spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van de Water, S.
Right arrow Articles by Zivkovic, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van de Water, S.
Right arrow Articles by Zivkovic, D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 128, 3877-3888 (2001)
© 2001 The Company of Biologists Limited

Ectopic Wnt signal determines the eyeless phenotype of zebrafish masterblind mutant

Sandra van de Water1, Marc van de Wetering2, Jos Joore1,{ddagger}, John Esseling1,§, Robert Bink, Hans Clevers2 and Danica Zivkovic1,*

1 Hubrecht Laboratory, Netherlands Institute for Developmental Biology, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands
2 Department of Immunology, University Hospital, PO Box 85500, 3508 GA Utrecht, The Netherlands
{ddagger} Present address: Westburg b.v., PO Box 214, 3830 AE Leusden, The Netherlands
§ Present address: Laboratory of Plant Cell Biology, Arboretumlaan 4, 6703 BD Wageningen, The Netherlands

*Author for correspondence: dana{at}niob.knaw.nl

Accepted July 25, 2001


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
masterblind (mbl) is a zebrafish mutation characterised by the absence or reduction in size of the telencephalon, optic vesicles and olfactory placodes. We show that inhibition of Gsk3ß in zebrafish embryos either by overexpression of dominant negative dn gsk3ß mRNA or by lithium treatment after the midblastula transition phenocopies mbl. The loss of anterior neural tissue in mbl and lithium-treated embryos is preceded by posteriorization of presumptive anterior neuroectoderm during gastrulation, which is evident from the anterior shift of marker genes Otx2 and Wnt1. Heterozygous mbl embryos showed increased sensitivity to inhibition of GSK3ß by lithium or dn Xgsk3ß that led to the loss of eyes. Overexpression of gsk3ß mRNA rescued eyes and the wild-type fgf8 expression of homozygous mbl embryos. emx1 that delineates the telencephalon is expanded and shifted ventroanteriorly in mbl embryos. In contrast to fgf8, the emx1 expression domain was not restored upon overexpression of gsk3ß mRNA. These experiments place mbl as an antagonist of the Wnt pathway in parallel or upstream of the complex consisting of Axin, APC and Gsk3ß that binds and phosphorylates ß-catenin, thereby destabilising it. mbl maps on LG 3 close to a candidate gene axin1. In mbl we detected a point mutation in the conserved minimal Gsk3ß-binding domain of axin1 leading to a leucine to glutamine substitution at position 399. Overexpression of wild-type axin1 mRNA rescued mbl completely, demonstrating that mutant axin1 is responsible for the mutant phenotype. Overexpression of mutant L399Q axin1 in wild-type embryos resulted in a dose-dependent dominant negative activity as demonstrated by the loss of telencephalon and eyes. We suggest that the function of Axin1/Mbl protein is to antagonise the Wnt signal and in doing so to establish and maintain the most anterior CNS. Our findings provide new insights into the mechanisms by which the Wnt pathway generates anteroposterior polarity of the neural plate.

Key words: masterblind, zebrafish, Wnt, GSK3ß, lithium


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The primordium of the vertebrate central nervous system (CNS) acquires its anteroposterior (AP) polarity early during gastrulation (Houart et al., 1998). Studies in amphibian embryos have led to a two-signal model of AP patterning of the neural plate (Nieuwkoop et al., 1952). This model proposes that the first, activating signal, induces the neural tissue of the anterior character, the primordium of the forebrain. The second, transforming signal, imposes progressively more posterior fates onto the anterior neural tissue to generate the hindbrain and spinal cord. According to a recently proposed two-inhibitor model the anterior neural tissue is generated when Wnts and BMPs are simultaneously inhibited by Wnt and BMP antagonists (Niehrs, 1999) that are released by tissues such as anterior endoderm in the mouse (Beddington and Robertson, 1998), the prechordal plate in Xenopus (Glinka et al., 1998; Kazanskaya et al., 2000) or the yolk syncitial layer (ysl) and the prechordal plate of the zebrafish (Hashimoto et al., 2000). The idea is that the expression of Wnt inhibitors by axial mesoderm gradually decreases to the posterior, whereas expression of Wnts increases resulting in posteriorization of the neural tissue. Ectopic activation of the Wnt pathway during gastrulation inhibits formation of the head (Hoppler et al., 1996; Kim et al., 2000). Misexpression of Wnts in amphibia and fish after the MBT, leads to posteriorization of the CNS and may result in loss of the forebrain (Christian and Moon, 1993; Kelly et al., 1995; Fekany-Lee et al., 2000). In contrast, secreted Wnt antagonists such as Frzb (Leyns et al., 1997), Dkk1 (Glinka et al., 1998) and Wif1 (Hsieh et al., 1999) are capable of inducing secondary heads albeit in co-operation with BMP antagonists (Piccolo et al., 1999; Sirotkin et al., 2000).

The AP patterning of the neural plate also appears to be tightly regulated by basal activity of Wnt pathway components that act to destabilise ß-catenin. In the absence of Wnt signal, glycogen synthase kinase-3ß (Gsk3ß), Axin, the adenomatous poliposis coli (APC) protein and phosphoprotein phosphatase 2A (PP2A) form a complex that binds and phosphorylates ß-catenin thereby stimulating its degradation by the ubiquitin-proteosome system (Aberle et al., 1997; Ikeda et al., 1998; Bienz and Clevers, 2000). In the presence of Wnts that trigger the canonical pathway, inhibition of Gsk3ß activity allows the cytoplasmic accumulation of stabilised ß-catenin. This unphosphorylated ß-catenin then translocates into the nucleus where it modulates target gene transcription by interacting with members of the TCF/LEF1 family of transcription factors (Behrens et al., 1996; Molenaar et al., 1996).

In model organisms as well as in mammalian cells in culture, Gsk3ß plays a key role in cell fate decisions by negatively regulating ß-catenin (Welsh et al., 1996; Larabell et al., 1997). Lithium has been shown to inhibit Gsk3ß, thereby mimicking Wnt signalling (Klein and Melton, 1996; Stambolic et al., 1996; Hedgepeth et al., 1997). Indeed, treatment of frog and fish embryos with lithium after the mid blastula transition (MBT) leads to posteriorization of the CNS that is strikingly similar to that induced by ectopic expression of Wnts (Yamaguchi and Shinagawa, 1989; Fredieu et al., 1997; Kelly et al., 1995). Consistent with the role of Wnt antagonist in anteriorization of the neural plate is targeted overexpression of gsk3ß mRNA in Xenopus embryos that induces ectopic neural tissue of anterior character (Itoh et al., 1995; Pierce and Kimelman, 1996). Another negative regulator of the Wnt pathway is Axin that promotes Gsk3ß-dependent phosphorylation of ß-catenin thereby stimulating its degradation. Mutations in axin, such as those encoded by the fused locus in mouse and loss of function of Drosophila axin, phenocopy overexpression of Wnt/wg (Zeng et al., 1997; Hamada et al., 1999). The phenotype of fused homozygous mutants is characterised by axial duplications that are reminiscent of induction of the secondary axes in frogs by ectopic overexpression of Wnts (McMahon and Moon, 1989). Indeed, in the Xenopus axis-induction assay, axin inhibits induction of a secondary axis by negatively regulating Wnts (Zeng et al., 1997; Fukui et al., 2000). fused mutants also have neuroectodermal abnormalities which supports a role of axin in AP patterning of the CNS (Perry et al., 1995). Recently, genetic evidence has been presented to show that components of the Wnt pathway downstream of axin play a role in head induction. Severe head defects in the zebrafish headless (hdl) mutant are due to a loss of function of tcf3 (Pelegri et al., 1998) that represses Wnt target genes (Kim et al., 2000).

masterblind (mbl) is a zebrafish recessive zygotic mutation from the Tübingen screen (Haffter et al., 1996). mbl is characterised by the absence or reduction in size of the telencephalon complemented by the anteriorward expansion of the epiphysis (Heisenberg et al., 1996; Masai et al., 1997). The phenotype of mbl suggests that the locus is required for normal development of the eyes and the telencephalon, the same structures that are negatively affected by ectopic Wnt signalling.

We present evidence that the function of mbl in normal development is to antagonise Wnt signalling and in doing so to establish and maintain the most anterior CNS. At the molecular and cellular levels, the posteriorised phenotype of mbl phenocopies the inhibition of Gsk3ß in zebrafish embryos. By manipulating in embryos the dose of Gsk3ß we show that the mbl mutant phenotype arises as a consequence of ectopic Wnt signalling. The defects in mbl were rescued by overexpression of gsk3ß or axin1 mRNA implicating that an ectopic Wnt signal underlies its phenotype. We detected in mbl mutants a point mutation in the minimal gsk3ß binding domain of axin1 (Heisenberg et al., 2001) that when injected into wild-type embryos had a weak dominant negative activity. Our findings provide new insights into the mechanisms that generate AP polarity of the neural plate and extend evidence for the crucial role of Wnt-pathway components such as mbl/axin therein.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Fish lines
Zebrafish were maintained as described by Westerfield (Westerfield, 1995). Embryos were obtained by natural matings. Hubrecht Laboratory (HLwt) and Tübingen (Tüwt) wild-type fish strains were used for lithium experiments. mbl is a recessive lethal zygotic mutant (Heisenberg et al., 1996).

mbl (tm13) heterozygous fish were generated from mbl outcrosses in Tüwt background (a kind gift from Pascal Haffter, Tübingen) and subsequently in HLwt background.

Lithium treatments
Lithium (0.3 M LiCl) treatments were carried out on a shaking platform at 27°C in egg water (Westerfield, 1995) on sphere stage embryos (4hpf) (post-MBT treatment or lithium treatment). Treated embryos were subsequently washed 3 times in egg water and used in different experiments.

"Head" measurements (µm) of lithium-treated and wild-type embryos were carried out using an ocular micrometer in a dissecting microscope. Rostrocaudal distance was determined from the most anterior part of the head to the otic vesicles while dorsoventral distance was determined from the dorsal aspect of the yolk to the top of the head at the mid-hindbrain boundary.

Microinjection of synthetic mRNAs
One or 0.5 nl with identical end concentration of mRNA in water was injected into one or two-cell stage embryos with needles of approx. 5 µm diameter using a pneumatic picopump microinjector (WPI). Capped synthetic mRNAs were prepared using the SP6 mMessage mMachine kit (Ambion). The following constructs were used to prepare RNA for injection: full length (fl Xgsk3ß), dominant negative (dn Xgsk3ß), and frame shift Xenopus gsk3ß (fs Xgsk3ß) in pCS2+ linearized with NotI (kind gift from Dr Kimelman) (Pierce and Kimelman, 1995); zebrafish gsk3ß linearized with NotI and zebrafish axin1 linearized with AscI (kind gift from Dr Hirano). In controls, equivalent quantities of GFP mRNA were injected and its expression assessed in living embryos.

DNA microinjection
Supercoiled plasmid DNA (1.4 nl of 40 µg/ml) for full length (fl Xgsk3ß) or dominant negative (dn Xgsk3ß) driven by the CMV promoter (kind gift from Dr Kimelman) (Pierce and Kimelman, 1995) was injected as previously described (Joore et al., 1996).

Whole-mount in situ hybridisation
Whole-mount in situ hybridisations were carried out as previously described (Joore et al., 1994).

Antisense DIG (Boehringer) labelled riboprobes were synthesised as described elsewhere: otx2 (Li et al., 1994), shh (Krauss et al., 1993), Krox20 (also known as egr2) (Oxtoby and Jowett, 1993), fgf8 (Reifers et al., 1998), emx1 (Morita et al., 1995), flh (Talbot et al., 1995), pax6 (Krauss et al., 1991), wnt1 (Molven et al., 1991).

Embryo genotyping
To verify whether microinjections of mRNAs for gsk3ß or axin1 rescued the mbl phenotype we genotyped injected and control embryos. In PCRs we tested primer pairs for markers that are closely linked to the mbl locus, z15747, z24851 and z25683 on LG 3 (G.-J. Rauch and R. Geisler, pers. comm.). DNA samples of individual embryos were used for genotyping. Each 20 µl reaction contained 5 µl template DNA. The marker that showed the highest linkage to mbl was z24851 on 60.3 cM (purchased from MWG AG Biotech) (http://zebrafish.mgh.harvard.edu/cgi-bin/ssr_map/view_lg.cgi and http://wwwmap.tuebingen.mpg.de) and Fig.6.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 6. (A) Position of axin1/mbl is at 62.8 cM on zebrafish LG 3 (59.7-83.2 cM) with respect to the position of marker z24851 that was used for genotyping. The LG 3 map was integrated from information available at http:/wwwmap.tuebingen.mpg.de and http:/zebrafish.mgh.harvard.edu/cgi_bin/ssr_map/view_lg.cgi. Left: scale in cM; right: scale in cR. (B) Point mutation A to T transversion in axin1 of mbl. (C) Wild-type uninjected embryo at ca 30 hpf and (D) embryo injected with 150 pg of mutant L399Q axin1 mRNA, which induced loss of telencephalon and laterally positioned eyes in 25% of 30 hpf embryos. (E,F) Whole-mount in situ hybridisation with axin1 riboprobe in 24 hpf embryos showing strong expression in the midbrain, ventral midhindbrain and ventral hindbrain, and a low signal in telencephalon, dorsal midbrain and midhindbrain boundary. The abnormal brain of mbl embryos (F) still shows expression of axin1 mRNA (arrows) comparable to that of the wild-type embryo (E).

 
Sequencing and axin1/mbl constructs
To identify the mutation in axin1 causing the mbl phenotype, mRNAs isolated from mbl and wild-type embryos originating from two wild-type fish strains were used as templates in RT-PCR reactions. The following primers were used:

bp 6-734: gacagagtgcagggacactatgagc and aagactttgccgttgcctgacaccg

bp 498-1248: cgtatcccggcagatcaaacccg and cgcctctcgttccctcaacaccc

bp 947-1816: acgtgaactctggctacgcgctggc and tggtgttgggaccgacgctcattcc

bp 1511-2076: gccattctccgaagtcccgctcg and ccccagacgctccaccgaactgg

bp 1842-2645: ggcagcacgctatccaagcgaccg and tggctctccagcacgtccacgttcg

PCR reactions were performed using Amplitaq Gold (Perkin Elmer). Conditions were: 20 seconds 94°C, 20 seconds 67°C and 30 seconds 72°C.

PCR fragments were subsequently subcloned into pGEMT and sequenced in the presence of 1.3 M Betaine and 1.3% DMSO. The mutation found in mbl was confirmed by direct sequencing of the PCR product.

To make an mbl expression construct from which we made L399Q mutant axin1 mRNA, a NsiI-NarI fragment from wild-type axin1 was replaced by a NsiI-NarI fragment from mbl containing the mutation.


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Lithium-mediated activation of the Wnt pathway induces posteriorization and concomitant loss of anterior brain
Lithium ions activate the Wnt pathway through inhibition of Gsk3ß activity (Klein and Melton, 1996; Stambolic et al., 1996; Hedgepeth et al., 1997). When applied after MBT to zebrafish or Xenopus embryos lithium induces deletion of archaencephalic brain with the eyes being the most sensitive to its action (Stachel et al., 1993; Yamaguchi and Shinagawa, 1989; Fredieu et al., 1997).

To determine the sensitivity period for eye loss, embryos were exposed to lithium at different times after MBT. The most sensitive interval was from late blastula to early gastrulation, 4 to 6 hpf, when lithium induced loss of eyes or small eyes in almost 100% of embryos. During 7 to 8 hpf, susceptibility to lithium declined and progressively more embryos with small and wild-type eyes were observed (data not shown) (Stachel et al., 1993; Yamaguchi and Shinagawa, 1989).

The loss of anterior brain could be predicted at the tailbud stage by aberrant expression of neural plate regional marker genes. wnt1, a marker for the presumptive mid/hindbrain boundary, was expanded anteriorly in the apparently narrowed neural plate (Fig. 1A,B), while the expression of the midline marker shh was weaker in the anterior neural plate (Fig. 1C). Interestingly, the modification of wnt1 expression in treated embryos was suggestive of abnormal convergent extension (CE) movements in the anterior neural plate (Fig. 1B). At 24 hpf the mild lithium phenotype was characterised by the loss of brain rostral to the D2/3 diencephalic boundary including the eyes, as revealed by loss of eye-specific pax6 expression (Fig. 1D,E) and by an anterior shift of otx2 (Fig. 1F). The severe phenotype was characterised by the loss of brain anterior to, and often including, the mid/hindbrain boundary as shown by loss of Pax6 (Fig. 1D) and Wnt1 expression (Fig. 1G). The hindbrain was unaffected as shown by expression of Krox20 (Fig. 1H).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 1. Marker gene characterisation of "late" lithium phenotypes by in situ hybridisation of (A-C) tailbud stage and (D-H) 24 hpf (wild type, left) and lithium- treated (Li+, right) embryos (A,C,D,F,G,H, lateral view; B,E dorsal view; anterior to the left). (A,B) Anteriorly shifted wnt1 covers the anterior neural plate (Li+). (C) Shh is diminished in the anterior midline (Li+). (D,F) The mild phenotype is characterised by the loss of brain anterior to D2/3 diencephalic boundary as revealed by (D) pax6 and (F) otx2. (E,G) The severe phenotype is characterised by the loss of brain anterior to the MHB as revealed by (E) pax6 and (G) wnt1. MHB was absent in the most severe cases (*). (H) The hindbrain was unaffected by the treatment as shown by krox20 expression.

 
The lithium-induced deletion of the rostral brain was confirmed by comparison of the size of the head in wild-type and treated embryos at 24 hpf (see Materials and Methods). We found a reduction of approximately 15% of the rostrocaudal axis of treated embryos (515±55 µm, n=16) versus controls (694±16 µm, n=16), while the dorsoventral head dimension was unchanged.

To investigate whether the loss of brain induced by lithium was due to apoptosis, we carried out the TUNEL assay on lithium-treated tailbud and 24 hpf embryos. Since there was no difference in labelling between lithium-treated and wild-type embryos we conclude that apoptosis does not underlie the lithium phenotype (data not shown).

The data show that the loss of anterior brain caused by lithium-mediated ectopic activation of the Wnt pathway is the consequence of posteriorization of the neuroectoderm during early- to midgastrula.

Overexpression of dn Xgsk3ß mRNA in wild-type embryos phenocopies mbl and lithium treatment
Lithium treatment inhibits Gsk3ß activity and phenocopies the mbl defects. To test whether inhibition of Gsk3ß activity is sufficient to phenocopy mbl, we overexpressed dn Xgsk3ß mRNA (Pierce and Kimelman, 1996) in wild-type embryos with the expectation of inducing loss of eyes. Indeed, overexpression of dn Xgsk3ß mRNA caused loss of eyes or reduction in their size in approx. 40% of injected embryos (n=154) (Fig. 2A,E). Although we titrated the mRNA concentrations to be injected and chose the concentration that induced the highest number of embryos with the eyeless phenotype associated with the lowest number of gastrulation phenotypes, there was still high mortality of injected embryos (Fig. 2A). It is likely that this mortality was caused by the disturbance of the Wnt pathway during axis formation (Harland and Gerhart, 1997; Moon and Kimelman, 1998). Consistent with this is the observation that a number of dn Xgsk3ß mRNA-injected embryos displayed axial abnormalities at the tailbud stage as indicated by truncated and bifurcated expression of flh, the marker for the notochord anlage (not shown). To circumvent interference of the "early" Wnt pathway by dn Xgsk3ß mRNA, we overexpressed the plasmid DNA containing dn Xgsk3ß driven by the CMV promoter (1.4 nl of 40 µg/ml). In three independent experiments 13.5% (14/102) of embryos had loss of eyes and partial loss of forebrain. Since the efficiency with which dn Xgsk3ß DNA overexpression induced the eyeless phenotype was very low, most likely due to mosaicism, we concluded that in our experimental design overexpression of dn Xgsk3ß mRNA was to be preferred. The specificity of the observed effects of dn Xgsk3ß mRNA on eye development was confirmed by injecting the inactive fs Xgsk3ß mRNA (Pierce and Kimmelman, 1996), which caused a mutant eye phenotype in less than 5% of embryos (Fig. 2C). To study gain of function of gsk3ß we overexpressed full length fl Xgsk3ß mRNA and observed an eye/brain phenotype in approx. 10% of embryos (Fig. 2B) that was characterised by the deletion of the ventral forebrain and accompanying partial eye-fusion (Fig. 2F,G). Together these data suggest that the inhibition as well as ectopic activation of gsk3ß signalling affects eye development.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 2. Overexpression of (A) dominant negative dn Xgsk3ß in wild-type embryos induced small eyes or loss of eyes as evaluated at 2 dpf. This phenotype was not induced either by overexpression of (B) full-length fl Xgsk3ß or by (C) frame shift fs Xgsk3ß. Numbers of embryos per treatment are indicated (top of graph) pooled from (A) 4, (B) 7 and (C) 4 independent experiments. (D-F) Phenotypes at 3 dpf or (G) at 24 hpf (lateral view, rostral to the left, dorsal up) of (D) wildtype, and upon overexpression of (E) dn Xgsk3ß that induced small eyes (left) or loss of eyes and forebrain (right), or (F,G) full-length fl Xgsk3ß that induced deletion of the ventral forebrain and partial eye fusion. (H-J) emx1 expression, at approx. 30 hpf, in (H) wild type is restricted to the telencephalon (arrow), but overexpression of dn Xgsk3ß (I,J) resulted in (I) eye reduction accompanied by an expanded emx1 domain in a few cases, and (J) in loss of eyes accompanied by normal emx1 expression in the majority of cases. (K,L) fgf8 expression in a squash preparation (dorsal view) at approx. 30 hpf in (K) wild type, and (L) an embryo overexpressing dn Xgsk3ß, showing small eyes accompanied by loss of optic stalk labelling (right panel). 1, MHB; 2, optic stalks; 4, dorsal diencephalon; 5, retina. mRNAs (320 pg/1 nl) were injected into one-cell stage embryos.

 
To study whether inhibition of gsk3ß in addition to eye development also interferes with morphogenesis of other brain compartments, we carried out in situ hybridisation with marker genes. Loss of function of emx1 in the mouse influences telencephalic development (Yoshida et al., 1997). emx1 in zebrafish is specifically confined to the dorsal telencephalon (Fig. 2H) (Morita et al., 1995). Overexpression of dn Xgsk3ß mRNA did not affect emx1 expression in 25/26 embryos with small eyes or in 8/39 eyeless embryos (Fig. 2J). In the one remaining embryo with small eyes an emx1 expression domain was shifted anteroventrally as in mbl (Fig. 2I), whereas in the 31/39 eyeless embryos emx1 was absent (not shown). Therefore, ectopic activation of the Wnt pathway through inhibition of Gsk3ß may induce loss of eyes without affecting the telencephalon. However, when it induces deletion of the telencephalon the eyes are always lost as well.

In zebrafish, fgf8 (acerebellar) is expressed at the MHB, in the dorsal diencephalon, retinae and optic stalks and in the facial ectoderm (FEC) (Fig. 2K) (Reifers et al., 1998). Overexpression of dn Xgsk3ß mRNA that induced small eyes in the majority of these embryos did not affect the fgf8 pattern (16/24) (Fig. 2L, left panel). In the minority of embryos with small eyes the optic stalk labelling was absent (7/24) (Fig. 2L, right panel), while exceptionally (1/24), fgf8 was expressed only at the MHB (not shown). In most of the embryos that lost their eyes upon dn Xgsk3ß mRNA overexpression, fgf8 was expressed at the MHB only (26/40) or not at all (14/40) (not shown). The data indicate that experimental activation of the Wnt pathway in zebrafish embryos through dn gsk3ß overexpression can differentially affect telencephalon and eyes.

Common molecular mechanisms underlie mbl and lithium-generated phenotypes
To investigate whether a common mechanism underlies gsk3ß inhibition and the mbl phenotype, we treated mbl mutants with a sub-effective dose of lithium. We reasoned that, owing to the dosage effect, mbl heterozygotes would be more sensitive to partial gsk3ß inhibition than wild types. We used 5-10 minute exposure to lithium (Fig. 3). A 6 minute treatment applied to the offspring of mbl+/– outcrossed to HLwt, results in 50% eyeless embryos and 50% wild-type embryos (Fig. 3A). This same treatment induced less than 2% of embryos affected in wildtypes (Fig. 3B), demonstrating an enhanced sensitivity of mbl heterozygotes to ectopic activation of the Wnt pathway. Interestingly, the same treatment results in 25% small eyes, 25% eyeless and 50% wild types when the offspring of mbl+/– outcrossed to Tüwt is used (not shown). Therefore the HLwt background is more sensitive to gsk3ß inhibition, possibly because of genetic differences in modifier genes that interact with the gsk3ß signalling.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3. Sensitivity to lithium of mbl heterozygotes as compared to wildtypes. Eye phenotype frequencies in 2 dpf zebrafish embryos treated at 4 hpf with lithium (0.3 M for 5-10 minutes). (A) Heterozygous mbl+/- x HLwt outcrosses. A 6-minute treatment resulted in 50% eyeless and 50% wild-type embryos. (B) Wild-type crosses where a 6-minute treatment resulted in a less than 2% phenotype. Numbers of embryos pooled from 2 independent experiments are indicated at the top of the graph. Wt, wild type; se, small eyes; ne, no eyes; de, dead.

 
Our data show that lower levels of wild-type Mbl protein in mbl heterozygotes result in a higher sensitivity to gsk3ß inhibition, indicating that mbl encodes a dosage-dependent inhibitor of Wnt signalling. These experiments support the hypothesis that gsk3ß and Mbl function in the same pathway.

Overexpression of Xgsk3ß rescues eyes of mbl embryos
To test the hypothesis that wild-type Mbl protein antagonizes the Wnt pathway we investigated the effects of injections of dn Xgsk3ß or fl Xgsk3ß mRNAs into progeny of in-crosses of mbl heterozygous fish. Overexpression of dn Xgsk3ß mRNA induced loss or reduction of eyes in approx. 80% of embryos (Fig. 4A). When effects of dn Xgsk3ß on wild-type embryos (Fig. 2A) as well as the increased susceptibility of heterozygous mbl embryos to lithium (Fig. 3A) are considered then 80% of embryos with a mutant phenotype would be predicted. To investigate whether the overexpression of fl Xgsk3ß mRNA could rescue eyes in mbl–/– embryos, we injected this mRNA into the progeny of in-crosses of mbl heterozygotes. Because of the variable penetrance of the eye phenotype in mbl embryos that ranges from eyelessness to small eyes (Heisenberg et al., 1996), we present analysis of only eyeless progeny (Fig. 4B,D). Upon injection of fl Xgsk3ß mRNA in embryos from eyeless clutches a reduction in eyeless embryos from 25% to 5% was accompanied by a corresponding increase in embryos with small eyes from 0% to 20% (Fig. 4B,E). These data strongly suggest that a simultaneous increase in the number of embryos with small eyes and a decrease of eyeless embryos reflects eye-rescue of homozygous eyeless mbl–/– embryos by fl Xgsk3ß mRNA.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 4. (A,B) Frequencies of phenotypes at 2 dpf of embryos from in-crosses of heterozygous mbl fish upon overexpression of (A) dominant negative dn Xgsk3ß that induced loss of eyes in approx. 80% of embryos, and (B) full-length fl Xgsk3ß, which rescued eyes of mbl-/- embryos. Numbers of embryos pooled from (A) 4 and (B) 5 independent experiments are indicated at the top of the graph; n.i., non-injected. (C-E) Eye phenotypes (lateral view, rostral to the left, dorsal up) at 3 dpf of (C) wild-type embryo from an eyeless clutch, (D) mbl embryo from an eyeless clutch, (E) overexpression of full-length fl Xgsk3ß rescued eyes in mbl. (F-H) flh expression at the tailbud stage. (G) in mbl, anterolateral borders of the neural plate (anterodorsal view) ectopically express flh compared to (F) wild type (arrowheads). (H) Overexpression of full-length fl Xgsk3ß reduced ectopic expression of flh (arrowhead, ectopic flh in mbl). mRNA (320 pg/1nl) was injected into one-cell stage embryos.

 
To confirm that phenotypically rescued embryos were indeed mbl–/–, we genotyped uninjected and fl Xgsk3ß mRNA-injected embryos. The marker closest to the mbl locus (G.-J. Rauch and R. Geisler pers. comm.) appeared to be z24851 on 60.3 cM (see Materials and Methods; Fig. 6) i.e. all phenotypically wild-type embryos (153/153) were genotyped as siblings (we could not discriminate between heterozygotes and wild types), 71/73 phenotypically mutant embryos were genotyped as mbl–/–, whereas two eyeless embryos were genotyped as siblings (Table 1). Genotyping of fl Xgsk3ß mRNA-injected embryos from eyeless clutches demonstrated that in 60% (18/29) of genotypically mbl–/– embryos eyes were rescued upon overexpression (Table 1). Surprisingly, 9/107 genotypic siblings had reduced eye size. Most of these embryos (7/107) originate from an experiment in which they were evaluated for marker genes prior to genotyping. Since the pigmentation was still weak and absolute eyesize difficult to determine in these embryos wild-type eyes may erroneously have been scored as small eyes. Moreover, some of the embryos with unexpected phenotypes may have recombinations between the marker and mbl locus. The genotyping confirmed our previous observation (Fig. 2B,F,G) that in the wild-type background gain-of-function Gsk3ß leads to approx. 13% (Table 1) of embryos with the overexpression phenotype, i.e. the fused eyes and deleted ventral forebrain.


View this table:
[in this window]
[in a new window]
 
Table 1.
 
To confirm the validity of rescues mediated by fl Xgsk3ß mRNA we injected zebrafish zf gsk3ß mRNA into mbl embryos (kind gift from Drs T. Hirano/M. Hibi) (Shimizu et al., 2000). As expected, since conservation at the protein level of gsk3ß from the two species is high (>80%), fl zf gsk3ß mRNA rescued eyes in mbl–/– equally well as fl Xgsk3ß mRNA (data not shown).

To study whether the wild-type brain has been restored in fl Xgsk3ß- rescued mbl–/– embryos with small eyes, we analysed expression of flh, emx1 and fgf8. The zebrafish homeobox gene floating head (flh) that is essential in notochord development (Talbot et al., 1995) is required for progression of neurogenesis in the epiphysis. In mbl–/– embryos epiphysal neurons are generated throughout the dorsal forebrain within the ectopic flh expression domain that delineates the front of the neural plate as early as the tailbud stage (Fig. 4G) (Masai et al., 1997). Overexpression of fl Xgsk3ß in mbl embryos resulted in a marked downregulation of this ectopic flh-domain at the anterior neural plate (Fig. 4H) that now resembled the wild-type expression (Fig. 4F) and most likely predicted eye rescue.

The telencephalic domain of eyeless and small eyes mbl embryos was shifted ventrally and anteriorly as revealed by an expanded emx1 domain (Fig. 5B,C). These data suggest that telencephalic domain in mbl embryos is in molecular terms not lost, but transformed, with, as a consequence, the lack of differentiated telencephalon. The data show that overexpression of fl Xgsk3ß may rescue eyes, without fully restoring the wild-type emx1 domain (Fig. 5D). To further analyse the effect of rescue on brain regionalisation, mbl embryos were labelled with fgf8. In uninjected mbl embryos, the loss of eyes was accompanied by the disappearance of fgf8 expression in the optic stalks and retinae and weakening or disappearance of the expression in the dorsal diencephalon, whereas expression at the mid/hindbrain boundary and in facial ectoderm was present (Fig. 5F). fgf8 expression in rescued embryos with small eyes was restored to various degrees (Fig. 5G,H). In addition to the wild-type pattern (left eye in Fig. 5H), eye rescue could be established without restoration of fgf8 in retinae (left eye in Fig. 5G), suggesting that Xgsk3ß is sufficient to fully restore eyes in mbl–/– embryos.



View larger version (79K):
[in this window]
[in a new window]
 
Fig. 5. emx1 expression at approx. 30 hpf is restricted to the telencephalon in wild-type embryos (A). In mbl embryos with small eyes (B) and (C) eyeless, this expression is anteroventrally expanded. (D) Overexpression of full-length fl Xgsk3ß in mbl embryos rescued eyes but did not normalize the mutant emx1 domain. (E-H) fgf8 expression at approx. 30 hpf in (E) wild-type embryos and (F) eyeless mbl embryos that lost the expression in retinae and optic stalks and still showed weak expression in facial ectoderm (FEC) and dorsal diencephalon and a normal expression at the MHB. (G,H) Overexpression of full-length fl Xgsk3ß in mbl embryos rescued expression in one optic stalk and one eye (G) and (H) both eyes and fully rescued wild-type fgf8 expression. (A-H, lateral view, rostral to the left; G,H lower panels in a frontal view.) 1, MHB; 2, optic stalks; 3, FEC; 4, dorsal diencephalon; 5, retina. mRNAs (320 pg/1nl) were injected in 1-cell embryos.

 
mbl corresponds to axin1
The question of whether mbl corresponds to gsk3ß is readily answered; the mbl locus does not encode gsk3ß, since they map on different linkage groups, LG 3 and LG 9, respectively (Shimizu et al., 2000) (http:/wwwmap.tuebingen.mpg.de). Our data strongly suggest that although the gsk3ß-mediated rescue of mbl is incomplete it plays a pivotal role in the pathway involving wild-type mbl function. Since gsk3ß antagonises the Wnt pathway through phosphorylation of ß-catenin, it appears that a candidate gene for mbl should function similarly. axin1 maps at 62.8 cM on LG 3 close to the marker z24851 at 60.3 cM that we found to be closely linked to mbl. axin1 therefore represents an excellent candidate gene (Fig. 6A) (Geisler et al., 1999; Shimizu et al., 2000; Heisenberg et al., 2001). To test for the correspondence of axin1 and mbl we sequenced axin1 cDNA (accession no. AB032262) (Shimizu et al., 2000) from 2 wild-type lines and a homozygous mbl mutant background. In axin1 cDNA that was amplified from mbl mutants we found a 1 nt T -> A transversion at position 1220 that results in a change of leucine into glutamine at position 399 in the protein (Fig. 6B). This leucine is conserved in a 25 aa sequence in axin, which represents the minimal gsk3ß interaction domain (GID) that directly binds to gsk3ß (Hedgepeth et al., 1999a). axin1 mRNA is maternally present and its expression is ubiquitous in wild-type and mbl embryos until and including the tailbud stage (data not shown) (Heisenberg et al., 2001). Importantly, at 24 hpf when the telencephalic domain is clearly delineated by emx1 expression axin1 mRNA appears to be concentrated in the midbrain and to be less abundant in the telencephalon, at the mid/hindbrain boundary (Fig. 6E) and throughout dorsal fore and midbrain. In mbl embryos there is an anterior brain domain that although misshapen, is similar to wild type in that it is characterised by low abundance of axin1 message (Fig. 6F). To study the functional role of the leucine to glutamine mutation in GID of axin, we assessed the capacity of wild-type axin1 mRNA to rescue mbl. Overexpression of 50 pg of full-length axin1 mRNA resulted in more than 80% (9/11) phenotypic rescue of genotypically mbl embryos (Table 1). The axin1-mediated rescue frequently resulted in a wild-type phenotype, whereas gsk3ß-mediated rescue most often resulted in smaller eyes. At higher concentrations overexpression of axin1 induced a headless ventralised phenotype reminiscent of the phenotype of sqt;boz mutants (Sirotkin et al., 2000). Ectopic expression of an equivalent quantity of the mutant mbl RNA could not rescue the masterblind phenotype. Interestingly, in four independent experiments overexpression in wild-type embryos of 150 pg of mRNA transcribed from axin1 containing the L399Q mutation resulted, at 24 hpf, in 25% (29/117) of embryos with a phenotype characterized by loss of telencephalon but with clearly present laterally positioned eyes (Fig. 6D), in 6% (7/117) eyeless embryos and 11% (13/117) dead embryos. These data suggest that upon overexpression, mutant mbl exerts a dose-dependent dominant negative activity, and provides in vivo evidence for the observation by Heisenberg et al. (Heisenberg et al., 2001) that TCF-dependent transcription in vitro is increased in the presence of L399Q mutant mbl/axin.

The data demonstrate that the mbl locus corresponds to axin1 and that the recovered point mutation results in an altered axin1 function that leads to activation of ß-catenin /TCF.

In summary, mutation in minimal GID of axin1/mbl as well as a fine-tuned post-MBT treatment with lithium or injection of dn gsk3ß mRNA all induce loss of eyes in zebrafish embryos, while overexpression of gsk3ß or axin1 rescues eyes of mbl embryos. The data are consistent with ectopic activation of ß-catenin/TCF signalling in mbl embryos.


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Lithium treatment that phenocopies mbl and hdl mutants blocks establishment of the anterior CNS through posteriorization of its progenitors
While lithium is known to exert effects on phosphoinositol metabolism (Berridge et al., 1989), recent evidence has demonstrated that its developmental effects are primarily due to activation of the Wnt pathway through inhibition of gsk3ß and a consequent stabilisation of unphosphorylated ß-catenin (Klein and Melton, 1996; Stambolic et al., 1996; Hedgepeth et al., 1997). When fish and frog embryos are treated with lithium post-MBT (present work) (Yamaguchi and Shinagawa, 1989; Fredieu et al., 1997; Macdonald et al., 1994) loss of anterior CNS ensues that is reminiscent of phenotypes of the zebrafish mutant masterblind (mbl) (Heisenberg et al., 1996). By treating embryos at different times during development with lithium we determined that the critical period for head induction is from late blastula (sphere) to early gastrula (shield) similar to what has been observed in Xenopus (Yamaguchi and Shinagawa, 1989). In order for normal brain development to proceed, Wnt signalling has to be excluded during this interval from the prospective forebrain region/the animal pole region (Woo and Fraser, 1995). The end of this interval coincides with the earliest patterning events within anterior neuroectoderm (Houart et al., 1997). It is likely that from this moment onwards ectopic Wnt does not interfere with head induction per se but instead disrupts genes that regionalise the neural plate. We show that deletion of anterior CNS in lithium-treated embryos is not due to apoptosis, but to posteriorisation of the anterior neuroectoderm as revealed by an anterior shift in expression of midbrain- and MHB-specific marker genes. An interesting proposition has been made that lithium posteriorises anterior neuroectoderm by negatively affecting cell proliferation which appears to be the highest in the anterior neural plate (Yamada, 1994; Gathpande et al., 1993; Hall, 1942). Based on our data that programmed cell death does not underly loss of anterior CNS in zebrafish embryos treated after the MBT with lithium and in conjunction with data from these classical experiments we speculate that the population of cells that would generate the forebrain in normal development never arises in lithium-treated embryos. Indeed, this may well be the reason why the anterior tissue of lithium-treated embryos is not only transformed to posterior fates, but is lacking all together. Therefore it may be that this ectopic Wnt signal, through activation of inappropriate target genes, downregulates proliferation. Although this proposition seems to contradict the well established role of Wnts as proto-oncogenes known to stimulate proliferation in cancer, the situation in the context of an embryo may be different. In the anterior neural plate, a balance of signalling inputs may result in a specific combination of activated target genes which accounts for inhibition rather than stimulation of cell cycling.

Interestingly, the block on gsk3ß activity and a consequent activation of the Wnt pathway by the post-MBT lithium treatment, in the most severe cases, phenocopies zebrafish hdl (headless) mutants (Kim et al., 2000). The common molecular mechanisms underlying this phenotypic resemblance is evident since in hdl the loss of function of Tcf3 (Pelegri et al., 1998), a transcriptional repressor in the canonical Wnt pathway results in derepression of Wnt targets (Kim et al., 2000), while lithium treatment inhibits gsk3ß and apparently activates an overlapping set of targets (Fredieu et al., 1997) (this work). The phenotypes of mbl and hdl as well as of lithium-treated and dn gsk3ß-injected embryos are presumably due to activation of Wnt target genes, which are repressed in the anterior CNS in normal development.

Mutation in mbl and inhibition of gsk3ß induce loss of eyes but have distinct effects on brain regionalisation
The posteriorising effect of an ectopic Wnt signal results in loss of eyes (Heisenberg et al., 1996; Masai et al., 1997; Kelly et al., 1995; Fredieu et al., 1997; Stachel et al., 1993; Kim et al., 2000) (this work). Vertebrate eye formation is initiated by protrusion of optic vesicles from anterior neural tissue. The optic vesicle develops into the optic cup while inducing lens in the opposing ectoderm (Grainger, 1992). As a consequence of ectopic Wnt signal neither the optic vesicle nor the lens can form in mbl (Heisenberg et al., 1996). Our experiments show that this anterolateral region of the early neural plate that gives rise to optic vesicles is transformed in mbl embryos and now ectopically expresses flh. Accordingly, in mbl embryos rescued with gsk3ß the wild-type flh pattern is restored. The optic vesicle presumably does not form because anterior neural tissue is transfated to posterior and has lost its morphogenetic properties. Interestingly, it has been suggested that overexpression of gsk3ß in Xenopus interferes with signalling that controls morphogenesis of optic vesicles (Itoh et al., 1995). During early gastrulation this most anterior presumptive retina/forebrain field represents the source of the lens inducing planar signal (Grainger, 1992). Since in mbl embryos this region is posteriorised, the lens-inducing signals are likely not generated at all and as a consequence the lens fails to develop.

Although eye loss is common to mbl, hdl mutants, and experimental inhibition of gsk3ß, the brainpattern is differentially affected. Although previous observations that in mbl embryos the telencephalon is reduced or missing are still valid (Heisenberg et al., 1996), we find that emx1 expression, which in wild type delineates the most dorsal telencephalon, is in mbl not reduced or lost, but rather is expanded and shifted anteroventrally. It appears that the emx1 domain is anteriorly displaced from its dorsal position as indicated by the diencephalic marker flh [compare Fig. 5B,C and Fig. 7B (Masai et al., 1997)]. The consequence appears to be the lack of differentiated telencephalon that in order to differentiate may require signals from the most anterior ventral CNS, which has been transformed in mbl. In contrast to mbl, overexpression of dn gsk3ß either does not affect emx1 expression at all, or in the most severe cases its domain is deleted together with all of the fore- and midbrain. However in 1 out of 26 embryos overexpressing dn gsk3ß we observed the expanded emx1 domain that is typical for mbl mutants. Moreover, our data show that overexpression of fl Xgsk3ß in mbl mutants may rescue eyes, without restoring telencephalon, as evidenced by an aberrant emx1 domain in these embryos that remains, as in mutant embryos, ventrally expanded. An exciting hypothesis is that eye and telencephalon would require different levels of Wnt inhibition for their development. To assess whether this hypothesis is valid we are currently investigating the localisation, abundance and phosphorylation status of ß-catenin in mbl embryos as well as in embryos that received different experimental treatments.

The mbl locus corresponds to axin1
Our data suggest that interference with gsk3ß signalling in the embryo results in different phenotypes as a consequence of quantitative differences in phosphorylation of ß-catenin. Indeed, we show that the mbl locus signals in a dose-dependent fashion since a sub-threshold lithium treatment of mbl heterozygote embryos, which only marginally affected wild-type embryos, resulted in eyeless phenotype in heterozygotes. Conversely when gsk3ß was overexpressed in homozygous mbl it was capable of rescuing eyes but not their wild-type size. We deduced that mbl contributes to Gsk3ß-mediated phosphorylation of ß-catenin. These experiments place the mbl gene in the canonical Wnt pathway in parallel or upstream of the complex consisting of APC, Gsk3ß, PP2A and ß-catenin (Bienz and Clevers, 2000). Identification of axin1 as the mbl locus (this work) (Heisenberg et al., 2001) was therefore in agreement with the role proposed for mbl. axin was identified as the gene mutated in the fused mice that as homozygotes have axial duplications (Perry et al., 1995). Moreover, when tested in the Xenopus axis-induction assay, axin inhibits induction of a secondary axis by negatively regulating Wnt (Zeng et al., 1997; Fukui et al., 2000). In a multimeric complex, Axin simultaneously binds to APC, Gsk3ß, PP2A and ß-catenin to promote Gsk3ß-mediated phosphorylation of ß-catenin and its subsequent degradation (Bienz and Clevers, 2000; Ratcliffe et al., 2000). In this fashion axin prevents interaction of stabilised unphosphorylated ß-catenin with TCF transcription factors and subsequent regulation of Wnt target genes (Roose et al., 1999; Bienz and Clevers, 2000). mbl is a point mutation in axin1 resulting in a leucine to glutamine substitution at position 399 that leads to its loss of function. Leu 399 is conserved in a 25 aa sequence in Axin, which represents the minimal Gsk3ß interaction domain (GID) that directly binds to Gsk3ß (Hedgepeth et al., 1999b). The analogous mutation L525M in murine Axin1 – present as L396M in human colorectal cancers – also interfered with gsk3ß binding and resulted in low level activation of TCF-dependent transcription (Webster et al., 2000). Yet another L521P point mutation, also in GID of murine axin1, transformed it into a transcriptional activator (Smalley et al., 1999). Our data are in agreement with these findings, since we demonstrate that overexpression of axin1 L399Q in wild-type embryos induces 30% phenotype most likely through its dose-dependent dominant negative activity. In contrast to the mbl phenotype, overexpression of axin1 L399Q in wild-type embryos induces a deletion of the telencephalic region in a majority of embryos (80%), whereas only 20% becomes eyeless. The molecular basis for the dominant negative activity of axin1 that is mutated in GID domain (Hinoi et al., 2000; Smalley et al., 1999; Webster et al., 2000) may be based on its interference with the function of wild-type axin1. In this scenario, mutant axin1 would compete with wild-type axin1 for components that form the multimeric complex with it, such as APC, PP2A and ß-catenin. In this manner, mutant axin1 would impair the function of wild-type axin1,which is to antagonise the Wnt signal. If true, those regions of the embryo containing lower levels of axin1 mRNA would, upon overexpression of mutant axin1, be more sensitive to its dominant negative activity. Strikingly, zebrafish telencephalon contains less axin1 mRNA than the midbrain (Fig. 6E,F). It is therefore tempting to speculate that the telencephalon would be the most sensitive target to phenotypic alteration by dominant negative activity of overexpressed mutant axin1. Our experiments appear to support this possibility.

With regard to the mbl phenotype, it is interesting to note that fused homozygous mice display strong neuroectodermal abnormalities (Perry et al., 1995). Expression of axin1 in the anterior midbrain of Xenopus embryos (Hedgepeth et al., 1999a) its anterior overlap at the mid/forebrain boundary with tcf4 and its dorsal overlap with wnt1 and wnt3A (Konig et al., 2000) a), as well as its strong expression in the midbrain of the zebrafish embryo (Fig. 6E,F) further support its role in regionalisation of the anterior brain.

Why does overexpression of gsk3ß only rarely result in full phenotypic rescue of mbl?
Overexpression of axin1 more efficiently and more completely rescues mbl than gsk3ß overexpression (Table I), although in both cases rescue is expected to arise as a consequence of ß-catenin phosphorylation and, as a result, counteraction of the ectopic Wnt signal. It has been shown that ß-catenin is not a good substrate for Gsk3ß in vitro, but is efficiently phosphorylated in the presence of Axin1 (Ikeda et al., 1998). Since the point mutation in GID of mbl/axin1 abolishes binding of gsk3ß to Axin1 (Heisenberg et al., 2001), this is likely to be the limiting factor for its enzymatic activity. We speculate that overexpression of gsk3ß can partially overcome this limitation and to an extent rescue the mbl phenotype because it may very efficiently interact with maternal axin1. For instance, it has been shown in Xenopus egg extracts that the inhibitory effect of GBP and dsh on ß-catenin degradation is reversed by high concentrations of gsk3ß due to titration of GBP and dsh on axin (Salic et al., 2000). The same work suggests that the interaction between axin- gsk3ß is highly dynamic since dn gsk3ß blocks degradation of ß-catenin in extracts. If so, then overexpression of gsk3ß in mbl embryos would shift the binding equilibrium towards gsk3ßaxin, and, as a consequence, degradation of ß-catenin. The reason for the incomplete phenotypic rescue of mbl may be the limiting concentrations of maternal axin1. Alternatively, it is possible that the weak dominant negative activity of L399Q mutant axin1 cannot be overruled by overexpression of gsk3ß.

Does a gradient of Wnt signalling pattern the neural ectoderm?
Comparison of loss-of-function hdl/tcf3, lithium treatment, overexpression of dn gsk3ß and loss of Gsk3ß binding activity of mbl/axin1 reveals that although they all activate an ectopic Wnt signal their resulting phenotypes differ. This may be due to the type of Wnt target genes and/or the extent to which they are ectopically activated. Expression patterns of Wnts and their regulators suggest that there is an AP gradient of activation/repression of Wnt targets in the anterior neural plate.

For instance, in the most severe phenotypic category of hdl/tcf3, dn gsk3ß overexpression and severe lithium phenotype, Wnt target genes that during normal development are activated at the MHB and/or posterior to it, are in mutant and treated embryos derepressed and ectopically expressed anterior to the MHB (present work) (Kim et al., 2000). During normal development repression of these genes in the most anterior domain secures head induction. The most anterior neuroectoderm is characterised not only by the highest expression of tcf3, the absence of Wnt ligands and high levels of axin1/mbl in the midbrain caudally to it, but is also exposed to secreted Wnt antagonists such as dkk1 (Hashimoto et al., 2000) and perhaps others as well. These are only a few molecules among those that play a role in establishment of a gradient of Wnt signal. At the present moment the challenge is to identify expression and function of other potential players that generate neuroectodermal polarity, both known ones such as APC and PP2A and novel ones. Moreover, it should be possible, using specific antibodies, to carry out spatiotemporal analysis of stabilised unphosphorylated ß-catenin and thus investigate whether there exists an AP gradient of Wnt signalling.

Since phosphorylation of ß-catenin represents an integrating point of numerous input signals within the Wnt pathway we propose that there may be a gradient of constitutive inhibition (phosphorylation of ß-catenin) with its apex at the anterior pole of the embryo. This gradient acts upon the posteriorising signal, which is the unphosphorylated ß-catenin with the apex at the posterior pole.


    ACKNOWLEDGMENTS
 
We are indebted to Drs G.-J. Rauch and R. Geisler for advising us with the genotyping work and commenting on the manuscript. We would like to thank Henk Aanstoot and Maarten Pennings for help in sequencing mbl. We thank Drs D. Kimelman and T. Hirano for providing DNA constructs, Dr M. Hibi for technical advice and Drs M. Brand, J-P. Concordet, A. Fjose, T. Jowett, M. Mishina, A. Molven and E. Weinberg for constructs for riboprobes. We thank Drs O. Destree, J. den Hertog, F. van Eeden, R. Korswagen and Prof. R. Plasterk for critically commenting on the manuscript. We highly appreciate assistence with imaging and photography from Ferdinand Vervoordeldonk and Jaap Heinen. Animal Care Facility of the Hubrecht Lab is thanked for services rendered.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Aberle, H., Bauer, A., Stappert, J., Kispert, A. and Kemler, R. (1997). ß-catenin is a target for the ubiquitin-proteosome pathway. EMBO J. 16, 3797-3804.[Medline]
Beddington, R. S. and Robertson, E. J. (1998). Anterior patterning in mouse. Trends Genet. 14, 277-284.[Medline]
Behrens, J., von Kries, J. P., Kuhl, M., Bruhn, L., Wedlich, D., Grosschedl, R. and Bierchmeier, W. (1996). Functional interaction of ß-catenin with the transcription factor LEF-1. Nature 382, 638-642.[Medline]
Berridge, M. J., Downes, C. P. and Hanley, M. R. (1989). Neural and developmental actions of lithium: a unifying hypothesis. Cell 59, 411-419.[Medline]
Bienz, M. and Clevers, H. (2000). Linking colorectal cancer to Wnt signaling. Cell 103, 311-320.[Medline]
Christian, J. L. and Moon, R. T. (1993). Interaction between Xwnt-8 and Spemann organizer signalling pathways generate dorsoventral pattern in the embryonic mesoderm of Xenopus laevis. Genes Dev. 7, 13-28.[Abstract/Free Full Text]
Fekany-Lee, K., Gonzalez, E., Miller-Bertoglio, V. and Solnica-Krezel, L. (2000). The homeobox gene bozozok promotes anterior neuroectoderm formation in zebrafish through negative regulation of Bmp2/4 and Wnt pathways. Development 127, 2333-2345.[Abstract]
Fredieu, J. R., Cui, J., Maier, D., Danilchik, V. and Christian, J. L. (1997). Xwnt-8 and lithium can act upon either dorsal mesodermal or neuroectodermal cells to cause a loss of forebrain in Xenopus embryos. Dev. Biol. 186, 100-114.[Medline]
Fukui, A., Kishida, S., Kikuchi, A. and Asashima, M. (2000). Effects of rat Axin domains on axis formation in Xenopus embryos. Dev. Growth Differ. 42, 489-498.[Medline]
Gathpande, S. K., Mulherkar, L. and Modak, S. P. (1993). Lithium chloride and trypan blue induce abnormal morphogenesis by suppressing cell population growth. Dev. Growth Differ. 35, 409-420.
Geisler, R., Rauch, G. J., Baier, H., van Bebber, F., Brobeta, L., Dekens, M. P., Finger, K., Fricke, C., Gates, M. A., Geiger, H., Geiger-Rudolph, S., Gilmour, D., Glaser, S., Gnugge, L., Habeck, H., Hingst, K., Holley, S., Keenan, J., Kirn, A., Knaut, H., Lashkari, D., Maderspacher, F., Martyn, U., Neuhauss, S., Haffter, P. et al. (1999). A radiation hybrid map of the zebrafish genome. Nature Genet. 23, 86-89.[Medline]
Glinka, A., Wu, W., Delius, H., Monaghan, P. A., Blumenstock, C. and Niehrs, C. (1998). Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Nature 391, 357-362.[Medline]
Grainger, R. M. (1992). Embryonic lens induction: shedding light on vertebrate tissue determinatioin. Trends Genet. 8, 349-355.[Medline]
Haffter, P., Granato, M., Brand, M., Mullins, M. C., Hammerschmidt, M., Kane, D. A., Odenthal, J., van Eeden, F. J., Jiang, Y. J., Heisenberg, C. P., Kelsh, R. N., Furutani-Seiki, M., Vogelsang, E., Beuchle, D., Schach, U., Fabian, C. and Nusslein-Volhard, C. (1996). The identification of genes with unique and essential functions in the development of the zebrafish, Danio rerio. Development 123, 1-36.[Abstract]
Hall, T. S. (1942). The model of action of lithium salts in amphibian development. J. Exp. Zool. 89, 1-33.
Hamada, F., Tomoyasu, Y., Takatsu, Y., Nakamura, M., Nagai, S., Suzuki, A., Fujita, F., Shibuya, H., Toyoshima, K., Ueno, N. and Akiyama, T. (1999). Negative regulation of Wingless signalling by D-Axin, a Drosophila homolog of axin. Science 283, 1739-1742.[Abstract/Free Full Text]
Harland, R. and Gerhart, J. (1997). Formation and function of Spemann’s organizer. Annu. Rev. Cell Dev. Biol. 13, 611-667.[Medline]
Hashimoto, H., Itoh, M., Yamanaka, Y., Yamashita, S., Shimizu, T., Solnica-Krezel, L., Hibi, M. and Hirano, T. (2000). Zebrafish Dkk1 functions in forebrain specification and axial mesendoderm formation. Dev. Biol. 217, 138-152.[Medline]
Hedgepeth, C. M., Conrad, L. J., Zhang, J., Huang, H.-C., Lee, V. M. Y. and Klein, P. S. (1997). Activation of the Wnt signaling pathway: A molecular mechanism for lithium action. Dev. Biol. 185, 82-91.[Medline]
Hedgepeth, C. M., Deardorff, M. and Klein, P. S. (1999a). Xenopus axin interacts with glycogen synthase kinase-3 beta and is expressed in the anterior midbrain. Mech. Dev. 80, 147-151.[Medline]
Hedgepeth, C. M., Deardorff, M. A., Rankin, K. and Klein, P. S. (1999b). Regulation of glycogen synthase kinase 3ß and downstream Wnt signaling by axin. Mol. Cell. Biol. 19, 7147-7157.[Abstract/Free Full Text]
Heisenberg, C.-P., Brand, M., Jiang, Y. J., Warga, R. M., Beuchle, D., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Haffter, P., Hammerschmidt, M., Kane, D. A., Kelsh, R. N., Mullins, M. C., Odenthal, J. and Nusslein-Volhard, C. (1996). Genes involved in forebrain development in the zebrafish, Danio rerio. Development 123, 191-203.[Abstract]
Heisenberg, C.-P. et al. (2001). A mutation in the Gsk3-binding domain of zebrafish Masterblind/Axin1 leads to a fate transformation of telencephalon and eyes to diencephalon. Genes Dev. 15, 1427-1434.[Abstract/Free Full Text]
Hinoi, T., Yamamoto, H., Kishida, M., Takada, S., Kishida, S. and Kikuchi, A. (2000). Complex formation of adenomatous polyposis coli gene product and axin facilitates glycogen synthase kinase-3ß-dependent phosporylation of ß-catenin and down-regulates ß-catenin. J. Biol. Chem. 275, 34399-34406.[Abstract/Free Full Text]
Ho, R. and Kane, D. A. (1990). Cell-autonomous action of zebrafish spt-1 mutation in specific mesodermal precursors. Nature 348, 728-730.[Medline]
Hoppler, S., Brown, J. and Moon, R. T. (1996). Expression of a dominant negative Wnt blocks induction of myoD in Xenopus embryos. Genes Dev. 10, 2805-2817.[Abstract/Free Full Text]
Houart, C., Westerfield, M. and Wilson S. W. (1998). A small population of anterior cells patterns the forebrain during zebrafish gastrulation. Nature 391, 788-792.[Medline]
Hsieh, J.-C., Kodjabachian, L., Rebbert, M. L., Rattner, A., Smallwood, P. M., Samos, C. H., Nusse, R., Dawid, I. B. and Nathans, J. (1999). A new secreted protein that binds to Wnt proteins and inhibits their activities. Nature 398, 431-436.[Medline]
Ikeda, S., Kishida, S., Yamamoto, H., Murai, H., Koyama, S. and Kikuchi, A. (1998). Axin, a negative regulator of the wnt signaling pathway, forms complex with GSK-3ß and ß catenin and promotes GSK-3ß-dependent phosphorylation of ß catenin. EMBO J. 17, 1371-1384.[Medline]
Itoh, K., Tang, T. L., Neel, B. G. and Sokol, S. Y. (1995). Specific modulation of ectodermal cell fates in Xenopus embryo by glycogen synthase kinase. Development 121, 3979-3988.[Abstract]
Joore, J., van der Lans, G. B., Lanser, P. H., Vervaart, J. M., Zivkovic, D., Speksnijder, J. E. and Kruijer, W. (1994). Effects of retinoic acid on the expression of retinoic acid receptors during zebrafish embryogenesis. Mech. Dev. 46, 147-150.
Kazanskaya, O., Glinka, A. and Niehrs, C. (2000). The role of Xenopus dickkopf-1 in prechordal plate specification and neural patterning. Development 127, 4981-4992.[Abstract]
Kelly, G. M., Greenstein, P., Erezyilmaz, D. F. and Moon, R. (1995). Zebrafish wnt8 and wnt8b share a common activity but are involved in distinct developmental pathways. Development 121, 1787-1799.[Abstract]
Kim, C.-E., Oda, T., Motoyuki, I., Jiang, D., Artinger, S. B., Chandrasekharappa, S. C., Driever, W. and Chitnis, A. B. (2000). Repressor activity of Headless/Tcf3 is essential for vertebrate head formation. Nature 407, 913-916.[Medline]
Klein, P. S. and Melton, D. A. (1996). A molecular mechanism for the effect of lithium on development. Proc. Natl. Acad. Sci. USA 93, 8455-8459.[Abstract/Free Full Text]
Konig, A., Gradl, D., Kuhl, M. and Wedlich, D. (2000). The HMG-box transcription factor XTcf-4 demarcates the forebrain-midbrain boundary. Mech. Dev. 93, 211-214.[Medline]
Krauss, S., Johansen, T., Korzh, V., Moens, U., Ericson, J. and Fjose, A. (1991). Zebrafish pax[zf-a]: a paired box-containing gene expressed in the neural tube. EMBO J. 10, 3609-3619.[Medline]
Krauss, S., Concordet, J. P. and Ingham, P. W. (1993). A functionally conserved homolog of the Drosophila segment polarity gene expressed in tissues with polarizing activity in zebrafish embryos. Cell 75, 1431-1444.[Medline]
Larabell, C. A., Torres, M., Rowning, B. A., Yost, C., Miller, J. R., Wu, M., Kimelman, D. and Moon, R. T. (1997). Establishment of dorso-ventral axis in Xenopus embryos is prestaged by asymmetries in ß catenin that are modulated by the Wnt signaling pathway. J. Cell Biol. 136, 1123-1136.[Abstract/Free Full Text]
Leyns, L., Bouwmeester, T., Kim, S. H., Piccolo, S. and De Robertis E. M. (1997). Frzb-1 is a secreted antagonist of Wnt signalling expressed in the Spemann organizer. Cell 88, 747-756.[Medline]
Li, Y., Allende, M. L., Finkelstein, R. and Weinberg, E. S. (1994). Expression of two zebrafish orthodenticle-related genes in the embryonic brain. Mech. Dev. 48, 229-244.[Medline]
Macdonald, R., Xu, Q., Barth, K. A., Mikkola, I., Holder, N., Fjose, A., Krauss, S. and Wilson, S. W. (1994). Regulatory gene gene expression boundaries demarcate site of neuronal differentiation in the embryonic zebrafish forebrain. Neuron 13, 1039-1053.[Medline]
Masai, I., Heisenberg, C.-P., Anukampa Barth, K., Macdonald, R., Adamek, S. and Wilson, S. (1997). Floating head and masterblind regulate neuronal patterning in the roof of the forebrain. Neuron 18, 43-57.[Medline]
McMahon, A. P. and Moon, R. T. (1989). Ectopic expression of the proto-oncogene int-1 in Xenopus embryos leads duplication of the embryonic axis. Cell 58, 1075-1084.[Medline]
Molven, A., Njolstad, P. R. and Fjose, A. (1991). Genomic structure and restricted neural expression of the zebrafish wnt-1 (int-1) gene. EMBO J. 10, 799-807.[Medline]
Moolenaar, M., van de Wetering, M., Oosterwegel, M., Peterson-Maduro, J., Korinek, V., Roose, J., Destree, O. and Clevers, H. (1996). XTcf-3 transcription factor mediates ß-catenin-induced axis formation in Xenopus embryos. Cell 86, 391-399.[Medline]
Moon, R. T. and Kimelman, D. (1998). From cortical rotaion to organizer gene expression: toward a molecular explanation of axis specification in Xenopus. BioEssays 20, 536-545.[Medline]
Morita, T., Nitta, H., Kiyama, Y., Mori, H. and Mishina, M. (1995). Differential expression of two zebrafish emx homeoprotein mRNAs in the developing brain. Neurosci. Lett. 198, 131-134.[Medline]
Niehrs, C. (1999). Head in the Wnt- the moleculair nature of Spemann’s head organizer. Trends Genet. 15, 314-319.[Medline]
Nieuwkoop, P. D., Boterenbrood, E. C., Kremer, A., Bloesma, F. S. N., Hoessels, E. L. M. J., Meyer, G. and Verheyen, F. J. (1952). Activation and organization of the central nervous system in amphibians. J. Exp. Zool. 120, 1-108.
Oxtoby, E. and Jowett, T. (1993). Cloning of the zebrafish krox-20 gene (krx-20) and its expression during hindbrain development. Nucleic Acids Res. 21, 1087-1095.[Abstract/Free Full Text]
Pelegri, F. and Maischein, H. M. (1998). Function of zebrafish beta catenin and TCF-3 in dorsoventral patterning. Mech. Dev. 77, 63-74.[Medline]
Perry, W. L. I., Vasicek, T. J., Lee, J. J., Rossi, J. M., Zeng, L., Zhang, T., Tilghman, S. M. and Costantini, F. (1995). Phenotypic and moleculair analysis of a transgenic insertional allele of mouse Fused locus. Genetics 141, 321-332.[Abstract]
Piccolo, S., Agius, E., Leyns, L., Phattacharyya, S., Grunz, H., Bouwmeester, T. and De Robertis, E. M. (1999). The head inducer cerberus is a multifunctional antagonis of Nodal, BMP and Wnt signals. Nature 397, 707-710.[Medline]
Pierce, S. B. and Kimelman, D. (1995). Regulation of Spemann organizer formation by the intracellular kinase Xgsk-3. Development 121, 755-765.[Abstract]
Pierce, S. B. and Kimelman, D. (1996). Overexpression of Xgsk-3 disrupts anterior ectodermal patterning in Xenopus. Dev. Biol. 175, 256-264.[Medline]
Ratcliffe, M. J., Itoh, K. and Sokol, S. Y. (2000). A positive role for the PP2A catalytic subunit in Wnt signal transduction. J. Biol. Chem. 275, 35680-35683.[Abstract/Free Full Text]
Reifers, F., Böhli, H., Walsh, E., Crossley, P., Stainier, D. and Brand, M. (1998). Fgf8 is mutated in zebrafish acerebellar (ace) mutants and is required for maintenance of midbrain-hindbrain boundary development and somitogenisis. Development 125, 2381-2395.[Abstract]
Roose, J., Huls, G., van Beest, M., Moerer, P., van der Horn, K., Goldsschmeding, R., Logtenber, T. and Clevers, H. (1999). Synergy between tumor supressor APC and the ß catenin-Tcf4 target Tcf1. Science 285, 1923-1926.[Abstract/Free Full Text]
Salic, A., Lee, E., Mayer, L. and Kirschner, M. W. (2000). Control of ß-catenin stability: reconstitution of the cytoplasmic steps of the Wnt pathway in Xenopus egg extracts. Mol. Cell 5, 523-532.[Medline]
Shimizu, T., Yamanaka, Y., Ryu, S.-L., Hashimoto, H., Yabe, T., Hirata, T., Bae, Y.-K., Hibi, M. and Hirano, T. (2000). Cooperative roles of Bozozok/Dharma and Nodal-related proteins in the formation of the dorsal organizer in zebrafish. Mech. Dev. 91, 293-303.[Medline]
Sirotkin, H. I., Dougan, S., Schier, A. F. and Talbot, W. S. (2000). bozozok and squint act in parallel to apecify dorsal mesoderm and anterior neuroectoderm in zebrafish. Development 127, 2583-2592.[Abstract]
Smalley, M. J., Sara, E., Paterson, H., Naylor, S., Cook, D., Jayatilake, H., Fryer, L. G., Hutchinson, L., Fry, M. J. and Dale, T. C. (1999). Interaction of Axin and Dvl-2 proteins regulates Dvl-2-stimulated TCF-dependent transcription. EMBO J. 18, 2823-2835.[Medline]
Stachel, S., Grunwald, D. J. and Myers, P. Z. (1993). Lithium perturbation and goosecoid expression identify a dorsal specification pathway in the pregastrula zebrafish. Development 117, 1261-1274.[Abstract]
Stambolic, V., Ruel, L. and Woodgett, J. R. (1996). Lithium inhibits glycogen synthase kinase-3 and mimics wingless signalling in intact cells. Curr. Biol. 6, 1664-1668.[Medline]
Talbot, W., Trevarrow, B., Halpern, M., Melby, A., Farr, G., Postlethwait, J., Jowett, T., Kimmel, C. and Kimelman, D. (1995). A homeobox gene essential for zebrafish notochord development. Nature 378, 150-157.[Medline]
Webster, M. T., Rozycka, M., Sara, E., Davis, E., Smalley, M., Young, N., Dale, T. C. and Wooster, R. (2000). Sequence variants of the axin gene in breast, colon, and other cancers: an analysis of mutations that interfere with gsk3ß binding. Genes Chrom. Cancer 28, 443-453.[Medline]
Welsh, G. I., Wilson, C. and Proud, C. G. (1996). GSK-3: a SHAGGY frog story. Trends Cell Biol. 6, 274-279.
Westerfield, M. (1995). The Zebrafish Book. Eugene: University of Oregon Press.
Woo, K. and Fraser, S. (1995). Order and coherence in the fate map of the zebrafish nervous system. Development 121, 2595-2609.[Abstract]
Yamada, T. (1994). Caudalization by the amphibian organizer; brachyury, convergent extension and retinoic acid. Development 120, 3051-3062.[Abstract]
Yamaguchi, Y. and Shinagawa, A. (1989). Marked alteration at midblastula transition in the effect of lithium on formation of the larval body pattern of Xenopus laevis. Dev. Growth Differ. 31, 531-541.
Yoshida, M., Suda, Y., Matsuo, I., Miyamoto, N., Takeda, N., Kuratani, S. and Aizawa, S. (1997). Emx1 and emx2 functions in development of dorsal telencephalon. Development 124, 101-111.[Abstract]
Zeng, L., Fagotto, F., Zhang, T., Hsu, W., Vasicek, T. J., Perry, W. L., Lee, J. J., Tilghman, S. M., Gumbiner, B. M. and Costantini, F. (1997). The mouse fused locus encodes axin, an inhibitor of the wnt signaling pathway that regulates embryonic axis formation Cell 90, 181-192.[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Hum Mol GenetHome page
S. Domene, E. Roessler, K. B. El-Jaick, M. Snir, J. L. Brown, J. I. Velez, S. Bale, F. Lacbawan, M. Muenke, and B. Feldman
Mutations in the human SIX3 gene in holoprosencephaly are loss of function
Hum. Mol. Genet., December 15, 2008; 17(24): 3919 - 3928.
[Abstract] [Full Text] [PDF]


Home page
DMMHome page
E. Sajedi, C. Gaston-Massuet, M. Signore, C. L. Andoniadou, D. Kelberman, S. Castro, H. C. Etchevers, D. Gerrelli, M. T. Dattani, and J. P. Martinez-Barbera
Analysis of mouse models carrying the I26T and R160C substitutions in the transcriptional repressor HESX1 as models for septo-optic dysplasia and hypopituitarism
Dis. Model. Mech., November 1, 2008; 1(4-5): 241 - 254.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. Ninkovic, C. Stigloher, C. Lillesaar, and L. Bally-Cuif
Gsk3{beta}/PKA and Gli1 regulate the maintenance of neural progenitors at the midbrain-hindbrain boundary in concert with E(Spl) factor activity
Development, September 15, 2008; 135(18): 3137 - 3148.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
G. Davidson, B. Mao, I. del Barco Barrantes, and C. Niehrs
Kremen proteins interact with Dickkopf1 to regulate anteroposterior CNS patterning
Development, March 14, 2003; 129(24): 5587 - 5596.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
O. V. Lagutin, C. C. Zhu, D. Kobayashi, J. Topczewski, K. Shimamura, L. Puelles, H. R.C. Russell, P. J. McKinnon, L. Solnica-Krezel, and G. Oliver
Six3 repression of Wnt signaling in the anterior neuroectoderm is essential for vertebrate forebrain development
Genes & Dev., February 1, 2003; 17(3): 368 - 379.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
H. C. Korswagen, D. Y.M. Coudreuse, M. C. Betist, S. van de Water, D. Zivkovic, and H. C. Clevers
The Axin-like protein PRY-1 is a negative regulator of a canonical Wnt pathway in C. elegans
Genes & Dev., May 15, 2002; 16(10): 1291 - 1302.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Rallu, R. Machold, N. Gaiano, J. G. Corbin, A. P. McMahon, and G. Fishell
Dorsoventral patterning is established in the telencephalon of mutants lacking both Gli3 and Hedgehog signaling
Development, January 11, 2002; 129(21): 4963 - 4974.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van de Water, S.
Right arrow Articles by Zivkovic, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van de Water, S.
Right arrow Articles by Zivkovic, D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?