations in Notch3 (Joutel et al., 1996) and its etiology has been ascribed to a vascular defect (Salloway and Hong, 1998).

Notch ligands are also expressed within the endothelium and are required for proper vessel development. Jagged1 is expressed in the developing endothelium and targeted disruption of the Jagged1 gene in mice results in defects in head and yolk sac angiogenesis, although the formation of the major vessels appears normal (Xue et al., 1999). In zebrafish, deltaC is expressed in migrating lateral mesodermal vascular progenitors, and at later stages its expression is restricted to the dorsal aorta (DA) (Smithers et al., 2000), while a recently described novel Notch ligand, Dll4, is expressed in a similar pattern in mouse (Shutter et al., 2000).

Potential downstream targets of Notch signaling have also been identified within the developing vascular system. The recently identified HRT proteins are hairy-related basic helix-loop-helix (bHLH) transcription factors that display vascular-specific expression in mice and humans (Chin et al., 2000; Nakagawa et al., 1999). Recently, mHRT2 was shown to be a direct target of Notch signaling in in vitro cultured cells (Nakagawa et al., 2000). A mutation in the zebrafish homolog of HRT2 was found to be responsible for the gridlock (grl) mutation (Zhong et al., 2000), which causes a localized vascular patterning defect within the DA (Weinstein et al., 1995). Interestingly, grl expression becomes restricted to the DA during blood vessel development (Zhong et al., 2000), suggesting a possible role in arterial-venous differentiation.

We provide evidence that Notch signaling is important for arterial-venous differentiation of blood vessels. We find that zebrafish notch3 is expressed in the DA, but not the posterior cardinal vein (PCV), during embryonic vascular development. Embryos lacking Notch activity fail to induce arterial-specific ephrinB2 (efnb2a) expression, and exhibit ectopic expression of venous markers within the DA. Furthermore, we show that activation of the Notch signaling pathway, either throughout the embryo or targeted to the endothelium, causes loss of venous-specific marker expression. Finally, perturbation of Notch signaling causes defects in vascular morphology similar to those observed in mice lacking ephrin-B2 or EphB4, including abnormal remodeling of the major trunk vessels and aberrant intersomitic vessel projection. Taken together, our results suggest that Notch signaling is required within the vasculature for proper arterial-venous differentiation and repression of venous cell fate.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Zebrafish
The wild-type line EK was obtained from Ekkwill Farms (Gibsonton, FL) and inbred for several generations. Fish heterozygous for mibta52b were provided by Julian Lewis (Imperial Cancer Research Fund, London). Fish and embryos were maintained as described previously (Westerfield, 1993). The hsp70:Gal4 and UAS:notch1a-intra ICD transgenic lines are described elsewhere (Scheer and Campos-Ortega, 1999; Scheer et al., 2001). Hemizygous adult fish were set up in multiple matings and eggs collected the following morning. The development of embryos was delayed by placing in a chilling incubator overnight at 24°C. The following day, embryos were heat shocked at either the 15- or 18-somite stage by transferring to a capped 50 ml culture flask (Nalge Nunc International, Rochester, NY) and incubating at 40°C for 15 or 30 minutes. Embryos were then incubated at 28.5°C until the 28- to 30-somite stage, after which they were fixed and processed for in situ hybridization.

Plasmids and probes
Plasmids encoding zebrafish tie1and flt4 were kindly provided by Leonard Zon (Children’s Hospital, Boston). A plasmid for zebrafish ephrinB2 was kindly provided by Michael Tsang (NICHD, Bethesda). A plasmid encoding tbx20 was graciously provided by Dae Gwon Ahm and Robert Ho (Princeton University, Princeton). Plasmid pBS 30D1.C, containing a fragment of zebrafish deltaC was provided by Julian Lewis (Imperial Cancer Research Fund, London). A plasmid containing the coding sequence of rtk5 was kindly provided by Julie Cooke (University College, London). A plasmid containing a fragment of the extracellular domain of notch3 (C.-H. K., unpublished data) was linearized with NcoI and transcribed with SP6.

The pCSGreen plasmid was constructed by digesting pEGFP-C1 (Clontech, Palo Alto, CA) with NheI and ligating to oligonucleotide linkers (5'-CTAGGCTTGATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAG and 5'-CTAGCTGCAAAAAGAACAAGTAGCTTGTATTCTATAGTGTCACCTAAATCAAGC) containing the SP6 promoter and 5' leader sequence found in pCS2+ (Rupp et al., 1994). An enhanced green fluorescent protein (EGFP)/XSu(H) DBM fusion construct was made by partially digesting pCS2+XSu(H)DBM (provided by C. Kintner, Salk Institute, San Diego) with EcoRI and XhoI. This fragment was cloned into pCSGreen digested with EcoRI and SalI to yield pCSGSuDN. Plasmids were linearized with MluI and mRNA was synthesized using the mMessage mMaker kit (Ambion, Inc., Austin, TX).

An XbaI fragment of the zebrafish fli1 promoter that includes 1 kb upstream of exon 1 and 6 kb of intron 1 was subcloned into pBluescript from a PAC obtained by hybridization to the 5' end of the fli1 cDNA (Brown et al., 2000). An oligonucleotide linker containing NheI, SrfI, and AscI sites was cloned into an MluI site upstream of the fli1 start codon to give pBS119d10L. A fragment encoding the intracellular domain (ICD) of zebrafish Notch3 was cloned in frame with the myc epitope in pCS3+MT. The cassette containing the myc-tagged Notch3 ICD and the polyA signal sequences was removed from pCS3 MTN3ICD by digesting with DraI and NotI, filled in with Klenow and cloned into pBS119d10L digested with SrfI to give pflimTN3ICD.

In situ hybridization and immunostaining
Whole-mount in situ hybridization was performed as described previously (Hauptmann and Gerster, 1994). Immunostaining was performed as described previously (Westerfield, 1993) using monoclonal antibody 9E10 (Berkeley Antibody Co., Richmond, CA) that recognizes the myc epitope.

Videomicroscopy, microangiography and histological analysis
Embryos were raised at 28.5°C in 30% Danieau buffer containing 0.003% 1-phenyl-2-thiourea to prevent pigmentation. For videomicroscopy and microangiography individual embryos were anesthetized in 0.02% tricaine (Sigma, St. Louis, MO) and mounted in 5% methyl cellulose dissolved in 30% Danieau buffer. Videomicroscopic images were collected directly on videotape using a Zeiss Axioplan microscope equipped with an MTI-DAGE SIT-68 camera. Video clips were assembled, edited, and compressed into Quicktime movies using Adobe Premiere 5.1. Microangiography was performed as described (Weinstein et al., 1995). For histological analysis, embryos were embedded in JB4 plastic resin according to described protocols (Westerfield, 1993). Embedded embryos were sectioned using a Leica microtome and sections were mounted on glass slides. Sections were stained with Hematoxylin and Eosin, coverslipped using Permount, and photographed under water immersion at 630x magnification using a Zeiss Axioplan microscope.

Microinjection
Capped mRNA was injected into 1-cell stage wild-type embryos as described (Xu, 1999). Expression was monitored at shield stage using a Leica MZFLII dissection microscope equipped for epifluorescence with an FITC filter set. Embryos not exhibiting EGFP expression at this point were removed and not included in later analyses. For DNA injection, plasmids were linearized by digestion with NotI followed by phenol:chloroform extraction and ethanol precipitation. Approximately 100-200 pg of linearized DNA was injected into early 1-cell stage embryos.


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Markers of arterial and venous identity in zebrafish trunk vessels
We are interested in determining the factors required for arterial-venous specification during vascular development in the zebrafish, Danio rerio. We characterized the vascular expression patterns of the zebrafish homologs of ephrinB2 and its receptor, EphB4, in developing embryos by whole-mount in situ hybridization. Although a previous study had described the expression of zebrafish ephrinB2 in presomitic mesoderm and in the posterior half of developing somites (Durbin et al., 1998), its expression in blood vessels was not reported. We found that, as in the mouse (Wang et al., 1998), ephrinB2 is also expressed in the zebrafish vasculature and is restricted to the DA at the 30-somite stage (Fig. 1B,C). ephrinB2 expression in the DA is initiated after migrating lateral mesodermal angioblasts reach the trunk midline (between the 16- and 18-somite stages; data not shown). Interestingly, we found that zebrafish notch3 (Kim, C.-H. and Chitnis, A. B., unpublished; previously known as notch5 (Westin and Lardelli, 1997)) is also expressed within the DA but not the PCV (Fig. 1D,E). The other zebrafish notch homologs do not exhibit a similar expression pattern (Westin and Lardelli, 1997) (data not shown). Two putative homologs of EphB4, referred to as rtk5 and rtk8, have also been reported in the zebrafish (Cooke et al., 1997). The vascular expression of these genes had also not been previously reported. We found that rtk5 is expressed within the vasculature and is found at a higher level in the posterior cardinal vein (PCV) than in the DA (see Fig. 4C). Rtk5 is also expressed within the hypochord (Fig. 4C), a structure that has been implicated in DA formation in Xenopus laevis (Cleaver and Krieg, 1998). The expression patterns of the receptor tyrosine kinase flt4, which becomes restricted to venous blood vessels by the 30-somite stage (Fig. 1F,G), and the ETS family transcription factor fli1, which is expressed in both the DA and PCV (Fig. 1H,I), are shown for reference.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 1. In situ hybridization of 30-somite stage wild-type embryos using markers of arterial-venous specification. (A) Line drawing of a 30-somite stage embryo. The boxed region corresponds to the area shown in B,D,F and H (Kimmel et al., 1995). (B,D,F,H) Lateral views of (B) ephrinB2, (D) notch3, (F) flt4 and (H) fli1 expression in the trunk vessels. (C,E,G,I) Thick sections (~35-50 µm) through the trunk of embryos showing expression of (C) ephrinB2, (E) notch3, (G) flt4, and (I) fli1. (B-I) The dorsal aorta (DA) is indicated by a red arrowhead and the posterior cardinal vein (PCV) by a blue arrowhead. (E) Pronephric duct expression of notch3 is indicated by black arrowheads. NT, neural tube; NC, notochord. Scale bars, (A) 100 µm, (B,D,F,H) 40 µm, (C,E,G,I) 30 µm.

 


View larger version (85K):
[in this window]
[in a new window]
 
Fig. 4. Ectopic expression of venous markers in mibta52b mutant embryos. (A) In wild-type siblings flt4 expression is restricted to the PCV by the 30-somite stage. (B) In mibta52b mutant embryos expression persists within both the PCV (blue arrow) and the DA (red arrowhead) at this stage. (C) In wild-type siblings rtk5 is expressed within the hypochord (black arrow), and is detected at a higher level within the PCV (blue arrow) than the DA (red arrowhead). (D) In mibta52b mutant embryos rtk5 expression is absent from the PCV, and regions of ectopic rtk5 expression are noted in the DA (red arrowhead). (E,F) Transmitted light images of (E) wild-type and (F) mibta52b mutant living sibling embryos at 36 hpf. (F) The curled tail and other characteristics (see text) are apparent in the mutant embryo and are similar to embryos injected with EGFPSuDN (see Fig. 2H). Scale bars (A,B) 100 µm, (C,D) 50 µm, (E,F) 200 µm.

 
Loss of Notch signaling perturbs normal arterial-venous differentiation
The observation that notch3 is expressed specifically within the DA suggested a potential role for Notch signaling in determining arterial cell fate during blood vessel development. To examine the role of the Notch pathway in the vasculature, we utilized a DNA binding mutant of a X. laevis homolog of the Suppressor of Hairless protein [XSu(H)DBM] that functions as an inhibitor of Notch signaling and elicits a neurogenic phenotype (Wettstein et al., 1997). A fusion protein was constructed between the enhanced green fluorescent protein (EGFP) and XSu(H) DBM, and mRNA encoding this fusion construct (EGFPSuDN) was injected into 1-cell stage embryos followed by in situ hybridization analysis for artery-specific gene expression. Embryos injected with 800 pg of EGFP expressed ephrinB2 within the DA at 24 hours postfertilization (hpf; Fig. 2A). while those injected with EGFPSuDN mRNA (800 pg) showed reduced or absent ephrinB2 expression within the DA (Fig. 2B). Expression of ephrinB2 in the eye, forebrain and midbrain was not affected by injection of EGFPSuDN (data not shown). We also determined the effect of EGFPSuDN on notch3 expression within the DA. Embryos injected with 1 ng of EGFP display notch3 expression within the DA and neural tube (red arrowhead and black arrow, respectively, in Fig. 2C). However, notch3 expression is reduced in the DA and neural tube in embryos injected with a comparable amount of EGFPSuDN (Fig. 2D). Since the mouse homolog of grl has recently been identified as a downstream target of Notch signaling, we assayed for its expression in EGFPSuDN-injected embryos. Embryos injected with 800 pg of EGFP showed normal grl expression within the DA (Fig. 2E). Surprisingly, all embryos injected with EGFPSuDN also exhibited expression of grl within the DA at normal levels (Fig. 2F). No effect was seen on DA-specific grl expression with EGFPSuDN injections up to 1 ng (data not shown). Embryos injected with 800 pg (Fig. 2G) or 1 ng (data not shown) of EGFP were morphologically normal, while embryos injected with the same amount of EGFPSuDN exhibited curved trunk and tail (Fig. 2H) as well as abnormal circulatory patterns (see below). In embryos injected with 1 ng EGFPSuDN we observed more severe trunk curvature and kinked notochords (data not shown).



View larger version (101K):
[in this window]
[in a new window]
 
Fig. 2. Microinjection of EGFPSuDN perturbs arterial differentiation. (A,B) In situ hybridization of ephrinB2 in injected embryos fixed at 24 hpf. (A) Embryos injected with 800 pg of EGFP express ephrinB2 in the DA (red arrowhead). (B) In embryos injected with 800 pg of EGFPSuDN there is reduction of vascular ephrinB2. (C,D) In situ hybridization of notch3 in injected embryos fixed at 24 hpf. (C) Embryos injected with 1 ng of EGFP express notch3 within the neural tube (black arrow) and DA (red arrowhead). (D) notch3 expression within the neural tube (black arrow) and the DA (red arrowhead) is reduced following injection of 1 ng of EGFPSuDN. (E,F) In situ hybridization of grl in injected embryos fixed at 24 hpf. (E) Embyros injected with 800 pg EGFP express grl within the DA; (F) grl expression is not affected by injection with 800 pg EGFPSuDN. (A-F) All embryos were injected with indicated amount of mRNA at the 1-cell stage. (G, H) Transmitted light images of living embryos at 36 hpf. (G) Wild-type embryo injected with 800 pg of EGFP mRNA. (H) Wild-type embryo injected with 800 pg of EGFPSuDN exhibiting trunk curvature. (A-F) Lateral views, anterior to the left. (A-F) Scale bars (A-F) 100 µm, (G, H) 200 µm.

 
To further investigate the role of Notch signaling in arterial-venous differentiation, we utilized the zebrafish mutant mindbomb (mib), which displays a hallmark neurogenic phenotype typical of defective Notch signaling [(Appel et al., 1999; Jiang et al., 1996; Riley et al., 1999) see Discussion]. For these studies we used the most severe allele of mib (mibta52b), although we observed similar phenotypes with less severity in embryos mutant for the weaker mibm178 allele (data not shown). To confirm that mibta52b embryos exhibited defects in arterial-venous differentiation, we performed in situ hybridization using artery-specific markers. While wild-type siblings exhibited normal expression of ephrinB2 (Fig. 3A), embryos homozygous for mibta52b failed to express ephrinB2 within the DA (Fig. 3B) as was observed in EGFPSuDN-injected embryos (Fig. 2B). In addition, notch3 is apparent within the DA as well as the neural tube of wild-type embryos (Fig. 3C) while its expression is severely reduced or absent in mibta52b embryos (Fig. 3D). We also found that grl expression does not appear to be affected in the DA of mibta52b mutant embryos (Fig. 3E,F), in agreement with our observations concerning EGFPSuDN-injected embryos. DeltaC, a recently described Notch ligand (Smithers et al., 2000), is also expressed within the DA in wild-type embryos (Fig. 3G). An increase in neural expression of deltaC is evident in mibta52b mutant embryos (Fig. 3H) while deltaC expression within the DA is reduced in approximately half of the mutant embryos at the 30-somite stage (Fig. 3H). Similar to grl, expression of the T-box gene tbx20, which is normally restricted to the dorsal roof of the DA (Ahn et al., 2000; Griffin et al., 2000), is not affected in mibta52b mutant embryos (Fig. 3I,J).



View larger version (100K):
[in this window]
[in a new window]
 
Fig. 3. In situ hybridization of artery markers in 30-somite stage mibta52b mutant and wild-type sibling embryos. (A) In wild-type siblings, ephrinB2 expression is apparent in the DA (red arrowheads in A-J). (B) In mibta52b mutant embryos this expression is absent. (C) In wild-type sibling embryos notch3 is expressed within the DA. (D) In mibta52b mutant embryos notch3 expression is absent from both vascular and non-vascular tissues. (E) In wild-type sibling embryos grl is expressed specifically in the DA. (F) In mibta52b mutant embryos the expression of grl is not affected. (G) In wild-type sibling embryos deltaC is expressed within the DA. (H) In mibta52b mutant embryos expression of deltaC within the DA is decreased in approximately half of the mutant embryos. Excess neuronal expression is apparent (black arrow). (I) In wild-type siblings the T-box transcription factor tbx20 is expressed normally within the roof of the DA. (J) In mibta52b mutant embryos this expression is normal. Scale bar (A-J) 100 µm.

 
In addition to decreased expression of artery-specific markers in mibta52b mutant embryos, changes were also noted using venous-specific markers. The venous endothelial marker flt4, which normally becomes restricted to the PCV within the trunk by the 30-somite stage (Fig. 4A) is expressed ectopically within the DA in mutant embryos (Fig. 4B). The putative ephrinB2 receptor rtk5 is expressed at a higher level in the PCV than in the DA in wild-type embryos (Fig. 4C) while in mutants, expression is reduced within the PCV and ectopic expression in the DA is detected (Fig. 4D).

Embryos mutant for mibta52b also exhibited morphologic characteristics similar to embryos injected with EGFPSuDN. While wild-type sibling embryos were normal (Fig. 4E), mibta52b mutant embryos exhibited trunk curvature and lack of posterior trunk pigmentation (Fig. 4F) as has been described previously (Jiang et al., 1996).

Activation of the Notch pathway suppresses venous cell fate
Determining the role of Notch during organogenesis is difficult because of the wide range of cell types responsive to Notch signaling throughout development (Artavanis-Tsakonas et al., 1999). Injection of mRNA encoding an activated form of Notch3 into zebrafish embryos results in defects in somitogenesis and notochord formation as well as the absence of anterior structures (data not shown). Thus, mRNA injection could result in indirect effects on arterial-venous differentiation. To eliminate the early effects of Notch activation, we utilized a system that allows for temporal control of a transgene of interest by placing the yeast transactivator GAL4 downstream of the zebrafish heat shock promoter. Adult hsp70:Gal4 zebrafish (Halloran et al., 2000; Scheer et al., 2001) were crossed with UAS:notch1a-intra fish (Scheer and Campos-Ortega, 1999) and embryos derived from these crosses were heat shocked and processed as described in Materials and Methods. Since the parental lines are hemizygous for each transgene, only one quarter of the embryos will inherit both components of the GAL4-UAS system. Therefore, embryos were stained with an anti-myc antibody following in situ hybridization to confirm expression of Notch1a-intra.

To determine the effect of activated Notch on artery specification, embryos were stained for the DA-specific markers ephrinB2, notch3, deltaC and grl. Surprisingly, there was no observable difference in heat shocked embryos with respect to the expression of any of these arterial markers, including grl, within the vasculature (Fig. 5A,B and data not shown). Earlier induction at the 15-somite stage also failed to result in ectopic expression of any artery markers (data not shown).



View larger version (86K):
[in this window]
[in a new window]
 
Fig. 5. Activation of Notch signaling represses venous cell identity. (A,B) Expression of grl in hsp70:Gal4;UAS:notch1a-intra heat shocked embryos. (A) grl expression in heat shocked embryos not expressing Notch1a-intra. (B) grl is not ectopically induced within the vasculature by Notch1a-intra. (C-F) flt4 expression in hsp70:Gal4; UAS:notch1a-intra embryos heat shocked at the 18-somite stage. flt4 is expressed within venous vessels of the head (C) and trunk (E) at the 28- to 30-somite stages in embryos that do not express Notch1a-intra. (D,F) Notch1a-intra represses flt4 expression in venous blood vessels of the head (D) and trunk (F). (G,H) Targeted expression of Notch3 ICD to the endothelium using the fli1 promoter, represses flt4 expression. (G) An embryo injected with pfliMTN3ICD showing normal flt4 expression within the midcerebral vein (blue arrowhead) in the absence of ectopic Notch3 ICD; anterior is to the right. (H) Opposite side of embryo in G, showing a myc-positive cell (blue arrowhead) within the midcerebral vein that fails to express flt4; anterior is to the left. (I-L) Expression of tie1 in hsp70:Gal4;UAS:notch1a-intra heat shocked embryos. (I,K) In embryos not expressing ectopic Notch1a-intra, tie1 is expressed in all blood vessels at the 28- to 30-somite stage. (J,L) Tie1 expression within all vessels is maintained in embryos expressing Notch1a-intra. (C, D) Embryos are shown prior to staining with anti-myc antibody. (A,B,E-L) Embryos were subjected to whole-mount immunostaining with an anti-myc antibody to visualize ectopic expression of the (A,B,E,F,I-L) Notch1-intra or (G,H) Notch 3 ICD. (E,F,I,J) Arrows and arrowheads indicate the positions of the primordial midbrain channel and mid-cerebral vein, respectively. (A,B,K,L) Red arrowheads and blue arrows indicate the position of the DA and PCV, respectively. Scale bar (A,B,K,L) 50 µm, (C,D,I,J) 100 µm, (G,H) 200 µm.

 
We next determined if activating the Notch pathway affected the identity of venous blood vessels by assaying embryos for flt4 expression. In heat-shocked sibling embryos without ectopic Notch1a-intra expression, flt4 expression can be seen within the primordial midbrain channel (PMBC, arrows in Fig. 5C) and midcerebral vein (MCeV, arrowhead in Fig. 5C), as well as the PCV within the trunk (Fig. 5E). Embryos staining positive for the myc-tagged Notch1a-intra exhibited a decrease in flt4 expression within these venous vessels (Fig. 5D,F). To determine whether the absence of flt4 staining was due to a decrease in expression or the loss of cells within the vein itself, heat shocked embryos were stained with the endothelial marker tie1. In embryos that do not express Notch1a-intra, tie1 can be seen in all blood vessels of the head (Fig. 5I) and trunk (Fig. 5K). Tie1 expression within all blood vessels appears normal in embryos expressing Notch1a-intra (Fig. 5J,L).

To confirm that decreased flt4 expression was due to endothelial cell autonomous activation of the Notch signaling pathway, we utilized the zebrafish fli1 promoter to drive expression of a myc-tagged Notch3 ICD (MTN3 ICD). We have isolated a 7 kb fragment of the fli1 promoter that is sufficient to drive transgene expression within the cells of the head and trunk vasculature (unpublished observation). One-cell stage embryos were injected with linearized pfliMTN3ICD and assayed for flt4 and MTN3 ICD expression. An example of an embryo injected with fliMTN3 ICD is seen in Fig. 5G and H. On the left side of the head at approximately the 30-somite stage the MCeV has sprouted to its dorsal-most point and expresses flt4 in the absence of ectopic MTN3 ICD (confirmed by the absence of myc-positive nuclei; Fig. 5G). However, the MCeV on the opposite side of the embryo expresses MTN3 ICD as indicated by a myc-positive nucleus (Fig. 5H, blue arrowhead) and flt4 transcript is undetectable in this cell (Fig. 5H).

Consequences of defective Notch signaling on vascular morphogenesis
Since we found that the Notch pathway affects the identity of blood vessels during development, we determined the consequences of these effects on vascular morphogenesis. While wild-type siblings exhibited normal circulation at 60 hpf (Fig. 6A), cranial hemorrhage (Fig. 6B) was evident in mibta52b mutant embryos (80 out of 84 mutant embryos in 3 different clutches). Additionally, more than half of the homozygous mibta52b mutant embryos completely lacked circulation by 48 hpf (50 out of 84 in 3 clutches) and most of those that retained circulation exhibited arterial-venous (A-V) shunts (27 out of 34 mutant embryos with shunts from three clutches). Embryos injected with 800 pg EGFPSuDN also exhibited A-V shunts (47 out 167 in three experiments), while all embryos injected with a comparable amount of EGFP were normal. The location and behavior of arterial-venous shunts were similar in EGFPSuDN-injected embryos (data not shown) and embryos mutant for mibta52b (see below).



View larger version (85K):
[in this window]
[in a new window]
 
Fig. 6. Vascular defects in mibta52b embryos. (A) Head of a wild-type mibta52b sibling at 60 hpf. (B) Cranial hemorrhage in a mibta52b mutant embryo at 60 hpf (black arrows). (C) Schematic drawing of the trunk circulatory loop in a zebrafish embryo. Red and blue are arterial and venous vessels respectively, with the direction of blood flow indicated. The black arrow shows the position of the shunt in the mutant embryos in (E,G). (D) DIC image of the mid-trunk of a live wild-type mibta52b sibling at 55 hpf. A well-formed DA (red bracket) and PCV (blue bracket) are visible (see Movie 1, available on-line). The black arrow points to the endothelial cell walls clearly demarcating the boundary between the DA and PCV. (E) DIC image of a mutant mibta52b embryo displaying a shunt (black arrow) between the DA and PCV (see Movie 2, available on-line). (F) Longitudinal histological section through the trunk of a wild-type embryo showing the DA (red bracket) and PCV (blue bracket). Blood cells are present within the lumen of each vessel. The black arrow indicates the endothelial cell wall between the DA and PCV. (G) Longitudinal histological section through the trunk of the same mibta52b mutant embryo shown in E, also in the region of the shunt (black arrow). (H) DIC image of a mibta52b embryo showing a disorganized boundary between the DA and PCV (arrows) and lack of a properly remodeled PCV. (I) Confocal microangiogram of the trunk of a wild-type mibta52b sibling at 55 hpf. Intersomitic vessels appear regularly at the vertical myosepta. (J) Confocal microangiogram of the trunk of a mibta52b mutant at 55 hpf. Disorganization of the normal intersomitic vessel structure is apparent. (K) Higher magnification confocal microangiogram of the trunk of the mibta52b mutant in J. Ectopic sprouts from the main branches of the intersomitic vessels are visible (white arrows) penetrating the somite. Scale bars (A,B,I,J) 50 µm, (D-H,K) 25 µm. DA, dorsal aorta; CA, caudal artery; ACV, anterior cardinal vein; PCV, posterior cardinal vein; CV, caudal vein.

 
To analyze the nature of the A-V shunts in more detail, we utilized real time differential interference contrast (DIC) videomicroscopy to examine blood flow patterns and vascular morphology in mibta52b mutant embryos that retained circulation. Normally, blood flows into the zebrafish trunk via the lateral dorsal aortae, which fuse to become a single medial DA running the length of the trunk (Fig. 6C). The DA continues into the tail, becoming the caudal artery (CA). At the caudal end of the CA, blood flow reverses direction and returns rostrally through the tail via the caudal vein (CV), and then through the trunk via the posterior cardinal vein (PCV), which empties into the large venous Ducts of Cuvier (DC) before re-entering the heart. DIC videomicroscopy of wild-type embryos at 48 hpf revealed DA and PCV vessel walls with well-demarcated boundaries between the two vessels (Fig. 6D; Movie 1 available on-line). While direct connections between the DA and PCV were never observed in wild-type siblings, mibta52b mutant embryos displayed shunts linking these vessels that resulted in premature venous return and little or no circulation through the CA and CV (Fig. 6C,E; Movie 2 available on-line). Histological analysis of the mutant embryo in Fig. 6E revealed significant disorganization of the DA and PCV (Fig. 6G) compared to wild-type sibling embryos (Fig. 6F), in addition to disruption of the vascular wall at the location of the shunt (indicated by a black arrow in Fig. 6G). Mutant embryos exhibited disorganized boundaries between the DA and the PCV compared to their wild-type siblings (indicated by black arrows in Fig. 6H) and the PCV often failed to be remodeled into a single vessel (Fig. 6H and data not shown).

During videomicroscopic analysis of mibta52b embryos, we also noted improper blood flow patterns in the region of the intersomitic vessels (ISVs). To further investigate the nature of these defects we performed confocal microangiography (Weinstein et al., 1995) on mutant and wild-type sibling embryos at 55 hpf, to directly visualize the patterns of patent vessels. In wild-type embryos, ISVs are completely formed by 55 hpf. These vessels appear regularly at successive vertical myoseptal boundaries, joining together above the neural tube as paired dorsal longitudinal anastomotic vessels (Fig. 6I). No patent vessels are ever observed within somitic tissue in wild-type embryos at this stage. Although the initial sprouting of the ISVs appears normal in mibta52b embryos (data not shown), ectopic sprouts penetrating the somitic tissue are apparent at 55 hpf (Fig. 6J, white arrows in Fig. 6K).


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have utilized the zebrafish to study arterial and venous differentiation during embryonic blood vessel formation. As in mouse and Xenopus, we find molecular differences between arteries and veins can be demonstrated before circulation in zebrafish embryos by the expression of the transmembrane ligand EphrinB2 and the EphB4 homolog rtk5 (Cooke et al., 1997), respectively. We find that notch3 is also expressed specifically within the vasculature in the DA beginning at the 18-somite stage, similar to the temporal expression pattern of ephrinB2. This artery-restricted pattern of expression and the known role of Notch signaling in cell fate decisions led us to investigate the role of this pathway during arterio-venous differentiation.

We determined the effect on vascular development of both loss and gain of Notch activity during embryonic development. We are able to effectively inhibit the Notch pathway using a dominant negative form of Su(H) that fails to bind DNA (Wettstein et al., 1997). In embryos expressing EGFPSuDN we find decreased arterial expression of both ephrin-B2 and notch3. In addition, EGFPSuDN-injected embryos display circulatory shunts between the DA and PCV within the trunk, a phenotype that has been associated with decreased ephrinB2 expression in mice lacking ACRVL-1 (Urness et al., 2000). We have noted identical, yet more severe phenotypes in embryos mutant for the mibta52b locus. Although the identity of the mib gene is unknown, several lines of evidence suggest that it is an important component of the Notch signaling pathway (Jiang et al., 1996). Mib mutant embryos display a severe neurogenic phenotype similar to that described in Drosophila mutants lacking components of the Notch signaling pathway (Jiang et al., 1996; Xu et al., 1990). In addition, zebrafish embryos with a mutation in the gene encoding the Notch ligand deltaA exhibit many of the phenotypes described in mib mutant embryos (Appel et al., 1999; Riley et al., 1999). Our results provide further evidence supporting the importance of mib in Notch signaling, by demonstrating that wild-type embryos expressing EGFPSuDN exhibit many of the molecular and morphologic vascular defects observed in mibta52b mutants. Embryos that are mutant for mibta52b display loss of ephrinB2 and notch3 expression within the DA and exhibit circulatory shunts similar to that seen in wild-type embryos injected with mRNA encoding EGFPSuDN. We have also noted aberrant intersomitic vessel projection and defective remodeling of the major vessels in mibta52b mutant embryos, phenotypes that have been noted in mouse embryos lacking ephrin-B2 (Adams et al., 1999; Gerety et al., 1999; Wang et al., 1998) or EphB4, as well as Xenopus embryos injected with a dominant negative form of EphB4 (Helbling et al., 2000). Although embryos lacking Notch activity display defects in arterial differentiation, expression of other artery-specific markers, such as tbx20 and grl, is not affected in mutant embryos. The proper expression of these markers as well as endothelial markers such as flk1, fli1 and tie1 in mibta52b mutant embryos (unpublished observations) indicates the presence of endothelial cells at the position of the DA. These results suggest that Notch signaling is required for a specific step during arterial differentiation and is dispensable for the initial positioning of the major trunk vessels.

In addition to defects in arterial differentiation, we find that the venous markers flt4 and rtk5 become ectopically expressed within the DA in mibta52b mutant embryos suggesting that a major role of Notch signaling is to repress the venous fate within the developing arterial primordium. This model is consistent with the expression patterns of both notch3 and flt4. Flt4 is initially expressed in angioblasts beginning at the 12-somite stage (Thompson et al., 1998), at which time notch3 is not apparent in these cells (unpublished observation). As notch3 expression becomes detectable within the DA at the 18-somite stage, flt4 expression decreases in all presumptive arterial vessels and is restricted to veins by the 25-somite stage. The loss of rtk5 expression within the PCV of mibta52b mutant embryos is possibly due to the absence of a positive autoregulatory loop that has been proposed to be responsible for EphB4 expression in the mouse vasculature (Gerety et al., 1999) as mice lacking EphB4 also fail to express a tau-lacZ transgene from the EphB4 locus. Thus, the loss of ephrinB2 expression in mibta52b mutant embryos likely results in the failure to activate the Rtk5 receptor and maintain its own expression within venous vessels.

We find further support for the role of Notch signaling in repressing venous cell fate from the ectopic expression of an activated form of Notch during embryonic development. Activation of Notch signaling in hsp70:Gal4;UAS:notch1a-intra embryos at the 18-somite stage leads to a decrease in flt4 expression in all venous vessels by the 30-somite stage. Expression of tie1 is unaffected in hsp70:Gal4;UAS:notch1a-intra heat-shocked embryos, indicating an effect on flt4 expression rather than the loss of cells within venous vessels. Despite the effects on venous cell fate, activation of the Notch pathway throughout the embryo failed to induce an arterial cell fate ectopically, suggesting that Notch signaling may cooperate with other pathways to mediate arterial differentiation.

The observation that notch3 is expressed within the DA suggests that the Notch pathway is acting at the level of the endothelial cell itself. We confirmed this by expressing Notch3 ICD using the zebrafish fli1 promoter. We find that cells within venous vessels that express a myc-tagged form of Notch3 ICD from the fli1 promoter failed to properly express flt4, confirming a cell-autonomous effect on endothelial cell identity. Thus, notch3 is functioning within the endothelial cells of the DA to repress a venous cell fate

During neurogenesis, activation of the Notch pathway leads to expression of bHLH factors, such as the hairy-like genes of the Enhancer of split complex, that repress the action of proneural genes and inhibit a neural fate (Artavanis-Tsakonas et al., 1999). Interestingly, grl is a hairy-like factor and its mouse homolog, HRT2, has been shown to be a transcriptional repressor that is downstream of Notch signaling in vitro (Nakagawa et al., 2000). Thus, grl would seem to be a strong candidate for a downstream effector of venous repression. However, grl does not appear to be downregulated in EGFPSuDN-injected embryos or mibta52b mutant embryos as would be expected for a Notch target gene. Furthermore, activation of Notch signaling throughout the embryo fails to cause ectopic expression of grl within venous vessels, although flt4 is reduced within these vessels under the same conditions. We have observed increased grl expression in the forebrain and optic tectum and ectopic expression within the lens following heat shock (unpublished ovservation) indicating that, in these tissues, grl can be downstream of Notch signaling in concordance with in vitro studies (Nakagawa et al., 2000). Although grl is clearly important for development of the DA, our data suggest that it does not function by mediating Notch-induced repression of venous fate. Consistent with these observations, expression of flt4, as well as ephrinB2, is unaffected in grlm145 mutant embryos (unpublished observation).

Until recently, the processes by which arterial and venous blood vessels acquire their identity were generally attributed to physiologic cues, but it is now apparent that genetic factors underlie this process. We propose a model in which the Notch pathway acts at a specific step in arterial-venous differentiation to repress a venous cell fate program within the presumptive DA. Notch activity seems to be dispensable for earlier steps of arterial-venous differentiation such as the positioning of the DA and PCV primordia, suggesting that the process of defining arteries and veins is a complex cascade of differentiation governed by signaling pathways that have yet to be identified.


    ACKNOWLEDGMENTS
 
We would like to thank those researchers who provided plasmid constructs. We would also like to thank Beth Roman and Andreas Vogel for critical reading of the manuscript. B. M. W. is supported by NIH intramural grant ZO1 HD 01011 and N. D. L. is supported by a postdoctoral associateship from the National Research Council.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Adams, R. H., Wilkinson, G. A., Weiss, C., Diella, F., Gale, N. W., Deutsch, U., Risau, W. and Klein, R. (1999). Roles of ephrinB ligands and EphB receptors in cardiovascular development: demarcation of arterial/venous domains, vascular morphogenesis, and sprouting angiogenesis. Genes Dev. 13, 295-306.[Abstract/Free Full Text]
Ahn, D. G., Ruvinsky, I., Oates, A. C., Silver, L. M. and Ho, R. K. (2000). tbx20, a new vertebrate T-box gene expressed in the cranial motor neurons and developing cardiovascular structures in zebrafish. Mech. Dev. 95, 253-258.[Medline]
Appel, B., Fritz, A., Westerfield, M., Grunwald, D. J., Eisen, J. S. and Riley, B. B. (1999). Delta-mediated specification of midline cell fates in zebrafish embryos. Curr. Biol. 9, 247-256.[Medline]
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J. (1999). Notch signaling: cell fate control and signal integration in development. Science 284, 770-776.[Abstract/Free Full Text]
Brown, L. A., Rodaway, A. R., Schilling, T. F., Jowett, T., Ingham, P. W., Patient, R. K. and Sharrocks, A. D. (2000). Insights into early vasculogenesis revealed by expression of the ETS- domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech. Dev. 90, 237-252.[Medline]
Chin, M. T., Maemura, K., Fukumoto, S., Jain, M. K., Layne, M. D., Watanabe, M., Hsieh, C. M. and Lee, M. E. (2000). Cardiovascular basic helix loop helix factor 1, a novel transcriptional repressor expressed preferentially in the developing and adult cardiovascular system. J. Biol. Chem. 275, 6381-6387.[Abstract/Free Full Text]
Chitnis, A., Henrique, D., Lewis, J., Ish-Horowicz, D. and Kintner, C. (1995). Primary neurogenesis in Xenopus embryos regulated by a homologue of the Drosophila neurogenic gene Delta. Nature 375, 761-766.[Medline]
Cleaver, O. and Krieg, P. A. (1998). VEGF mediates angioblast migration during development of the dorsal aorta in Xenopus. Development 125, 3905-3914.[Abstract]
Conlon, R. A., Reaume, A. G. and Rossant, J. (1995). Notch1 is required for the coordinate segmentation of somites. Development 121, 1533-1545.[Abstract]
Cooke, J. E., Xu, Q., Wilson, S. W. and Holder, N. (1997). Characerisation of five novel zebrafish Eph-related receptor tyrosine kinases suggests roles in patterning the neural plate. Dev. Genes Evol. 206, 515-531.
Del Amo, F. F., Smith, D. E., Swiatek, P. J., Gendron-Maguire, M., Greenspan, R. J., McMahon, A. P. and Gridley, T. (1992). Expression pattern of Motch, a mouse homolog of Drosophila Notch, suggests an important role in early postimplantation mouse development. Development 115, 737-744.[Abstract]
Dornseifer, P., Takke, C. and Campos-Ortega, J. A. (1997). Overexpression of a zebrafish homologue of the Drosophila neurogenic gene Delta perturbs differentiation of primary neurons and somite development. Mech. Dev. 63, 159-171.[Medline]
Durbin, L., Brennan, C., Shiomi, K., Cooke, J., Barrios, A., Shanmugalingam, S., Guthrie, B., Lindberg, R. and Holder, N. (1998). Eph signaling is required for segmentation and differentiation of the somites. Genes Dev. 12, 3096-3109.[Abstract/Free Full Text]
Ellisen, L. W., Bird, J., West, D. C., Soreng, A. L., Reynolds, T. C., Smith, S. D. and Sklar, J. (1991). TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 66, 649-661.[Medline]
Gerety, S. S., Wang, H. U., Chen, Z. F. and Anderson, D. J. (1999). Symmetrical mutant phenotypes of the receptor EphB4 and its specific transmembrane ligand ephrin-B2 in cardiovascular development. Mol. Cell 4, 403-414.[Medline]
Griffin, K. J., Stoller, J., Gibson, M., Chen, S., Yelon, D., Stainier, D. Y. and Kimelman, D. (2000). A conserved role for H15-related T-box transcription factors in zebrafish and Drosophila heart formation. Dev. Biol. 218, 235-247.[Medline]
Halloran, M. C., Sato-Maeda, M., Warren, J. T., Su, F., Lele, Z., Krone, P. H., Kuwada, J. Y. and Shoji, W. (2000). Laser-induced gene expression in specific cells of transgenic zebrafish. Development 127, 1953-1960.[Abstract]
Hauptmann, G. and Gerster, T. (1994). Two-color whole-mount in situ hybridization to vertebrate and Drosophila embryos. Trends Genet. 10, 266.[Medline]
Helbling, P. M., Saulnier, D. M. and Brandli, A. W. (2000). The receptor tyrosine kinase EphB4 and ephrin-B ligands restrict angiogenic growth of embryonic veins in Xenopus laevis. Development 127, 269-278.[Abstract]
Irvine, K. D. (1999). Fringe, Notch, and making developmental boundaries. Curr. Opin. Genet. Dev. 9, 434-441.[Medline]
Jiang, Y. J., Brand, M., Heisenberg, C. P., Beuchle, D., Furutani-Seiki, M., Kelsh, R. N., Warga, R. M., Granato, M., Haffter, P., Hammerschmidt, M. et al. (1996). Mutations affecting neurogenesis and brain morphology in the zebrafish, Danio rerio. Development 123, 205-216.[Abstract]
Joutel, A., Corpechot, C., Ducros, A., Vahedi, K., Chabriat, H., Mouton, P., Alamowitch, S., Domenga, V., Cecillion, M., Marechal, E. et al. (1996). Notch3 mutations in CADASIL, a hereditary adult-onset condition causing stroke and dementia. Nature 383, 707-710.[Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. K., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253-310.[Medline]
Krebs, L. T., Xue, Y., Norton, C. R., Shutter, J. R., Maguire, M., Sundberg, J. P., Gallahan, D., Closson, V., Kitajewski, J., Callahan, R. et al. (2000). Notch signaling is essential for vascular morphogenesis in mice. Genes Dev. 14, 1343-1352.[Abstract/Free Full Text]
Muskavitch, M. A. (1994). Delta-notch signaling and Drosophila cell fate choice. Dev. Biol. 166, 415-430.[Medline]
Nakagawa, O., McFadden, D. G., Nakagawa, M., Yanagisawa, H., Hu, T., Srivastava, D. and Olson, E. N. (2000). Members of the HRT family of basic helix-loop-helix proteins act as transcriptional repressors downstream of notch signaling. Proc. Natl. Acad. Sci. USA 97, 13655-13660.[Abstract/Free Full Text]
Nakagawa, O., Nakagawa, M., Richardson, J. A., Olson, E. N. and Srivastava, D. (1999). HRT1, HRT2, and HRT3: a new subclass of bHLH transcription factors marking specific cardiac, somitic, and pharyngeal arch segments. Dev. Biol. 216, 72-84.[Medline]
Pui, J. C., Allman, D., Xu, L., DeRocco, S., Karnell, F. G., Bakkour, S., Lee, J. Y., Kadesch, T., Hardy, R. R., Aster, J. C. et al. (1999). Notch1 expression in early lymphopoiesis influences B versus T lineage determination. Immunity 11, 299-308.[Medline]
Riley, B. B., Chiang, M., Farmer, L. and Heck, R. (1999). The deltaA gene of zebrafish mediates lateral inhibition of hair cells in the inner ear and is regulated by pax2.1. Development 126, 5669-5678.[Abstract]
Rupp, R. A., Snider, L. and Weintraub, H. (1994). Xenopus embryos regulate the nuclear localization of XMyoD. Genes Dev 8, 1311-1323.[Abstract/Free Full Text]
Salloway, S. and Hong, J. (1998). CADASIL syndrome: a genetic form of vascular dementia. J. Geriatr. Psychiatry Neurol. 11, 71-77.
Scheer, N. and Campos-Ortega, J. A. (1999). Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mech. Dev. 80, 153-158.[Medline]
Scheer, N., Groth, A., Hans, S. and Campos-Ortega, J. A. (2001). An instructive function for Notch in promoting gliogenesis in the zebrafish retina. Development 128, 1099-1107.[Abstract]
Shutter, J. R., Scully, S., Fan, W., Richards, W. G., Kitajewski, J., Deblandre, G. A., Kintner, C. R. and Stark, K. L. (2000). Dll4, a novel Notch ligand expressed in arterial endothelium. Genes Dev. 14, 1313-1318.[Abstract/Free Full Text]
Smithers, L., Haddon, C., Jiang, Y. and Lewis, J. (2000). Sequence and embryonic expression of deltaC in the zebrafish. Mech. Dev. 90, 119-123.[Medline]
Takke, C., Dornseifer, P., v. Weizsacker, E. and Campos-Ortega, J. A. (1999). her4, a zebrafish homologue of the Drosophila neurogenic gene E(spl), is a target of NOTCH signalling. Development 126, 1811-1821.[Abstract]
Thompson, M. A., Ransom, D. G., Pratt, S. J., MacLennan, H., Kieran, M. W., Detrich, H. W., 3rd, Vail, B., Huber, T. L., Paw, B., Brownlie, A. J. et al. (1998). The cloche and spadetail genes differentially affect hematopoiesis and vasculogenesis. Dev. Biol. 197, 248-269.[Medline]
Urness, L. D., Sorensen, L. K. and Li, D. Y. (2000). Arteriovenous malformations in mice lacking activin receptor-like kinase-1. Nat. Genet. 26, 328-331.[Medline]
Uyttendaele, H., Ho, J., Rossant, J. and Kitajewski, J. (2001). Vascular patterning defects associated with expression of activated Notch4 in embryonic endothelium. Proc. Natl. Acad. Sci. USA 98, 5643-5648.[Abstract/Free Full Text]
Uyttendaele, H., Marazzi, G., Wu, G., Yan, Q., Sassoon, D. and Kitajewski, J. (1996). Notch4/int-3, a mammary proto-oncogene, is an endothelial cell-specific mammalian Notch gene. Development 122, 2251-2259.[Abstract]
Wang, H. U., Chen, Z. F. and Anderson, D. J. (1998). Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4. Cell 93, 741-753.[Medline]
Weinstein, B. M., Stemple, D. L., Driever, W. and Fishman, M. C. (1995). Gridlock, a localized heritable vascular patterning defect in the zebrafish. Nat. Med. 1, 1143-1147.[Medline]
Westerfield, M. (1993). The Zebrafish Book. Eugene, OR: University of Oregon Press.
Westin, J. and Lardelli, M. (1997). Three novel Notch genes in zebrafish: implications for vertebrate Notch gene evolution and function. Dev. Genes Evol. 207, 51-63.
Wettstein, D. A., Turner, D. L. and Kintner, C. (1997). The Xenopus homolog of Drosophila Suppressor of Hairless mediates Notch signaling during primary neurogenesis. Development 124, 693-702.[Abstract]
Xu, Q. (1999). Microinjection into zebrafish embryos. In Molecular Methods in Developmental Biology. Vol. 127 (ed. M. Guille), pp. 125-132. Totowa, NJ: Humana Press.
Xu, T., Rebay, I., Fleming, R. J., Scottgale, T. N. and Artavanis-Tsakonas, S. (1990). The Notch locus and the genetic circuitry involved in early Drosophila neurogenesis. Genes Dev. 4, 464-475.[Abstract/Free Full Text]
Xue, Y., Gao, X., Lindsell, C. E., Norton, C. R., Chang, B., Hicks, C., Gendron-Maguire, M., Rand, E. B., Weinmaster, G. and Gridley, T. (1999). Embryonic lethality and vascular defects in mice lacking the Notch ligand Jagged1. Hum. Mol. Genet. 8, 723-730.[Abstract/Free Full Text]
Zhong, T. P., Rosenberg, M., Mohideen, M. A., Weinstein, B. and Fishman, M. C. (2000). gridlock, an HLH gene required for assembly of the aorta in zebrafish. Science 287, 1820-1824.[Abstract/Free Full Text]
Zimrin, A. B., Pepper, M. S., McMahon, G. A., Nguyen, F., Montesano, R. and Maciag, T. (1996). An antisense oligonucleotide to the notch ligand jagged enhances fibroblast growth factor-induced angiogenesis in vitro. J. Biol. Chem. 271, 32499-32502.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
DevelopmentHome page
B. M. Hogan, R. Herpers, M. Witte, H. Helotera, K. Alitalo, H. J. Duckers, and S. Schulte-Merker
Vegfc/Flt4 signalling is suppressed by Dll4 in developing zebrafish intersegmental arteries
Development, December 1, 2009; 136(23): 4001 - 4009.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Masumura, K. Yamamoto, N. Shimizu, S. Obi, and J. Ando
Shear Stress Increases Expression of the Arterial Endothelial Marker EphrinB2 in Murine ES Cells via the VEGF-Notch Signaling Pathways
Arterioscler Thromb Vasc Biol, December 1, 2009; 29(12): 2125 - 2131.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
Q. ZhuGe, M. Zhong, W. Zheng, G.-Y. Yang, X. Mao, L. Xie, G. Chen, Y. Chen, M. T. Lawton, W. L. Young, et al.
Notch-1 signalling is activated in brain arteriovenous malformations in humans
Brain, October 7, 2009; (2009) awp246v1.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. F. Siekmann, C. Standley, K. E. Fogarty, S. A. Wolfe, and N. D. Lawson
Chemokine signaling guides regional patterning of the first embryonic artery
Genes & Dev., October 1, 2009; 23(19): 2272 - 2277.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Kim, Y. Kim, H.-T. Kim, D. W. Kim, Y. Ha, J. Kim, C.-H. Kim, I. Lee, and K. Song
TC1(C8orf4) Is a Novel Endothelial Inflammatory Regulator Enhancing NF-{kappa}B Activity
J. Immunol., September 15, 2009; 183(6): 3996 - 4002.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. Xie, T. Wu, K. Xu, I. K. Huang, O. Cleaver, and C.-L. Huang
Endothelial-Specific Expression of WNK1 Kinase Is Essential for Angiogenesis and Heart Development in Mice
Am. J. Pathol., September 1, 2009; 175(3): 1315 - 1327.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. Morrow, J. P. Cullen, W. Liu, S. Guha, C. Sweeney, Y. A. Birney, N. Collins, D. Walls, E. M. Redmond, and P. A. Cahill
Sonic Hedgehog Induces Notch Target Gene Expression in Vascular Smooth Muscle Cells via VEGF-A
Arterioscler Thromb Vasc Biol, July 1, 2009; 29(7): 1112 - 1118.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
L. C. G. Campos, A. A. Miyakawa, V. G. Barauna, L. Cardoso, T. F. Borin, L. A. d. O. Dallan, and J. E. Krieger
Induction of CRP3/MLP expression during vein arterialization is dependent on stretch rather than shear stress
Cardiovasc Res, July 1, 2009; 83(1): 140 - 147.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. E. Burns, J. L. Galloway, A. C. H. Smith, M. D. Keefe, T. J. Cashman, E. J. Paik, E. A. Mayhall, A. H. Amsterdam, and L. I. Zon
A genetic screen in zebrafish defines a hierarchical network of pathways required for hematopoietic stem cell emergence
Blood, June 4, 2009; 113(23): 5776 - 5782.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
I. Sorensen, R. H. Adams, and A. Gossler
DLL1-mediated Notch activation regulates endothelial identity in mouse fetal arteries
Blood, May 28, 2009; 113(22): 5680 - 5688.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S.-W. Jin and C. Patterson
The Opening Act: Vasculogenesis and the Origins of Circulation
Arterioscler Thromb Vasc Biol, May 1, 2009; 29(5): 623 - 629.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Gaengel, G. Genove, A. Armulik, and C. Betsholtz
Endothelial-Mural Cell Signaling in Vascular Development and Angiogenesis
Arterioscler Thromb Vasc Biol, May 1, 2009; 29(5): 630 - 638.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Vincent, P. Bonnin, M. Clemessy, J.-O. Contreres, N. Lamande, J.-M. Gasc, J. Vilar, P. Hainaud, G. Tobelem, P. Corvol, et al.
Angiotensinogen Delays Angiogenesis and Tumor Growth of Hepatocarcinoma in Transgenic Mice
Cancer Res., April 1, 2009; 69(7): 2853 - 2860.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. R. Swift and B. M. Weinstein
Arterial-Venous Specification During Development
Circ. Res., March 13, 2009; 104(5): 576 - 588.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
B. Larrivee, C. Freitas, S. Suchting, I. Brunet, and A. Eichmann
Guidance of Vascular Development: Lessons From the Nervous System
Circ. Res., February 27, 2009; 104(4): 428 - 441.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
K. J. Lavine and D. M. Ornitz
Shared Circuitry: Developmental Signaling Cascades Regulate Both Embryonic and Adult Coronary Vasculature
Circ. Res., January 30, 2009; 104(2): 159 - 169.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Z. Chun, S. Kaur, G. V. Samant, L. Wang, K. Pramanik, M. K. Garnaas, K. Li, L. Field, D. Mukhopadhyay, and R. Ramchandran
Snrk-1 is involved in multiple steps of angioblast development and acts via notch signaling pathway in artery-vein specification in vertebrates
Blood, January 29, 2009; 113(5): 1192 - 1199.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Y. H. Kim, H. Hu, S. Guevara-Gallardo, M. T. Y. Lam, S.-Y. Fong, and R. A. Wang
Artery and vein size is balanced by Notch and ephrin B2/EphB4 during angiogenesis
Development, November 15, 2008; 135(22): 3755 - 3764.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. Aitsebaomo, A. L. Portbury, J. C. Schisler, and C. Patterson
Brothers and Sisters: Molecular Insights Into Arterial-Venous Heterogeneity
Circ. Res., October 24, 2008; 103(9): 929 - 939.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Horowitz and M. Simons
Branching Morphogenesis
Circ. Res., October 10, 2008; 103(8): 784 - 795.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
S.-J. Lee, T.-H. Chan, T.-C. Chen, B.-K. Liao, P.-P. Hwang, and H. Lee
LPA1 is essential for lymphatic vessel development in zebrafish
FASEB J, October 1, 2008; 22(10): 3706 - 3715.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. K. Garnaas, K. L. Moodie, M.-l. Liu, G. V. Samant, K. Li, R. Marx, J. M. Baraban, A. Horowitz, and R. Ramchandran
Syx, a RhoA Guanine Exchange Factor, Is Essential for Angiogenesis In Vivo
Circ. Res., September 26, 2008; 103(7): 710 - 716.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. J. Lavine, F. Long, K. Choi, C. Smith, and D. M. Ornitz
Hedgehog signaling to distinct cell types differentially regulates coronary artery and vein development
Development, September 15, 2008; 135(18): 3161 - 3171.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
C. C. Hong, T. Kume, and R. T. Peterson
Role of Crosstalk Between Phosphatidylinositol 3-Kinase and Extracellular Signal-Regulated Kinase/Mitogen-Activated Protein Kinase Pathways in Artery-Vein Specification
Circ. Res., September 12, 2008; 103(6): 573 - 579.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
B. M. Hogan, J. Bussmann, H. Wolburg, and S. Schulte-Merker
ccm1 cell autonomously regulates endothelial cellular morphogenesis and vascular tubulogenesis in zebrafish
Hum. Mol. Genet., August 15, 2008; 17(16): 2424 - 2432.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. A. Murphy, M. T. Y. Lam, X. Wu, T. N. Kim, S. M. Vartanian, A. W. Bollen, T. R. Carlson, and R. A. Wang
Endothelial Notch4 signaling induces hallmarks of brain arteriovenous malformations in mice
PNAS, August 5, 2008; 105(31): 10901 - 10906.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Nicoli, C. Tobia, L. Gualandi, G. De Sena, and M. Presta
Calcitonin receptor-like receptor guides arterial differentiation in zebrafish
Blood, May 15, 2008; 111(10): 4965 - 4972.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
N. M.S. van den Akker, V. Caolo, L. J. Wisse, P. P.W.M. Peters, R. E. Poelmann, P. Carmeliet, D. G.M. Molin, and A. C. Gittenberger-de Groot
Developmental coronary maturation is disturbed by aberrant cardiac vascular endothelial growth factor expression and Notch signalling
Cardiovasc Res, May 1, 2008; 78(2): 366 - 375.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
F. le Noble, C. Klein, A. Tintu, A. Pries, and I. Buschmann
Neural guidance molecules, tip cells, and mechanical factors in vascular development
Cardiovasc Res, May 1, 2008; 78(2): 232 - 241.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
J. J. Zoeller, A. McQuillan, J. Whitelock, S.-Y. Ho, and R. V. Iozzo
A central function for perlecan in skeletal muscle and cardiovascular development
J. Cell Biol., April 21, 2008; 181(2): 381 - 394.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. T. Holderfield and C. C.W. Hughes
Crosstalk Between Vascular Endothelial Growth Factor, Notch, and Transforming Growth Factor-{beta} in Vascular Morphogenesis
Circ. Res., March 28, 2008; 102(6): 637 - 652.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Cermenati, S. Moleri, S. Cimbro, P. Corti, L. Del Giacco, R. Amodeo, E. Dejana, P. Koopman, F. Cotelli, and M. Beltrame
Sox18 and Sox7 play redundant roles in vascular development
Blood, March 1, 2008; 111(5): 2657 - 2666.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. A. High, M. M. Lu, W. S. Pear, K. M. Loomes, K. H. Kaestner, and J. A. Epstein
Endothelial expression of the Notch ligand Jagged1 is required for vascular smooth muscle development
PNAS, February 12, 2008; 105(6): 1955 - 1959.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J.-L. Li, R. C.A. Sainson, W. Shi, R. Leek, L. S. Harrington, M. Preusser, S. Biswas, H. Turley, E. Heikamp, J. A. Hainfellner, et al.
Delta-like 4 Notch Ligand Regulates Tumor Angiogenesis, Improves Tumor Vascular Function, and Promotes Tumor Growth In vivo
Cancer Res., December 1, 2007; 67(23): 11244 - 11253.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
C. Roca and R. H. Adams
Regulation of vascular morphogenesis by Notch signaling
Genes & Dev., October 15, 2007; 21(20): 2511 - 2524.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
T. Gridley
Notch signaling in vascular development and physiology
Development, August 1, 2007; 134(15): 2709 - 2718.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. Niessen and A. Karsan
Notch signaling in the developing cardiovascular system
Am J Physiol Cell Physiol, July 1, 2007; 293(1): C1 - C11.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. J. Hofmann and M. L. Iruela-Arispe
Notch Signaling in Blood Vessels: Who Is Talking to Whom About What?
Circ. Res., June 8, 2007; 100(11): 1556 - 1568.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
V. Bolos, J. Grego-Bessa, and J. L. de la Pompa
Notch Signaling in Development and Cancer
Endocr. Rev., May 1, 2007; 28(3): 339 - 363.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Wu and E. H. Bresnick
Glucocorticoid and Growth Factor Synergism Requirement for Notch4 Chromatin Domain Activation
Mol. Cell. Biol., March 15, 2007; 27(6): 2411 - 2422.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Y. Liu, N. Pathak, A. Kramer-Zucker, and I. A. Drummond
Notch signaling controls the differentiation of transporting epithelia and multiciliated cells in the zebrafish pronephros
Development, March 15, 2007; 134(6): 1111 - 1122.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
X. L. Aranguren, A. Luttun, C. Clavel, C. Moreno, G. Abizanda, M. A. Barajas, B. Pelacho, M. Uriz, M. Arana, A. Echavarri, et al.
In vitro and in vivo arterial differentiation of human multipotent adult progenitor cells
Blood, March 15, 2007; 109(6): 2634 - 2642.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. J. Patterson, M. Gering, C. E. Eckfeldt, A. R. Green, C. M. Verfaillie, S. C. Ekker, and R. Patient
The transcription factors Scl and Lmo2 act together during development of the hemangioblast in zebrafish
Blood, March 15, 2007; 109(6): 2389 - 2398.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. D. Leslie, L. Ariza-McNaughton, A. L. Bermange, R. McAdow, S. L. Johnson, and J. Lewis
Endothelial signalling by the Notch ligand Delta-like 4 restricts angiogenesis
Development, March 1, 2007; 134(5): 839 - 844.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Suchting, C. Freitas, F. le Noble, R. Benedito, C. Breant, A. Duarte, and A. Eichmann
The Notch ligand Delta-like 4 negatively regulates endothelial tip cell formation and vessel branching
PNAS, February 27, 2007; 104(9): 3225 - 3230.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. T. Raetzman, B. S. Wheeler, S. A. Ross, P. Q. Thomas, and S. A. Camper
Persistent Expression of Notch2 Delays Gonadotrope Differentiation
Mol. Endocrinol., November 1, 2006; 20(11): 2898 - 2908.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
R. E. Lamont and S. Childs
MAPping Out Arteries and Veins
Sci. Signal., October 3, 2006; 2006(355): pe39 - pe39.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
A. P. Hall
Review of the Pericyte during Angiogenesis and its Role in Cancer and Diabetic Retinopathy
Toxicol Pathol, October 1, 2006; 34(6): 763 - 775.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J.-S. Silvestre and Z. Mallat
Arteries or Veins?: VEGF Helps EPCs Choose Their cAMP.
Arterioscler Thromb Vasc Biol, September 1, 2006; 26(9): 1934 - 1935.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Yurugi-Kobayashi, H. Itoh, T. Schroeder, A. Nakano, G. Narazaki, F. Kita, K. Yanagi, M. Hiraoka-Kanie, E. Inoue, T. Ara, et al.
Adrenomedullin/Cyclic AMP Pathway Induces Notch Activation and Differentiation of Arterial Endothelial Cells From Vascular Progenitors
Arterioscler Thromb Vasc Biol, September 1, 2006; 26(9): 1977 - 1984.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
S. Saiki, K. Sakai, M. Saiki, Y. Kitagawa, T. Umemori, K. Murata, M. Matsui, and G. Hirose
Varicose veins associated with CADASIL result from a novel mutation in the Notch3 gene.
Neurology, July 25, 2006; 67(2): 337 - 339.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. D. Covassin, J. A. Villefranc, M. C. Kacergis, B. M. Weinstein, and N. D. Lawson
Distinct genetic interactions between multiple Vegf receptors are required for development of different blood vessel types in zebrafish
PNAS, April 25, 2006; 103(17): 6554 - 6559.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. M. Miano
Fishing for Function in Zebrafish
Circ. Res., March 31, 2006; 98(6): 723 - 726.
[Full Text] [PDF]


Home page
StrokeHome page
G. G. Leblanc, J. F. Meschia, D. T. Stuss, and V. Hachinski
Genetics of Vascular Cognitive Impairment: The Opportunity and the Challenges
Stroke, January 1, 2006; 37(1): 248 - 255.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S.-W. Jin, D. Beis, T. Mitchell, J.-N. Chen, and D. Y. R. Stainier
Cellular and molecular analyses of vascular tube and lumen formation in zebrafish
Development, December 1, 2005; 132(23): 5199 - 5209.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J.E. Ferguson III, R. W. Kelley, and C. Patterson
Mechanisms of Endothelial Differentiation in Embryonic Vasculogenesis
Arterioscler Thromb Vasc Biol, November 1, 2005; 25(11): 2246 - 2254.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. Morrow, A. Scheller, Y. A. Birney, C. Sweeney, S. Guha, P. M. Cummins, R. Murphy, D. Walls, E. M. Redmond, and P. A. Cahill
Notch-mediated CBF-1/RBP-J{kappa}-dependent regulation of human vascular smooth muscle cell phenotype in vitro
Am J Physiol Cell Physiol, November 1, 2005; 289(5): C1188 - C1196.
[Abstract] [Full Text] [PDF]


Home page
Neuro Oncol DukeHome page
G. Bergers and S. Song
The role of pericytes in blood-vessel formation and maintenance
Neuro-oncol, October 1, 2005; 7(4): 452 - 464.
[Abstract] [PDF]


Home page
Genes Dev.Home page
C. E. Burns, D. Traver, E. Mayhall, J. L. Shepard, and L. I. Zon
Hematopoietic stem cell fate is established by the Notch-Runx pathway
Genes & Dev., October 1, 2005; 19(19): 2331 - 2342.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Kubota, Y. Oike, S. Satoh, Y. Tabata, Y. Niikura, T. Morisada, M. Akao, T. Urano, Y. Ito, T. Miyamoto, et al.
Cooperative interaction of Angiopoietin-like proteins 1 and 2 in zebrafish vascular development
PNAS, September 20, 2005; 102(38): 13502 - 13507.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Armulik, A. Abramsson, and C. Betsholtz
Endothelial/Pericyte Interactions
Circ. Res., September 16, 2005; 97(6): 512 - 523.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. Red-Horse, M. Kapidzic, Y. Zhou, K.-T. Feng, H. Singh, and S. J. Fisher
EPHB4 regulates chemokine-evoked trophoblast responses: a mechanism for incorporating the human placenta into the maternal circulation
Development, September 15, 2005; 132(18): 4097 - 4106.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
B.-K. Koo, H.-S. Lim, R. Song, M.-J. Yoon, K.-J. Yoon, J.-S. Moon, Y.-W. Kim, M.-c. Kwon, K.-W. Yoo, M.-P. Kong, et al.
Mind bomb 1 is essential for generating functional Notch ligands to activate Notch
Development, August 1, 2005; 132(15): 3459 - 3470.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. R. Carlson, Y. Yan, X. Wu, M. T. Lam, G. L. Tang, L. J. Beverly, L. M. Messina, A. J. Capobianco, Z. Werb, and R. Wang
Endothelial expression of constitutively active Notch4 elicits reversible arteriovenous malformations in adult mice
PNAS, July 12, 2005; 102(28): 9884 - 9889.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
R. Hallmann, N. Horn, M. Selg, O. Wendler, F. Pausch, and L. M. Sorokin
Expression and Function of Laminins in the Embryonic and Mature Vasculature
Physiol Rev, July 1, 2005; 85(3): 979 - 1000.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B.-K. Koo, K.-J. Yoon, K.-W. Yoo, H.-S. Lim, R. Song, J.-H. So, C.-H. Kim, and Y.-Y. Kong
Mind Bomb-2 Is an E3 Ligase for Notch Ligand
J. Biol. Chem., June 10, 2005; 280(23): 22335 - 22342.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
E. C. Lai, F. Roegiers, X. Qin, Y. N. Jan, and G. M. Rubin
The ubiquitin ligase Drosophila Mind bomb promotes Notch signaling by regulating the localization and activity of Serrate and Delta
Development, May 15, 2005; 132(10): 2319 - 2332.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. K. Takeuchi, M. Mileikovskaia, K. Koshiba-Takeuchi, A. B. Heidt, A. D. Mori, E. P. Arruda, M. Gertsenstein, R. Georges, L. Davidson, R. Mo, et al.
Tbx20 dose-dependently regulates transcription factor networks required for mouse heart and motoneuron development
Development, May 15, 2005; 132(10): 2463 - 2474.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. Eichmann, T. Makinen, and K. Alitalo
Neural guidance molecules regulate vascular remodeling and vessel navigation
Genes & Dev., May 1, 2005; 19(9): 1013 - 1021.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. J. Patterson, M. Gering, and R. Patient
Scl is required for dorsal aorta as well as blood formation in zebrafish embryos
Blood, May 1, 2005; 105(9): 3502 - 3511.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Y.-s. Mukouyama, H.-P. Gerber, N. Ferrara, C. Gu, and D. J. Anderson
Peripheral nerve-derived VEGF promotes arterial differentiation via neuropilin 1-mediated positive feedback
Development, March 1, 2005; 132(5): 941 - 952.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Wu, F. Iwata, J. A. Grass, C. S. Osborne, L. Elnitski, P. Fraser, O. Ohneda, M. Yamamoto, and E. H. Bresnick
Molecular Determinants of NOTCH4 Transcription in Vascular Endothelium
Mol. Cell. Biol., February 15, 2005; 25(4): 1458 - 1474.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
F. le Noble, V. Fleury, A. Pries, P. Corvol, A. Eichmann, and R.S. Reneman
Control of arterial branching morphogenesis in embryogenesis: go with the flow
Cardiovasc Res, February 15, 2005; 65(3): 619 - 628.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. Lorent, S.-Y. Yeo, T. Oda, S. Chandrasekharappa, A. Chitnis, R. P. Matthews, and M. Pack
Inhibition of Jagged-mediated Notch signaling disrupts zebrafish biliary development and generates multi-organ defects compatible with an Alagille syndrome phenocopy
Development, November 15, 2004; 131(22): 5753 - 5766.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
V. Domenga, P. Fardoux, P. Lacombe, M. Monet, J. Maciazek, L. T. Krebs, B. Klonjkowski, E. Berrou, M. Mericskay, Z. Li, et al.
Notch3 is required for arterial identity and maturation of vascular smooth muscle cells
Genes & Dev., November 15, 2004; 18(22): 2730 - 2735.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. Duarte, M. Hirashima, R. Benedito, A. Trindade, P. Diniz, E. Bekman, L. Costa, D. Henrique, and J. Rossant
Dosage-sensitive requirement for mouse Dll4 in artery development
Genes & Dev., October 15, 2004; 18(20): 2474 - 2478.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
L. T. Krebs, J. R. Shutter, K. Tanigaki, T. Honjo, K. L. Stark, and T. Gridley
Haploinsufficient lethality and formation of arteriovenous malformations in Notch pathway mutants
Genes & Dev., October 15, 2004; 18(20): 2469 - 2473.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
F. Esni, B. Ghosh, A. V. Biankin, J. W. Lin, M. A. Albert, X. Yu, R. J. MacDonald, C. I. Civin, F. X. Real, M. A. Pack, et al.
Notch inhibits Ptf1 function and acinar cell differentiation in developing mouse and zebrafish pancreas
Development, September 1, 2004; 131(17): 4213 - 4224.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Das, C. Craig, Y. Funahashi, K.-M. Jung, T.-W. Kim, R. Byers, A. P. Weng, J. L. Kutok, J. C. Aster, and J. Kitajewski
Notch Oncoproteins Depend on {gamma}-Secretase/Presenilin Activity for Processing and Function
J. Biol. Chem., July 16, 2004; 279(29): 30771 - 30780.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Tournoy, X. Bossuyt, A. Snellinx, M. Regent, M. Garmyn, L. Serneels, P. Saftig, K. Craessaerts, B. De Strooper, and D. Hartmann
Partial loss of presenilins causes seborrheic keratosis and autoimmune disease in mice
Hum. Mol. Genet., July 1, 2004; 13(13): 1321 - 1331.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S. Hans, N. Scheer, I. Riedl, E. v. Weizsacker, P. Blader, and J. A. Campos-Ortega
her3, a zebrafish member of the hairy-E(spl) family, is repressed by Notch signalling
Development, June 15, 2004; 131(12): 2957 - 2969.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
B. R. Shepherd, H. Y.S. Chen, C. M. Smith, G. Gruionu, S. K. Williams, and J. B. Hoying
Rapid Perfusion and Network Remodeling in a Microvascular Construct After Implantation
Arterioscler Thromb Vasc Biol, May 1, 2004; 24(5): 898 - 904.
[Abstract] [Full Text]


Home page
DevelopmentHome page
K. A. Hogan, C. A. Ambler, D. L. Chapman, and V. L. Bautch
The neural tube patterns vessels developmentally using the VEGF signaling pathway
Development, April 1, 2004; 131(7): 1503 - 1513.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. MacKenzie, P. Duriez, F. Wong, M. Noseda, and A. Karsan
Notch4 Inhibits Endothelial Apoptosis via RBP-J{kappa}-dependent and -independent Pathways
J. Biol. Chem., March 19, 2004; 279(12): 11657 - 11663.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. J. Whitehead, N. W. Plummer, J. A. Adams, D. A. Marchuk, and D. Y. Li
Ccm1 is required for arterial morphogenesis: implications for the etiology of human cavernous malformations
Development, March 15, 2004; 131(6): 1437 - 1448.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Tsunematsu, K. Nakayama, Y. Oike, M. Nishiyama, N. Ishida, S. Hatakeyama, Y. Bessho, R. Kageyama, T. Suda, and K. I. Nakayama
Mouse Fbw7/Sel-10/Cdc4 Is Required for Notch Degradation during Vascular Development
J. Biol. Chem., March 5, 2004; 279(10): 9417 - 9423.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
F. le Noble, D. Moyon, L. Pardanaud, L. Yuan, V. Djonov, R. Matthijsen, C. Breant, V. Fleury, and A. Eichmann
Flow regulates arterial-venous differentiation in the chick embryo yolk sac
Development, January 15, 2004; 131(2): 361 - 375.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J.-T. Chi, H. Y. Chang, G. Haraldsen, F. L. Jahnsen, O. G. Troyanskaya, D. S. Chang, Z. Wang, S. G. Rockson, M. van de Rijn, D. Botstein, et al.
Endothelial cell diversity revealed by global expression profiling
PNAS, September 16, 2003; 100(19): 10623 - 10628.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
W. Shoji, S. Isogai, M. Sato-Maeda, M. Obinata, and J. Y. Kuwada
Semaphorin3a1 regulates angioblast migration and vascular development in zebrafish embryos
Development, July 15, 2003; 130(14): 3227 - 3236.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
N. D. Lawson, J. W. Mugford, B. A. Diamond, and B. M. Weinstein
phospholipase C gamma-1 is required downstream of vascular endothelial growth factor during arterial development
Genes & Dev., June 1, 2003; 17(11): 1346 - 1351.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Iso, Y. Hamamori, and L. Kedes
Notch Signaling in Vascular Development
Arterioscler Thromb Vasc Biol, April 1, 2003; 23(4): 543 - 553.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. C. Oates and R. K. Ho
Hairy/E(spl)-related (Her) genes are central components of the segmentation oscillator and display redundancy with the Delta/Notch signaling pathway in the formation of anterior segmental boundaries in the zebrafish
Development, March 8, 2003; 129(12): 2929 - 2946.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
B. L. Roman, V. N. Pham, N. D. Lawson, M. Kulik, S. Childs, A. C. Lekven, D. M. Garrity, R. T. Moon, M. C. Fishman, R. J. Lechleider, et al.
Disruption of acvrl1 increases endothelial cell number in zebrafish cranial vessels
Development, March 8, 2003; 129(12): 3009 - 3019.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
H. Kubo and K. Alitalo
The bloody fate of endothelial stem cells
Genes & Dev., February 1, 2003; 17(3): 322 - 329.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Hamada, Y. Oike, Y. Ito, H. Maekawa, K. Miyata, T. Shimomura, and T. Suda
Distinct Roles of Ephrin-B2 Forward and EphB4 Reverse Signaling in Endothelial Cells
Arterioscler Thromb Vasc Biol, February 1, 2003; 23(2): 190 - 197.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Funahashi, N. H. Sugi, T. Semba, Y. Yamamoto, S. Hamaoka, N. Tsukahara-Tamai, Y. Ozawa, A. Tsuruoka, K. Nara, K. Takahashi, et al.
Sulfonamide Derivative, E7820, Is a Unique Angiogenesis Inhibitor Suppressing an Expression of Integrin {alpha}2 Subunit on Endothelium
Cancer Res., November 1, 2002; 62(21): 6116 - 6123.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
C. Thisse and L. I. Zon
Organogenesis--Heart and Blood Formation from the Zebrafish Point of View
Science, January 18, 2002; 295(5554): 457 - 462.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
B.M. WEINSTEIN and N.D. LAWSON
Arteries, Veins, Notch, and VEGF
Cold Spring Harb Symp Quant Biol, January 1, 2002; 67(0): 155 - 162.
[Abstract] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Movies
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lawson, N. D.
Right arrow Articles by Weinstein, B. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lawson, N. D.
Right arrow Articles by Weinstein, B. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?