|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||

1 ICRF Clare Hall Laboratories, South Mimms, Hertfordshire EN6 3LD, UK
2 Institut für Molekulare Medizin, Klinik für Tumorbiologie, Universität Freiburg, Breisacher Strasse 117, 79121 Freiburg, Germany
3 Unité de Biologie et Genetique du Development, CNRS UPR 41, Université Rennes I, Avenue du General Leclerc, 35042 Rennes, France
4 Department of Biochemistry, University of Oxford, South Parks Road, Oxford OX1 3QU, UK
* Deceased June 2001
Author for correspondence (e-mail: tim.hunt{at}icrf.icnet.uk)
Accepted July 5, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Cell cycle, Meiosis, Maturation promoting factor, Eg-2, c-mos, Antisense oligonuceotides, Cycloheximide, Cyclin-dependent kinase, Xenopus laevis, Xenopus tropicalis
| INTRODUCTION |
|---|
|
|
|---|
Protein synthesis is necessary for the activation of pre-MPF (Barkoff et al., 1998; Gerhart et al., 1984; Roy et al., 1996; Sagata et al., 1988; Wasserman and Masui, 1975). Newly synthesised proteins are required to activate Cdc25, which removes inhibitory Thr-14 and Tyr-15 phosphates on p34cdc2, and to inhibit Myt1 protein kinase (Gautier et al., 1991; Karaiskou et al., 1998; Kumagai and Dunphy, 1991; Mueller et al., 1995). Apart from a few exceptions, the nature of the newly synthesised proteins that are required for oocyte maturation remains elusive. Thus, it is well established that cmos synthesis is necessary for MAP kinase and MPF activation (Freeman et al., 1990; Sagata et al., 1989a; Sagata et al., 1988; Sheets et al., 1995), yet it is not sufficient for this process. In the absence of protein synthesis, c-mos cannot induce pre-MPF activation (Daar et al., 1993; Huang et al., 1995; Murakami and Vande Woude, 1997; Nebreda and Hunt, 1993; Shibuya and Ruderman, 1993; Yew et al., 1992). More recently, a novel p34cdc2 binding protein named Ringo (Speedy) has been identified, whose translation seems to be both required and sufficient for GVBD (Ferby et al., 1999; Lenormand et al., 1999).
After GVBD, continued protein synthesis is required for successful completion of MI, the reappearance of MPF at the onset of MII (Gerhart et al., 1984), for suppression of interphase between MI and MII and for the establishment of the metaphase arrest at the end of MII (Furuno et al., 1994; Iwabuchi et al., 2000; Nakajo et al., 2000; Thibier et al., 1997). The key feature of the meiotic cell cycle, the direct succession of two M-phases, without intermediate interphase and DNA replication is thus clearly dependent on newly synthesised proteins, but the identity of these proteins remains to be established. Although there is good evidence that c-mos synthesis is required for suppression of DNA replication after exit from MI (Furuno et al., 1994; Kanki and Donoghue, 1991), Roy et al. (Roy et al., 1996) found that active c-mos could not prevent entry into interphase during meiosis in the presence of cycloheximide (CHX).
B-type cyclins are newly synthesised in response to progesterone (Frank-Vaillant et al., 1999; Kobayashi et al., 1991), and are able to induce entry into meiosis even in the absence of protein synthesis (Nebreda et al., 1995; Roy et al., 1991). They are good candidates to help account for the protein synthesis requirement during oocyte maturation besides c-mos and Ringo. A small pool of newly synthesised active MPF is able to bring about Cdc25 activation and inactivation of Myt1 (Hoffmann et al., 1993; Mueller et al., 1995; Solomon et al., 1990) and hence to establish a positive feedback loop of MPF activation. Furthermore, cyclins are degraded during MI by the APC/C (Peter et al., 2001; Taieb et al., 2001) and accumulate again during entry into MII (Gross et al., 2000; Kobayashi et al., 1991; Ohsumi et al., 1994; Thibier et al., 1997). Most likely, the synthesis and (or) stabilisation of B-type cyclins are involved in suppression of interphase during the transition from MI to MII (Gross et al., 2000; Iwabuchi et al., 2000; Nakajo et al., 2000). Experiments with dominant negative (kinase-dead) p34cdc2 support this idea. Whereas injection of kinase-dead p34cdc2 into stage VI oocytes blocks GVBD, probably by sequestering newly synthesised cyclins or other p34cdc2 binding proteins (Nebreda et al., 1995), injection of the same reagent after GVBD induces DNA replication at the MI/MII transition (Furuno et al., 1994).
Conversely, inhibition of cyclin B1 and B2 synthesis using antisense oligonucleotides did not interfere with either entry or progression through meiosis (Minshull et al., 1991). This result suggested that cyclin synthesis is not required for the initial activation of pre-MPF at GVBD (Gautier and Maller, 1991; Kobayashi et al., 1991). These studies also implied that the stockpile of cyclin B bound to p34cdc2 in immature oocytes is sufficient to allow progression from MI to MII. If this were true, the transition from MI to MII would be more dependent on cyclin stabilisation rather than new cyclin synthesis after MI, as suggested by the results of Gross et al. (Gross et al., 2000).
These arguments are undermined, however, by the discovery of two new embryonic B-type cyclins in Xenopus oocytes as reported in this paper. These novel B-type cyclins are closely related to cyclins B1 and B2 but are sufficiently diverged in mRNA sequence to avoid ablation by the oligonucleotides used in Minshull et al.s antisense experiments (Minshull et al., 1991). Here, we reinvestigate the requirements for cyclin synthesis during Xenopus oocyte maturation, including the newly discovered B-type cyclins. We show that cyclin synthesis is indeed not required for the activation of MPF, but it is essential and apparently sufficient for progression from MI to MII and the establishment of CSF-arrest.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The accession numbers of X. laevis cyclins B3, B4 and B5 are AJ304990-AJ304992 respectively. X. tropicalis partial cDNA sequences have the accession nos. AJ303451-AJ303454 for cyclins B1, 2, 4 and 5.
Antisense oligonucleotides
The sequences of antisense oligonucleotides were: cyc8, gtacatctcttcatatt; anti-B1/4, gcagctttctttccagccattc; anti B5-2, tccatctgtcctgta. Both ends of cyc8 (bold letters) were synthesised using 2'-O-methyl ribonucleotide-CE phosphoramidites on a 2'-O-methyl ribonucleotide column. The innermost nine nucleotides were synthesised using deoxynucleotide-CE phosphoramidites. Deprotection occurred in concentrated ammonia at 55°C for 8 hours. Oligonucleotides were purified through NAP-10 columns (Amersham Pharmacia).
Production of specific antisera against Xenopus cyclins
N-terminal fragments comprising the first 108 amino acids of cyclins B1, B2 and B4 were subcloned into pET21b and expressed as C-terminally His-tagged proteins in E. coli BL21(DE3). They were purified using Ni-agarose columns (Qiagen), and used to immunise rabbits to generate polyclonal antisera by standard methods. For cyclin B5, a 16 residue synthetic peptide corresponding to the N terminus (WAAMRTGQMDNAVVKK) was coupled to KLH and used for immunisation. Antisera against cyclins B1, B2 and B4 gave similar signals on immunoblots in response to titrations of the antigens. All the antisera were affinity purified with the appropriate antigen. Their specificity was tested by immunoblotting in vitro translation reactions using each cyclin mRNA in the reticulocyte lysate. Fig. 1 shows that these reagents were highly specific for their cognate cyclin, reflecting their variable N-terminal sequences (see Fig. 2). Titrations of the antibodies against B1, B2 and B4 against their cognate bacterial antigens showed that the anti-B2 antiserum gave a signal approximately 2.5 time higher than those of anti-B1 and -B4, which gave similar signals to each other. The sensitivity of detection of the anti-B5 antiserum could not be tested in this manner, because it was raised against a peptide, and expression of the cyclin B5 N terminus in bacteria was poor.
|
|
Translation of endogenous mRNA in Xenopus egg extracts
Cytostatic factor (CSF)-arrested Xenopus egg extracts were prepared as described by Murray (Murray, 1991). Translation reactions were prepared by mixing equal volumes of egg extract and nuclease-treated rabbit reticulocyte lysate (Ambion). The mixture was incubated at 22°C for 30 minutes in the presence of antisense oligonucleotides at 1 µM. After this preincubation, 1 µl (1.4 µCi) of [35S]Pro-mixTM (>1000 Ci/mmol; Amersham) was added per 20 µl reaction volume to initiate labelling, and incubated at 22°C for a further 90 minutes. Aliquots of 20 µl were subjected to immunoprecipitation and analysed by SDS-PAGE and fluorography.
Handling of Xenopus oocytes
Ovaries were suspended in OR2 medium (82.5 mM NaCl, 2 mM KCl, 1 mM MgCl2, 5 mM K-Hepes pH 7.5) (Eppig and Dumont, 1976), treated with 1 mg/ml collagenase (Boehringer Mannheim) for 3 hours, washed and resuspended in modified Barth medium (Heasman et al., 1991). Stage VI oocytes were manually sorted and left for no longer than 12 to 24 hours at 18°C. They were induced to mature with 5 µg/ml progesterone (Sigma) at 22°C. Populations of oocytes that synchronously underwent GVBD were used for cytological and biochemical analysis of the two meiotic divisions, by collecting oocytes that had just formed the white spot (within a window of 15 minutes) from a pool of about 1000 oocytes.
Microinjection and cycloheximide treatment of oocytes
Oligonucleotides were dissolved in water and 50 nl of the solution was injected into oocytes 30 minutes after adding progesterone. cyc8 was used at a concentration of 1.5 mg/ml; anti-B5-2 at 0.5 mg/ml and anti-B1/B4 at 2 mg/ml; control oligonucleotides at 2 mg/ml. About 600 oocytes were injected to obtain pools of 150-200 oocytes that underwent GVBD synchronously. Cyclin B1 mRNAs (50 ng) were dissolved in water. Bacterially expressed sea urchin (Arbacia) cyclin B
90 (from J. Gannon) was dissolved in PBS and injected at the indicated concentrations. To measure the stability of radiolabelled cyclin B1, 50 nl of TnT translation mix (Promega) programmed with cyclin B1 plasmid DNA in the presence of 35S-labelled amino acids was injected into each of 20 oocytes. Samples of 3 oocytes were harvested at 20 minutes intervals. CSF-arrested oocytes were incubated in a Ca2+-limited medium (120 mM NaCl, 7.5 mM KCl, 22.5 mM Hepes, 400 µM EDTA, 500 µM MgSO4, 150 µM CaCl2) before injection in order to avoid activation. Where indicated, 100 µg/ml cycloheximide (final concentration) was added to the medium.
RNA extraction, northern blotting and RNase protection assays
RNA was extracted from samples of 20 oocytes following the proteinase K/phenol method described in section 7.16 of Sambrook et al. (Sambrook et al., 1989). Total RNA (10 µg) was separated on a 1% agarose gel in 20 mM Mops; 5 mM sodium acetate; 1 mM EDTA and 2% formaldehyde, transferred to Hybond-N+, and UV cross linked. We used PCR-fragments of the last 400 nucleotides of the B-type cyclin N-termini as probes. RNAse protection assays were performed using 5 µg of total RNA. Antisense RNA probes of N-terminal fragments of different cyclins were transcribed from pGEM vectors using T7 RNA polymerase and [
-32P]CTP (Amersham). The RNase protection assays used Ambion RPAII Kit following the manufacturers protocol. The protected fragments were analysed by electrophoresis on a 5% acrylamide/8 M urea gel and autoradiography.
Immunoblotting
Cell-free extracts of Xenopus oocytes and embryos were prepared by crushing 10 oocytes in 100 µl EB buffer (Gerhart et al., 1984), followed by centrifugation for 10 minutes in an Eppendorf centrifuge. The clear portion of the supernatant was precipitated in 3 vol. acetone and dissolved in SDS sample buffer. An aliquot corresponding to one oocyte was analysed by SDS-PAGE. The lanes were electrophoretically transferred to nitrocellullose and immunoblotted with the indicated antisera. Equal loading of different lanes was confirmed by staining the blots with 0.3% Ponceau in 3% TCA. The bound antibodies were detected with the appropriate HRP-coupled secondary antibody and the Amersham-Pharmacia ECL kit.
Histone kinase assays
Five oocytes were homogenised in EB buffer (10 µl/oocyte), centrifuged briefly, and 5 µl of the clear supernatant was assayed for histone H1 kinase activity as described previously (Furuno et al., 1994).
Confocal immunofluorescence microscopy of meiotic spindles in Xenopus oocytes
Xenopus oocytes were fixed and stained following the protocol described by Gard (Gard, 1993). Primary antibodies were 10 µg/ml anti-phospho-histone H3 rabbit polyclonal (Upstate Biotechnology) and 10 µg/ml Tat-1 anti-tubulin mouse monoclonal (Woods et al., 1989). Secondary antibodies were used at a dilution of 1000-fold (Alexa 488 and Alexa 546, Molecular Probes). Images were obtained with a Zeiss laser scanning microscope.
| RESULTS |
|---|
|
|
|---|
Frog oocytes also contain a mRNA that encodes cyclin B3, a more distant relative of the other B-type cyclins with closer similarity to the cyclin A family (see Fig. 2B). Cyclin B3 was first identified in chickens, nematodes and flies (Gallant and Nigg, 1994; Jacobs et al., 1998; Kreutzer et al., 1995; Sigrist et al., 1995), and there is a human version of the gene close to the centromere of chromosome 5 as well as several human ESTs. We have been unable to detect significant levels of cyclin B3 protein during frog oocyte maturation, however, or during early embryonic cell cycles (data not shown). Reconstruction experiments with translated synthetic mRNA showed that the limits of detection were below 1 ng/oocyte. For this reason, we consider it highly unlikely that cyclin B3 is involved in Xenopus oocyte maturation.
Stage VI oocytes contain cyclins B2 and B5, but very low levels of B1 and B4 (Fig. 3). Cyclin B2, but not cyclin B5 (which has the sequence EPPPIP in place of VPSPVP), undergoes a phosphorylation-dependent shift in electrophoretic mobility after progesterone treatment (Gautier and Maller, 1991; Kobayashi et al., 1991), and the levels of both these cyclins drop at later stages of oocyte maturation. Cyclins B1 and B4 started to accumulate around the time of MPF activation, 4 hours after progesterone addition (at which time 30% of the oocytes had a white spot in this experiment). The accumulation of c-mos and activation of MAP kinase (correlated with an electrophoretic mobility shift) (Haccard et al., 1993) preceded these events by approximately 1 hour. A second more dramatic increase in levels of cyclins B1 and B4 is reproducibly seen late in meiosis, between 7 and 8 hours after progesterone treatment.
|
|
|
|
Progression from MI to MII requires new cyclin synthesis
After formation of the first polar body, a new microtubule array forms underneath the surface of the oocyte. This array quickly transforms into the second meiotic spindle that rotates again into the final axial position, where it arrests in metaphase II (Fig. 5C). In oocytes injected with anti-B-type cyclin oligonucleotides, the second meiotic spindle failed to assemble. The chromosomes eventually moved towards the centre of the cell and became embedded in a dense microtubule network (Fig. 5C; antisense), where they remained partly condensed and continued to give a detectable signal with the anti-phospho-histone H3 antibody until approximately 2.5 hours after GVBD. Oocytes injected with the same concentration of random or sense oligonucleotides arrested in MII with a healthy looking metaphase II spindle (Fig. 5C; sense).
Inhibition of protein synthesis with CHX after GVBD interferes with completion of MI
In contrast to oocytes injected with antisense oligonucleotides, oocytes exposed to CHX shortly after GVBD did not complete MI. As previously reported by several groups, CHX applied at the time of GVBD caused rapid entry into interphase and initiation of DNA replication at the end of MI (Furuno et al., 1994; Huchon et al., 1993; Wasserman and Masui, 1975). Cytological analysis revealed that under these conditions, a compact spindle formed without properly aligned chromosomes. This structure persisted for approximately 1 hour after GVBD (Fig. 5D and data not shown). After this, the signal from the anti-phospho-histone H3 antibody rapidly disappeared and by 90 minutes the microtubule arrays in these oocytes were undetectable (data not shown). These data show that protein synthesis is required for proper completion of MI and entry into MII, whereas the antisense data imply that new cyclin synthesis is only necessary to enter and maintain MII.
Comparisons between CHX and antisense-treated oocytes
To further investigate this point, the levels of B-type cyclins and histone H1 kinase activity were measured in a set of progesterone-treated oocytes that were either not injected (control), or injected with cyc8 and anti-B5-2 oligonucleotides, or exposed to CHX just after GVBD (Fig. 6). In this experiment, a synchronously maturing cohort of oocytes was selected by hand. We also analysed the expression of c-mos and the phosphorylation status of MAP kinase and the APC/C subunit Cdc27, as deduced from their electrophoretic mobility.
During MI, the pool of B-type cyclins consisted mainly of cyclins B2 and B5. Histone kinase activity dropped partially and transiently after entry into meiosis, reflecting the overall cyclin levels: in this experiment, cyclin B2/B5 levels declined somewhat before cyclins B1/B4 accumulated. In the antisense-injected oocytes, histone H1 kinase activity declined roughly in parallel with the loss of B2/B5 after MI, and never recovered. By contrast, addition of CHX led to a much more rapid decay of histone kinase activity, even though cyclins B2 and B5 disappeared with similar kinetics in the CHX and antisense-treated oocytes. The reason for this difference is not clear. The expression patterns of c-mos and the activity of MAP kinase followed the pattern of histone kinase activity. In the absence of cyclin synthesis, MAP kinase was inactivated during MII and c-mos was degraded 120-150 minutes after GVBD. In CHX-treated oocytes, loss of MAP kinase and the disappearance of c-mos occurred much earlier, 30-60 minutes after GVBD, reflecting the earlier fall in histone kinase activity. The levels of cyclins B1 and B2 and the total histone H1 kinase activity are plotted in Fig. 6B.
Fig. 6 also shows the phosphorylation-dependent mobility shift of Cdc27 during oocyte maturation as described previously (Thibier et al., 1997; Gross et al., 2000), which appears to correlate with the activity of the APC/C (Vorlaufer and Peters, 1998). The phosphorylation status of Cdc27 partially reflected the changes in histone kinase activity during oocyte maturation. Cdc27 became phosphorylated early in MI and remained mainly in an intermediate state of electrophoretic mobility until the end of MII, regardless of the histone H1 kinase activity. A hyperphosphorylated band was present only when histone kinase activity was at a maximum. About 3 hours after GVBD in the control oocytes, all the Cdc27 was converted into this hyperphosphorylated species, which seems to be correlated with cyclin stabilisation and CSF activity (Vorlaufer and Peters, 1998). In oocytes injected with antisense oligonucleotides or treated with CHX, the hyperphosphorylated form of Cdc27 was never as obvious, and the upper smear had completely disappeared by 90 minutes in both cases.
Fig. 6 suggests that cyclins B2 and B5 do not accumulate to their previous levels during MII, but this turned out to be a variable feature of different batches of oocytes. Cyclin B2 and B5 were synthesised strongly during MII in some experiments, while in other cases (as in Fig. 6) they were not. We found that specific ablation of cyclins B1 and B4 was sufficient to inhibit MII in those batches of oocytes in which cyclins B2 and B5 did not accumulate. In the oocytes in which high levels of the B2 and B5 cyclins were synthesized after MI, antisense ablation of cyclin B1 and B4 had no effect on progression through meiosis (data not shown).
Cyclin B
90 reverts the effects of cyclin ablation
The simplest interpretation of these results is that B-type cyclin synthesis is essential for progression through the meiotic cell cycle after MI metaphase. This conclusion relies on treatment of oocytes with antisense oligonucleotides, which can cause a variety of non-specific side effects (Minshull and Hunt, 1992). We therefore tested if the ill effects of the anti-cyclin oligonucleotides could be rescued by introduction of a B-type cyclin protein at the appropriate time. One and a half hours after GVBD (at the end of MI) recombinant sea urchin cyclin B
90 was injected into oocytes whose mRNA for cyclins B1 and B4 had been ablated by antisense oligonucleotides. Fig. 7A shows that these antisense oligonucleotides caused the usual disturbance of the pigmented oocyte surface in this batch of oocytes, and that the mRNA for cyclins B1 and B4 was efficiently ablated. Histone kinase activity fell to low levels in these antisense-treated oocytes (Fig. 7C). The pigment disturbances, the loss of histone kinase and of c-mos were all prevented by injection of 25 ng cyclin B
90. Fig. 7D shows that oocytes injected with cyclin B
90 contained somewhat disorganised spindles with condensed but scattered chromosomes. In the antisense-injected oocytes that did not receive cyclin B
90, microtubule arrays like those shown in Fig. 5C were observed at the equivalent time (3 hours after GVBD). The peculiar morphology of the rescued spindles occurred even without any DNA injection when the Arbacia cyclin B
90 was introduced (Fig. 7D), as has previously been reported in egg extracts (Glotzer et al., 1991; Luca et al., 1991; Minshull et al., 1994; Murray et al., 1989).
|
|
We next tested whether the presence of indestructible cyclin B was sufficient to allow activation of CSF, in the absence of other protein synthesis. We injected [35S]methionine-labelled cyclin B1 that had been synthesised in reticulocyte lysate into oocytes and followed its degradation during a period of 1 hour (Fig. 9A). As expected from the previous experiments of Thibier et al. (Thibier et al., 1997) and Peter et al. (Peter et al., 2001), the labelled protein was unstable during M I and M II (data not shown). Fig. 9A shows that cyclin B1 was stable in normal MII arrested oocytes. In oocytes treated with CHX, however, the labelled cyclin B1 was unstable at the equivalent time after GVBD, confirming that inhibition of protein synthesis prevented the establishment of CSF arrest. Injection of mRNA encoding stable cyclin B1 30 minutes before adding CHX allowed the establishment of the CSF arrest, as indicated by the stability of the labelled cyclin B1 (Fig. 9A). We interpret these results to suggest that the presence of indestructible cyclin B1 was sufficient to support the formation of metaphase-arrested meiotic spindles, even in the absence of other protein synthesis (Fig. 9B). The spindles in these oocytes looked very similar to those in control oocytes, but were consistently slightly enlarged (with a length of approximately 60 µm compared to 45-50 µm in control oocytes; Fig. 9B). No spindle-like structures or condensed chromosomes were observed in oocytes after CHX treatment (data not shown), and Huchon et al. (Huchon et al., 1993) previously showed that such oocytes rapidly form nuclei.
|
90 protein reverted all the observed effects of cycloheximide. We conclude that by 30 minutes after exit from MI, no other proteins apart from cyclins need to be newly synthesised in order to assemble the MII spindle and to establish CSF-mediated inhibition of the APC. | DISCUSSION |
|---|
|
|
|---|
MPF activation at the G2/M transition does not require new synthesis of B-type cyclins
Complete ablation of all mRNAs for B-type cyclins did not delay the timing or extent of GVBD, suggesting that even though B-type cyclin synthesis is able to trigger MPF activation, it is dispensable for this process. We conclude from these results that the pool of pre-MPF in stage VI oocytes is sufficient to allow entry into M-phase and that cyclin B synthesis is not required for the amplification loop that leads to MPF activation. Previously, it was shown that cyclin A1 was not required for oocyte maturation (Minshull et al., 1991), and the levels of cyclin A are about 1% of the level of cyclin B1 at the time of GVBD (Kobayashi et al., 1991). We therefore consider it unlikely that any new cyclin synthesis is required for the G2-M transition in Xenopus oocytes, whereas the recently discovered Ringo/Speedy protein is an excellent candidate, alongside c-mos, to account for the protein synthesis requirement for progesterone-induced oocyte maturation (Ferby et al., 1999; Lenormand et al., 1999; Sagata et al., 1989a).
A similar situation is found in the somatic cell cycle, where a pool of inactive cyclin B/p34cdc2 accumulates until the end of G2, and new protein synthesis is required for the final activation of MPF and entry into M-phase (Altman et al., 1970; Daga and Jimenez, 1999; Nishijima et al., 1997; Wagenaar, 1983). It is thus conceivable, perhaps even likely, that the newly synthesised proteins in somatic cells are not B-type cyclins.
MPF activity during MI depends on the synthesis of unidentified proteins
The maternal stockpile of cyclin B2 and B5 protein is sufficient to support what appears to be normal assembly of the first meiotic spindle without any new cyclin synthesis. The stockpile of these maternal cyclins is then degraded slowly and with similar kinetics after antisense treatment or CHX treatment. By contrast, histone kinase activity falls much more rapidly when CHX is added to oocytes shortly after GVBD than in antisense-treated oocytes. Furthermore, complete inhibition of protein synthesis just after formation of the white spot interferes strongly with spindle assembly. Comparison between the specific inhibition of new cyclin synthesis as opposed to complete inhibition of translation thus reveals the existence of unidentified protein(s) that need to be synthesized in order to keep MPF active after GVBD. The same analysis reveals that histone H3 phosphorylation is not directly linked to MPF activity in Xenopus oocytes. We could detect phosphorylated histone H3 in condensed chromosomes long after MPF had become inactive in antisense injected oocytes (Fig. 5C). In the presence of CHX, however, the signal for histone H3 phosphorylation disappeared rapidly, before MI was completed. We conclude that histone H3 phosphorylation is maintained by another protein synthesis-dependent activity during meiosis. The Aurora kinases, Eg2 and Airk2, are known to phosphorylate serine 9 in histone H3 kinase (Hsu et al., 2000; Speliotes et al., 2000), but they appear to be stable proteins in Xenopus oocytes (H.H., unpublished data). There may be other candidate kinases, or the activation of the Aurora family may depend indirectly on protein synthesis.
Cyclin synthesis is essential and sufficient during MII
Suppression of interphase and progression through MII until the CSF-dependent arrest at metaphase represents the final protein synthesis requirement of oocyte maturation. Passage between MI and MII is associated with high APC/C activity, so that proteins containing destruction boxes are highly unstable at this time. Addition of CHX 1.5 hours after white spot formation (i.e. after MI has been completed) leads to the rapid loss of cyclins and MAP kinase activity and returns the cell to interphase. Specific inhibition of B-type cyclin synthesis similarly prevented entry into MII: antisense-injected oocytes did not reactivate MPF, did not form a normal MII spindle, and appeared very similar to CHX-treated oocytes (the white puffball phenotype). We were previously misled (Minshull et al., 1991) into concluding that the pool of pre-MPF was sufficient for completion of meiosis, because we did not suspect the existence of cyclins B4 and B5, whose continued synthesis is sufficient to support a normal MII. This revised interpretation is supported by the observation of Iwabuchi et al. (Iwabuchi et al., 2000) and Nakajo et al. (Nakajo et al., 2000) that a certain threshold level of MPF activity is required to keep newly synthesised Wee1 in check (Murakami and Vande Woude, 1998).
The deleterious effects of general inhibition of cyclin synthesis using antisense oligonucleotides were largely prevented by injection of indestructible cyclin B (sea urchin
90), except that the spindles were somewhat abnormal. As discussed above, Arbacia
90 cyclin B caused spindle abnormalities even in control oocytes, but it is also possible that the antisense oligonucleotides we used may have inadvertently ablated other mRNAs whose products are important for assembly of a perfect spindle. It is likely that other proteins, in particular c-mos, need to be synthesised in order to promote the increase in cyclin synthesis that normally occurs at the transition between MI and MII.
None of our observations can account for the long-standing paradox that CSF activity does not appear during MI metaphase. A reasonable explanation for this could be the existence of a protein X, which starts to be made some time after exposure to progesterone, and only reaches its necessary threshold after completion of MI. Our results do imply, however, that MPF activity is required for this hypothetical protein to inhibit the APC.
The different levels of cyclins B2 and B5 synthesis in different batches of oocytes after the completion of MI reflect the possibility of significant biochemical differences between oocytes derived from different frogs, and even between sub-populations of oocytes as previously reported by Fisher et al. (Fisher et al., 1999). Cyclins B1 and B4 are dispensable if cyclins B2 and B5 accumulate to significant levels after MI. This argues against the possibility that the two families of B-type cyclins have specific substrate targeting functions that are necessary for progression into MII. Nevertheless, cyclins B1 and B4 were required in about half the batches of oocytes that we have analysed (n=15). Synthesis of cyclins B1 and B4 is thus the predominant event that allows progression from MI to MII, whereas cyclins B2 and B5 are the major components of the maternal stockpile of pre-MPF whose activation is required for GVBD. We have ablated each individual B-type cyclin using specific antisense oligonucleotides, and not observed any obvious defects in oocyte maturation (Sohail et al., 2001)(data not shown). We conclude that there is considerable functional overlap between these four B-type cyclins.
The interdependence of MAP kinase and MPF at the MI/MII transition
In this paper, we provide evidence that c-mos accumulation and MAP kinase activity depend on MPF. Loss of MPF after GVBD results in inactivation of MAP kinase, followed by the disappearance of c-mos. The activity of MAP kinase in frog oocytes requires the activity of c-mos (Nebreda et al., 1993; Nebreda and Hunt, 1993; Posada et al., 1993; Shibuya and Ruderman, 1993). Hence, MPF seems to be required to maintain c-mos activity, possibly by phosphorylating it on S3 (Fisher et al., 2000). The subsequent disappearance of c-mos is probably a consequence of its dephosphorylation/inactivation (Nishizawa et al., 1992).
Conversely, accumulation of cyclins during MII is strictly dependent on the c-mos/MAP kinase/p90rsk pathway (Furuno et al., 1994; Gross et al., 2000). The mutual interdependence of cyclins and c-mos is crucial during Xenopus oocyte maturation, and if either fails to appear, the other is powerless to act. A recent paper (Frank-Vaillant et al., 2001) disagrees with these conclusions. These investigators injected 1 µM (final concentration) GST-p21cip1 into oocytes to inhibit the activity of CDK1, and we suspect that this may not have been quite sufficient to achieve complete inhibition of the kinase. The concentration of CDK1 in oocytes is about 0.5 µM (Kobayashi et al., 1994), and p21 is not as powerful an inhibitor of cyclin B-dependent CDKs as it is of cyclin A- and E-CDKs (Strausfeld et al., 1994).
The results presented in this paper give a clearer view of why protein synthesis is needed for progression of MI to MII. The translational activation of B-type cyclins after MI ensures that MPF activity is quickly restored, even though the cyclins turn over rapidly until CSF shuts down the APC/C. What determines the timing of this translational activation, and how it is controlled by the c-mos/MAP kinase/p90rsk pathway remain to be investigated. The most extreme interpretation of the data in this paper would be that no other protein synthesis is required for progression from MI to MII if high enough levels of B-type cyclins are present. We cannot exclude that other key proteins are synthesized during the 30 minute window between MI and MII that (of necessity) remained open in our experiments. It is clear, however, that the strong synthesis of B-type cyclins after the completion of MI is a key event allowing proper transition between the two meiotic divisions.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Altman, K. I., Gerber, G. B. and Okada, S. (1970). Radiation Biochemistry. New York: Academic Press.
Barkoff, A., Ballantyne, S. and Wickens, M. (1998). Meiotic maturation in Xenopus requires polyadenylation of multiple mRNAs. EMBO J. 17, 3168-3175.[Medline]
Bhatt, R. R. and Ferrell, J. E., Jr (1999). The protein kinase p90rsk as an essential mediator of cytostatic factor activity. Science 286, 1362-1365.
Cyert, M. S. and Kirschner, M. W. (1988). Regulation of MPF activity in vitro. Cell 53, 185-195.[Medline]
Daar, I., Yew, N. and Vande Woude, G. F. (1993). Inhibition of mos-induced oocyte maturation by protein kinase A. J. Cell Biol. 120, 1197-1202.
Daga, R. R. and Jimenez, J. (1999). Translational control of the cdc25 cell cycle phosphatase: a molecular mechanism coupling mitosis to cell growth. J. Cell Sci. 112, 3137-3146.[Abstract]
Draetta, G., Luca, F., Westendorf, J., Brizuela, L., Ruderman, J. and Beach, D. (1989). Cdc2 protein kinase is complexed with both cyclin A and B: evidence for proteolytic inactivation of MPF. Cell 56, 829-838.[Medline]
Eppig, J. J. and Dumont, J. N. (1976). Defined nutrient medium for the in vitro maintenance of Xenopus laevis oocytes. In vitro 12, 418-427.[Medline]
Ferby, I., Blazquez, M., Palmer, A., Eritja, R. and Nebreda, A. R. (1999). A novel p34(cdc2)-binding and activating protein that is necessary and sufficient to trigger G(2)/M progression in Xenopus oocytes. Genes Dev. 13, 2177-2189.
Ferrell, J. E., Jr (1999). Xenopus oocyte maturation: new lessons from a good egg. BioEssays 21, 833-842.[Medline]
Fisher, D. L., Brassac, T., Galas, S. and Dorée, M. (1999). Dissociation of MAP kinase activation and MPF activation in hormone-stimulated maturation of Xenopus oocytes. Development 126, 4537-4546.[Abstract]
Fisher, D. L., Mandart, E. and Dorée, M. (2000). Hsp90 is required for c-Mos activation and biphasic MAP kinase activation in Xenopus oocytes. EMBO J. 19, 1516-1524.[Medline]
Frank-Vaillant, M., Haccard, O., Ozon, R. and Jessus, C. (2001). Interplay between Cdc2 kinase and the c-Mos/MAPK pathway between metaphase I and metaphase II in Xenopus oocytes. Dev. Biol. 231, 279-288.[Medline]
Frank-Vaillant, M., Jessus, C., Ozon, R., Maller, J. L. and Haccard, O. (1999). Two distinct mechanisms control the accumulation of cyclin B1 and Mos in Xenopus oocytes in response to progesterone. Mol. Biol. Cell 10, 3279-3288.
Freeman, R. S., Kanki, J. P., Ballantyne, S. M., Pickham, K. M. and Donoghue, D. J. (1990). Effects of the v-mos oncogene on Xenopus development: meiotic induction in oocytes and mitotic arrest in cleaving embryos. J. Cell Biol. 111, 533-541.
Furuno, N., Nishizawa, M., Okazaki, K., Tanaka, H., Iwashita, J., Nakajo, N., Ogawa, Y. and Sagata, N. (1994). Suppression of DNA replication via Mos function during meiotic divisions in Xenopus oocytes. EMBO J. 13, 2399-2410.[Medline]
Gallant, P. and Nigg, E. A. (1994). Identification of a novel vertebrate cyclin: cyclin B3 shares properties with both A- and B-type cyclins. EMBO J. 13, 595-605.[Medline]
Gard, D. L. (1992). Microtubule organization during maturation of Xenopus oocytes: assembly and rotation of the meiotic spindles. Dev. Biol. 151, 516-530.[Medline]
Gard, D. L. (1993). Confocal immunofluorescence microscopy of microtubules in amphibian oocytes and eggs. Methods Cell Biol. 38, 241-264.[Medline]
Gard, D. L., Cha, B. J. and Schroeder, M. M. (1995). Confocal immunofluorescence microscopy of microtubules, microtubule- associated proteins, and microtubule-organizing centers during amphibian oogenesis and early development. Curr. Top. Dev. Biol. 31, 383-431.[Medline]
Gautier, J. and Maller, J. L. (1991). Cyclin B in Xenopus oocytes: implications for the mechanism of pre-MPF activation. EMBO J. 10, 177-182.[Medline]
Gautier, J., Minshull, J., Lohka, M., Glotzer, M., Hunt, T. and Maller, J. L. (1990). Cyclin is a component of maturation-promoting factor from Xenopus. Cell 60, 487-494.[Medline]
Gautier, J., Solomon, M. J., Booher, R. N., Bazan, J. F. and Kirschner, M. W. (1991). cdc25 is a specific tyrosine phosphatase that directly activates p34cdc2. Cell 67, 197-211.[Medline]
Gerhart, J., Wu, M. and Kirschner, M. (1984). Cell cycle dynamics of an M-phase-specific cytoplasmic factor in Xenopus laevis oocytes and eggs. J. Cell Biol. 98, 1247-1255.
Glotzer, M., Murray, A. W. and Kirschner, M. W. (1991). Cyclin is degraded by the ubiquitin pathway. Nature 349, 132-138.[Medline]
Gross, S. D., Schwab, M. S., Lewellyn, A. L. and Maller, J. L. (1999). Induction of metaphase arrest in cleaving Xenopus embryos by the protein kinase p90Rsk. Science 286, 1365-1367.
Gross, S. D., Schwab, M. S., Taieb, F. E., Lewellyn, A. L., Qian, Y. W. and Maller, J. L. (2000). The critical role of the MAP kinase pathway in meiosis II in Xenopus oocytes is mediated by p90(Rsk). Curr. Biol. 10, 430-438.[Medline]
Haccard, O., Jessus, C., Rime, H., Goris, J., Merlevede, W. and Ozon, R. (1993). Mitogen-activated protein kinase (MAP kinase) activation in Xenopus oocytes: roles of MPF and protein synthesis. Mol. Reprod. Dev. 36, 196-105.
Heasman, J., Holwill, S. and Wylie, C. C. (1991). Fertilization of cultured Xenopus oocytes and use in studies of maternally inherited molecules. Methods Cell Biol. 36, 213-230.[Medline]
Hirai, T., Yamashita, M., Yoshikuni, M., Lou, Y. H. and Nagahama, Y. (1992). Cyclin B in fish oocytes: its cDNA and amino acid sequences, appearance during maturation, and induction of p34cdc2 activation. Mol. Reprod. Dev. 33, 131-140.[Medline]
Hoffmann, I., Clarke, P. R., Marcote, M. J., Karsenti, E. and Draetta, G. (1993). Phosphorylation and activation of human cdc25-C by cdc2cyclin B and its involvement in the self-amplification of MPF at mitosis. EMBO J. 12, 53-63.[Medline]
Hsu, J. Y., Sun, Z. W., Li, X., Reuben, M., Tatchell, K., Bishop, D. K., Grushcow, J. M., Brame, C. J., Caldwell, J. A., Hunt, D. F. et al. (2000). Mitotic phosphorylation of histone H3 is governed by Ipl1/aurora kinase and Glc7/PP1 phosphatase in budding yeast and nematodes. Cell 102, 279-291.[Medline]
Huang, W., Kessler, D. S. and Erikson, R. L. (1995). Biochemical and biological analysis of Mek1 phosphorylation site mutants. Mol. Biol. Cell 6, 237-245.[Abstract]
Huchon, D., Rime, H., Jessus, C. and Ozon, R. (1993). Control of metaphase I formation in Xenopus oocyte: effects of an indestructible cyclin B and of protein synthesis. Biol. Cell 77, 133-141.[Medline]
Iwabuchi, M., Ohsumi, K., Yamamoto, T. M., Sawada, W. and Kishimoto, T. (2000). Residual cdc2 activity remaining at meiosis I exit is essential for meiotic M-M transition in Xenopus oocyte extracts. EMBO J. 19, 4513-4523.[Medline]
Jacobs, H. W., Knoblich, J. A. and Lehner, C. F. (1998). Drosophila Cyclin B3 is required for female fertility and is dispensable for mitosis like Cyclin B. Genes Dev. 12, 3741-3751.
Kanki, J. P. and Donoghue, D. J. (1991). Progression from meiosis I to meiosis II in Xenopus oocytes requires de novo translation of the mosxe protooncogene. Proc. Natl. Acad. Sci. USA 88, 5794-5798.
Karaiskou, A., Cayla, X., Haccard, O., Jessus, C. and Ozon, R. (1998). MPF amplification in Xenopus oocyte extracts depends on a two-step activation of cdc25 phosphatase. Exp. Cell Res. 244, 491-500.[Medline]
King, R. W., Peters, J. M., Tugendreich, S., Rolfe, M., Hieter, P. and Kirschner, M. W. (1995). A 20S complex containing CDC27 and CDC16 catalyzes the mitosis-specific conjugation of ubiquitin to cyclin B. Cell 81, 279-288.[Medline]
Kobayashi, H., Minshull, J., Ford, C., Golsteyn, R., Poon, R. and Hunt, T. (1991). On the synthesis and destruction of A- and B-type cyclins during oogenesis and meiotic maturation in Xenopus laevis. J. Cell Biol. 114, 755-765.
Kobayashi, H., Stewart, E., Poon, R. Y. and Hunt, T. (1994). Cyclin A and cyclin B dissociate from p34cdc2 with half-times of 4 and 15 h, respectively, regardless of the phase of the cell cycle. J. Biol. Chem. 269, 29153-29160.
Kreutzer, M. A., Richards, J. P., De Silva-Udawatta, M. N., Temenak, J. J., Knoblich, J. A., Lehner, C. F. and Bennett, K. L. (1995). Caenorhabditis elegans cyclin A- and B-type genes: a cyclin A multigene family, an ancestral cyclin B3 and differential germline expression. J. Cell Sci. 108, 2415-2424.[Abstract]
Kumagai, A. and Dunphy, W. G. (1991). The cdc25 protein controls tyrosine dephosphorylation of the cdc2 protein in a cell-free system. Cell 64, 903-914.[Medline]
Labbé, J. C., Capony, J. P., Caput, D., Cavadore, J. C., Derancourt, J., Kaghad, M., Lelias, J. M., Picard, A. and Dorée, M. (1989). MPF from starfish oocytes at first meiotic metaphase is a heterodimer containing one molecule of cdc2 and one molecule of cyclin B. EMBO J. 8, 3053-3058.[Medline]
Lenormand, J. L., Dellinger, R. W., Knudsen, K. E., Subramani, S. and Donoghue, D. J. (1999). Speedy: a novel cell cycle regulator of the G2/M transition. EMBO J. 18, 1869-1877.[Medline]
Luca, F. C., Shibuya, E. K., Dohrmann, C. E. and Ruderman, J. V. (1991). Both cyclin A delta 60 and B delta 97 are stable and arrest cells in M- phase, but only cyclin B delta 97 turns on cyclin destruction. EMBO J. 10, 4311-4320.[Medline]
Masui, Y. and Markert, C. L. (1971). Cytoplasmic control of nuclear behavior during meiotic maturation of frog oocytes. J. Exp. Zool. 177, 129-145.[Medline]
Milner, N., Mir, K. U. and Southern, E. M. (1997). Selecting effective antisense reagents on combinatorial oligonucleotide arrays. Nat. Biotechnol. 15, 537-541.[Medline]
Minshull, J. and Hunt, T. (1992). Antisense ablation of mRNA in frog and rabbit cell-free systems. In Antisense RNA and DNA (ed. J. A. H. Murray), pp. 195-212. New York: Wiley-Liss.
Minshull, J., Murray, A., Colman, A. and Hunt, T. (1991). Xenopus oocyte maturation does not require new cyclin synthesis. J. Cell Biol. 114, 767-772.
Minshull, J., Sun, H., Tonks, N. K. and Murray, A. W. (1994). A MAP kinase-dependent spindle assembly checkpoint in Xenopus egg extracts. Cell 79, 475-486.[Medline]
Mueller, P. R., Coleman, T. R., Kumagai, A. and Dunphy, W. G. (1995). Myt1: a membrane-associated inhibitory kinase that phosphorylates Cdc2 on both threonine-14 and tyrosine-15. Science 270, 86-90.
Murakami, M. S. and Vande Woude, G. F. (1997). Mechanisms of Xenopus oocyte maturation. Methods Enzymol. 283, 584-600.[Medline]
Murakami, M. S. and Vande Woude, G. F. (1998). Analysis of the early embryonic cell cycles of Xenopus; regulation of cell cycle length by Xe-wee1 and Mos. Development 125, 237-248.[Abstract]
Murray, A. W. (1991). Cell Cycle Extracts. In Xenopus laevis: Practical Uses in Cell and Molecular Biology. Vol. 36 (ed. B. K. Kay and H. B. Peng), pp. 573-597. San Diego: Academic Press.
Murray, A. W., Solomon, M. J. and Kirschner, M. W. (1989). The role of cyclin synthesis and degradation in the control of maturation promoting factor activity. Nature 339, 280-286.[Medline]
Nakajo, N., Yoshitome, S., Iwashita, J., Iida, M., Uto, K., Ueno, S., Okamoto, K. and Sagata, N. (2000). Absence of Wee1 ensures the meiotic cell cycle in Xenopus oocytes. Genes Dev. 14, 328-338.
Nebreda, A. R. and Ferby, I. (2000). Regulation of the meiotic cell cycle in oocytes. Curr. Opin. Cell Biol. 12, 666-675.[Medline]
Nebreda, A. R. and Hunt, T. (1993). The c-mos proto-oncogene protein kinase turns on and maintains the activity of MAP kinase, but not MPF, in cell-free extracts of Xenopus oocytes and eggs. EMBO J. 12, 1979-1986.[Medline]
Nebreda, A. R., Gannon, J. V. and Hunt, T. (1995). Newly synthesized protein(s) must associate with p34cdc2 to activate MAP kinase and MPF during progesterone-induced maturation of Xenopus oocytes. EMBO J. 14, 5597-5607.[Medline]
Nebreda, A. R., Hill, C., Gomez, N., Cohen, P. and Hunt, T. (1993b). The protein kinase mos activates MAP kinase kinase in vitro and stimulates the MAP kinase pathway in mammalian somatic cells in vivo. FEBS Lett. 333, 183-187.[Medline]
Nishijima, H., Nishitani, H., Seki, T. and Nishimoto, T. (1997). A dual-specificity phosphatase Cdc25B is an unstable protein and triggers p34(cdc2)/cyclin B activation in hamster BHK21 cells arrested with hydroxyurea. J. Cell Biol. 138, 1105-1116.
Nishizawa, M., Okazaki, K., Furuno, N., Watanabe, N. and Sagata, N. (1992). The second-codon rule and autophosphorylation govern the stability and activity of Mos during the meiotic cell cycle in Xenopus oocytes. EMBO J. 11, 2433-2446.[Medline]
Ohsumi, K., Sawada, W. and Kishimoto, T. (1994). Meiosis-specific cell cycle regulation in maturing Xenopus oocytes. J. Cell Sci. 107, 3005-3013.[Abstract]
Peter, M., Castro, A., Lorca, T., Le Peuch, C., Magnaghi-Jaulin, L., Dorée, M. and Labbé, J. C. (2001). The APC is dispensable for the first meiotic anaphase in Xenopus oocytes. Nat. Cell Biol. 3, 83-87.[Medline]
Posada, J., Yew, N., Ahn, N. G., Vande Woude, G. F. and Cooper, J. A. (1993). Mos stimulates MAP kinase in Xenopus oocytes and activates a MAP kinase kinase in vitro. Mol. Cell Biol. 13, 2546-2553.
Roy, L. M., Swenson, K. I., Walker, D. H., Gabrielli, B. G., Li, R. S., Piwnica-Worms, H. and Maller, J. L. (1991). Activation of p34cdc2 kinase by cyclin A. J. Cell Biol. 113, 507-514.
Roy, L. M., Haccard, O., Izumi, T., Lattes, B. G., Lewellyn, A. L. and Maller, J. L. (1996). Mos proto-oncogene function during oocyte maturation in Xenopus. Oncogene 12, 2203-2211.[Medline]
Sagata, N., Oskarsson, M., Copeland, T., Brumbaugh, J. and Vande Woude, G. F. (1988). Function of c-mos proto-oncogene product in meiotic maturation in Xenopus oocytes. Nature 335, 519-525.[Medline]
Sagata, N., Daar, I., Oskarsson, M., Showalter, S. D. and Vande Woude, G. F. (1989a). The product of the mos proto-oncogene as a candidate "initiator" for oocyte maturation. Science 245, 643-646.
Sagata, N., Watanabe, N., Vande Woude, G. F. and Ikawa, Y. (1989b). The c-mos proto-oncogene product is a cytostatic factor responsible for meiotic arrest in vertebrate eggs. Nature 342, 512-518.[Medline]
Sagata, N. (1997). What does Mos do in oocytes and somatic cells? BioEssays 19, 13-21.[Medline]
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Sheets, M. D., Wu, M. and Wickens, M. (1995). Polyadenylation of c-mos mRNA as a control point in Xenopus meiotic maturation. Nature 374, 511-516.[Medline]
Shibuya, E. K. and Ruderman, J. V. (1993). Mos induces the in vitro activation of mitogen-activated protein kinases in lysates of frog oocytes and mammalian somatic cells. Mol. Biol. Cell 4, 781-790.[Abstract]
Sigrist, S., Jacobs, H., Stratmann, R. and Lehner, C. F. (1995). Exit from mitosis is regulated by Drosophila fizzy and the sequential destruction of cyclins A, B and B3. EMBO J. 14, 4827-4838.[Medline]
Sohail, M., Hochegger, H., Klotzbücher, A., Le Guellec, R., Hunt, T. and Southern, E. M. (2001). Antisense oligonucleotides selected by hybridisation to scanning arrays are effective reagents in vivo. Nucleic Acids Res. 29, 2041-2051.
Solomon, M. J., Glotzer, M., Lee, T. H., Philippe, M. and Kirschner, M. W. (1990). Cyclin activation of p34cdc2. Cell 63, 1013-1024.[Medline]
Southern, E. M., Case-Green, S. C., Elder, J. K., Johnson, M., Mir, K. U., Wang, L. and Williams, J. C. (1994). Arrays of complementary oligonucleotides for analysing the hybridisation behaviour of nucleic acids. Nucleic Acids Res. 22, 1368-1373.
Speliotes, E. K., Uren, A., Vaux, D. and Horvitz, H. R. (2000). The survivin-like C. elegans BIR-1 protein acts with the Aurora-like kinase AIR-2 to affect chromosomes and the spindle midzone. Mol. Cell. 6, 211-223.[Medline]
Strausfeld, U. P., Howell, M., Rempel, R., Maller, J. L., Hunt, T. and Blow, J. J. (1994). Cip1 blocks the initiation of DNA replication in Xenopus extracts by inhibition of cyclin-dependent kinases. Curr. Biol. 4, 876-883.[Medline]
Sudakin, V., Ganoth, D., Dahan, A., Heller, H., Hershko, J., Luca, F. C., Ruderman, J. V. and Hershko, A. (1995). The cyclosome, a large complex containing cyclin-selective ubiquitin ligase activity, targets cyclins for destruction at the end of mitosis. Mol. Biol Cell. 6, 185-197.[Abstract]
Taieb, F. E., Gross, S. D., Lewellyn, A. L. and Maller, J. L. (2001). Activation of the anaphase-promoting complex and degradation of cyclin B is not required for progression from Meiosis I to II in Xenopus oocytes. Curr. Biol. 11, 508-513.[Medline]
Thibier, C., De Smedt, V., Poulhe, R., Huchon, D., Jessus, C. and Ozon, R. (1997). In vivo regulation of cytostatic activity in Xenopus metaphase II- arrested oocytes. Dev. Biol. 185, 55-66.[Medline]
Tinsley, R. C. and Kobel, H. R., eds (1996). The Biology of Xenopus. Oxford: The Zoological Society of London/Clarendon Press.
Vorlaufer, E. and Peters, J. M. (1998). Regulation of the cyclin B degradation system by an inhibitor of mitotic proteolysis. Mol. Biol. Cell 9, 1817-1831.
Wagenaar, E. B. (1983). The timing of synthesis of proteins required for mitosis in the cell cycle of the sea urchin embryo. Exp. Cell Res. 144, 393-403.[Medline]
Wasserman, W. J. and Masui, Y. (1975). Effects of cycloheximide on a cytoplasmic factor initiating meiotic maturation in Xenopus oocytes. Exp. Cell Res. 91, 381-388.[Medline]
Weeks, D. L., Walder, J. A. and Dagle, J. M. (1991). Cyclin B mRNA depletion only transiently inhibits the Xenopus embryonic cell cycle. Development 111, 1173-1178.
Woods, A., Sherwin, T., Sasse, R., MacRae, T. H., Baines, A. J. and Gull, K. (1989). Definition of individual components within the cytoskeleton of Trypanosoma brucei by a library of monoclonal antibodies. J. Cell Sci. 93, 491-500.
Yew, N., Mellini, M. L. and Vande Woude, G. F. (1992). Meiotic initiation by the mos protein in Xenopus. Nature 355, 649-652.[Medline]
Yoshida, N., Mita, K. and Yamashita, M. (2000). Comparative study of the molecular mechanisms of oocyte maturation in amphibians. Comp. Biochem. Physiol. B. Biochem Mol. Biol. 126, 189-197.[Medline]
Zachariae, W. and Nasmyth, K. (1999). Whose end is destruction: cell division and the anaphase-promoting complex. Genes Dev. 13, 2039-2058.
This article has been cited by other articles:
![]() |
N. Riehs, S. Akimcheva, J. Puizina, P. Bulankova, R. A. Idol, J. Siroky, A. Schleiffer, D. Schweizer, D. E. Shippen, and K. Riha Arabidopsis SMG7 protein is required for exit from meiosis J. Cell Sci., July 1, 2008; 121(13): 2208 - 2216. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ueno, N. Nakajo, M. Watanabe, M. Isoda, and N. Sagata FoxM1-driven cell division is required for neuronal differentiation in early Xenopus embryos Development, June 1, 2008; 135(11): 2023 - 2030. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-G. Liang, Y.-Q. Su, H.-Y. Fan, H. Schatten, and Q.-Y. Sun Mechanisms Regulating Oocyte Meiotic Resumption: Roles of Mitogen-Activated Protein Kinase Mol. Endocrinol., September 1, 2007; 21(9): 2037 - 2055. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Dehennaut, T. Lefebvre, C. Sellier, Y. Leroy, B. Gross, S. Walker, R. Cacan, J.-C. Michalski, J.-P. Vilain, and J.-F. Bodart O-Linked N-Acetylglucosaminyltransferase Inhibition Prevents G2/M Transition in Xenopus laevis Oocytes J. Biol. Chem., April 27, 2007; 282(17): 12527 - 12536. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Miller, M. K. Summers, D. V. Hansen, M. V. Nachury, N. L. Lehman, A. Loktev, and P. K. Jackson Emi1 stably binds and inhibits the anaphase-promoting complex/cyclosome as a pseudosubstrate inhibitor Genes & Dev., September 1, 2006; 20(17): 2410 - 2420. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Goetz, D. D. Brown, and F. L. Conlon TBX5 is required for embryonic cardiac cell cycle progression Development, July 1, 2006; 133(13): 2575 - 2584. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Maton, T. Lorca, J.-A. Girault, R. Ozon, and C. Jessus Differential regulation of Cdc2 and Aurora-A in Xenopus oocytes: a crucial role of phosphatase 2A J. Cell Sci., June 1, 2005; 118(11): 2485 - 2494. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Casaletto, L. K. Nutt, Q. Wu, J. D. Moore, L. D. Etkin, P. K. Jackson, T. Hunt, and S. Kornbluth Inhibition of the anaphase-promoting complex by the Xnf7 ubiquitin ligase J. Cell Biol., April 11, 2005; 169(1): 61 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pascreau, J.-G. Delcros, J.-Y. Cremet, C. Prigent, and Y. Arlot-Bonnemains Phosphorylation of Maskin by Aurora-A Participates in the Control of Sequential Protein Synthesis during Xenopus laevis Oocyte Maturation J. Biol. Chem., April 8, 2005; 280(14): 13415 - 13423. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Tung, D. V. Hansen, K. H. Ban, A. V. Loktev, M. K. Summers, J. R. Adler III, and P. K. Jackson A role for the anaphase-promoting complex inhibitor Emi2/XErp1, a homolog of early mitotic inhibitor 1, in cytostatic factor arrest of Xenopus eggs PNAS, March 22, 2005; 102(12): 4318 - 4323. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, J.-L. Magnard, S. McCormick, and M. Yang Progression through Meiosis I and Meiosis II in Arabidopsis Anthers Is Regulated by an A-Type Cyclin Predominately Expressed in Prophase I Plant Physiology, December 1, 2004; 136(4): 4127 - 4135. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Basu, A.K. Navneet, S. Dasgupta, and S. Bhattacharya Cdc2-Cyclin B-Induced G2 to M Transition in Perch Oocyte Is Dependent on Cdc25 Biol Reprod, September 1, 2004; 71(3): 894 - 900. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Charlesworth, L. L. Cox, and A. M. MacNicol Cytoplasmic Polyadenylation Element (CPE)- and CPE-binding Protein (CPEB)-independent Mechanisms Regulate Early Class Maternal mRNA Translational Activation in Xenopus Oocytes J. Biol. Chem., April 23, 2004; 279(17): 17650 - 17659. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Sun and K. Machaca Ca2+cyt negatively regulates the initiation of oocyte maturation J. Cell Biol., April 12, 2004; 165(1): 63 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Karaiskou, A.-C. Lepretre, G. Pahlavan, D. Du Pasquier, R. Ozon, and C. Jessus Polo-like kinase confers MPF autoamplification competence to growing Xenopus oocytes Development, April 1, 2004; 131(7): 1543 - 1552. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ito, M. Shimada, and T. Terada Mitogen-Activated Protein Kinase Kinase Inhibitor Suppresses Cyclin B1 Synthesis and Reactivation of p34cdc2 Kinase, Which Improves Pronuclear Formation Rate in Matured Porcine Oocytes Activated by Ca2+ Ionophore Biol Reprod, March 1, 2004; 70(3): 797 - 804. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kuroda, K. Naito, K. Sugiura, M. Yamashita, I. Takakura, and H. Tojo Analysis of the Roles of Cyclin B1 and Cyclin B2 in Porcine Oocyte Maturation by Inhibiting Synthesis with Antisense RNA Injection Biol Reprod, January 1, 2004; 70(1): 154 - 159. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Baert, J.-F. Bodart, B. Bocquet-Muchembled, A. Lescuyer-Rousseau, and J.-P. Vilain Xp42Mpk1 Activation Is Not Required for Germinal Vescicle Breakdown but for Raf Complete Phosphorylation in Insulin-stimulated Xenopus Oocytes J. Biol. Chem., December 12, 2003; 278(50): 49714 - 49720. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Maton, C. Thibier, A. Castro, T. Lorca, C. Prigent, and C. Jessus Cdc2-Cyclin B Triggers H3 Kinase Activation of Aurora-A in Xenopus Oocytes J. Biol. Chem., June 6, 2003; 278(24): 21439 - 21449. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yoshitome, N. Furuno, E. Hashimoto, and N. Sagata The C-Terminal Seven Amino Acids in the Cytoplasmic Retention Signal Region of Cyclin B2 are Required for Normal Bipolar Spindle Formation in Xenopus Oocytes and Embryos Mol. Cancer Res., June 1, 2003; 1(8): 589 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Goda, T. Ishii, N. Nakajo, N. Sagata, and H. Kobayashi The RRASK Motif in Xenopus Cyclin B2 Is Required for the Substrate Recognition of Cdc25C by the Cyclin B-Cdc2 Complex J. Biol. Chem., May 23, 2003; 278(21): 19032 - 19037. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Littlepage and J. V. Ruderman Identification of a new APC/C recognition domain, the A box, which is required for the Cdh1-dependent destruction of the kinase Aurora-A during mitotic exit Genes & Dev., September 1, 2002; 16(17): 2274 - 2285. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Zheng, T. Furukawa, T. Ogura, K. Tajimi, and N. Inagaki M Phase-specific Expression and Phosphorylation-dependent Ubiquitination of the ClC-2 Channel J. Biol. Chem., August 23, 2002; 277(35): 32268 - 32273. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. De Smedt, R. Poulhe, X. Cayla, F. Dessauge, A. Karaiskou, C. Jessus, and R. Ozon Thr-161 Phosphorylation of Monomeric Cdc2. REGULATION BY PROTEIN PHOSPHATASE 2C IN XENOPUS OOCYTES J. Biol. Chem., August 2, 2002; 277(32): 28592 - 28600. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Peter, J.-C. Labbe, M. Doree, and E. Mandart A new role for Mos in Xenopus oocyte maturation: targeting Myt1 independently of MAPK Development, January 5, 2002; 129(9): 2129 - 2139. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||