|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||

Skirball Institute for Biomolecular Medicine, Developmental Genetics Program, Cell Biology and Pathology Departments, New York University Medical Center, 540 First Avenue, New York, NY 10016, USA
* Present address: Divisions of Developmental Biology and Ophthalmology, Childrens Hospital Research Foundation, 3333 Burnett Avenue, Cincinnati, OH 45229-3039, USA
Author for correspondence (e-mail: richard.lang{at}chmcc.org)
Accepted August 20, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Lens induction, Lens development, Dysgenetic lens, Pax6, Fgfr, Bmp7, Foxe3, Sox2, Mouse
| INTRODUCTION |
|---|
|
|
|---|
Of central interest is Pax6, a homeodomain transcription factor that is necessary for eye (Hogan et al., 1986b; Hill et al., 1991) and lens development (Ashery-Padan et al., 2000; Fujiwara et al., 1994) and, in the context of both invertebrate (Halder et al., 1995) and vertebrate (Altmann et al., 1997; Chow et al., 1999) embryos, is sufficient. The expression of Pax6 in the lens lineage in vertebrates (Grindley et al., 1995) is controlled by at least one highly conserved transcriptional control element (Williams et al., 1998). This 341 bp enhancer has activity in directing gene expression to the lens placode, lens epithelium, immature primary lens fiber cells, corneal epithelium and the epithelium of the lacrimal gland (Kammandel et al., 1999; Makarenkova et al., 2000; Williams et al., 1998). In the mouse, Pax6 expression in the lens lineage is maintained from the placode stage onwards through the action of bone morphogenetic protein (Bmp) 7 (Wawersik et al., 1999), a member of the transforming growth factor ß superfamily (Massague, 1998). Bmp7 is normally expressed in the lens placode and its deletion through gene targeting results in a failure of Pax6 expression maintenance (Wawersik et al., 1999) and a variably penetrant phenotype that manifests as anophthalimia in its most severe form (Dudley et al., 1995).
Fibroblast growth factors (Fgfs) have been implicated in late lens development with the demonstration that Fgf-containing retina-conditioned medium and recombinant Fgf 1 and Fgf 2 could stimulate fiber cell differentiation in lens epithelial explants (Chamberlain and McAvoy, 1987; Chamberlain and McAvoy, 1989). In addition, a series of in vivo gain-of-function studies have shown that a number of Fgf ligands can modulate lens development. The placement of Fgf8-containing beads adjacent to the developing chick eye has suggested a role in early lens development (Vogel-Hopker et al., 2000), while overexpression of a variety of ligands in transgenic mice can stimulate premature differentiation of lens fiber cells (Lovicu and Overbeek, 1998; Robinson et al., 1995b). Some members of the Fgf receptor family are also expressed in the lens lineage (de Iongh et al., 1997; de Iongh et al., 1996). Fgfr1 is expressed in the presumptive ectoderm and lens pit. After lens vesicle separation, Fgfr1 and Fgf2IIIc are both expressed in the lens vesicle and presumptive corneal epithelium. As lens development proceeds, Fgfr2IIIc (bek) is expressed throughout the lens epithelium and the transitional zone, but expression declines in maturing lens fiber cells. By contrast, Fgfr2IIIb (KGFR) shows strong expression in the early fibers of the transitional zone with weaker expression in the lens epithelium (de Iongh et al., 1997; de Iongh et al., 1996). Consistent with these observations, it has been shown that when dominant-negative or dimerized soluble forms of fibroblast growth factor receptors (Fgfrs) are expressed in the developing fiber cells, their differentiation is suppressed (Chow et al., 1995; Govindarajan and Overbeek, 2001; Robinson et al., 1995a), indicating that Fgfr activity is necessary. To date, the question of whether Fgfr signaling might be required for earlier phases of lens development, including lens induction, has not been addressed.
In this report, we describe such experiments. We use three distinct strategies to show that at both the morphological and molecular levels, lens induction does not proceed normally if Fgfr activity is perturbed. First, we demonstrate that reduced levels of Pax6 reporter construct expression and Pax6 immunoreactivity result when presumptive lens ectoderm is cultured in the presence of small molecule inhibitors of the Fgfr kinases. Second, we show that when a dominant-negative Fgfr1IIIc is expressed in the presumptive lens ectoderm, early lens development is morphologically abnormal and, in addition, that molecular markers of lens induction, including Pax6 and Sox2, are expressed at reduced levels. Finally, we perform analysis to show that there is a genetic interaction between Bmp7, an established lens inducer (Dudley et al., 1995; Wawersik et al., 1999), and Fgfr signaling at the stage of lens induction. This manifests as more severe lens defects and lower expression levels for Pax6 and Foxe3 (a lens lineage marker) in compound genotype animals. Combined, these analyses indicate that Fgfr signaling has an important role in lens induction and that this pathway converges with the activity of Bmp7 in upregulating the expression of Pax6 (Ashery-Padan et al., 2000; Fujiwara et al., 1994) and Foxe3 (Blixt et al., 2000; Brownell et al., 2000) transcription factors necessary for lens development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Inhibitors of Fgfr signaling
SU9597 is a compound from a new family of inhibitors for the Fgf receptor tyrosine kinases (Mohammadi et al., 1997; Sun et al., 1999) and was used to block Fgf receptor signaling in vitro. The chemical name for SU9597 is 3-{2-[6-(3-methoxy-phenyl)-2-oxo-1,2-dihydro-indol-3-ylidenemethyl]-4-methyl-1H-pyrrol-3-yl}-propionic acid (Makarenkova et al., 2000). For explant cultures, SU9597 was dissolved in dimethylsulfoxide as a 100 mM stock solution, aliquoted and stored at 20°C.
Generation of transgenic mice
A restriction fragment encoding a C-terminally truncated mutant form of the Fgfr1IIIc (Reid et al., 1990) was subcloned into the P6 EE1.0 plasmid that consists of a PGEM4z backbone, the 341 bp Pax6 ectoderm enhancer [designated EE (Williams et al., 1998)] and a 1 kb fragment containing a minimal Pax6 P0 promoter. This minimal promoter fragment extends from an XhoI site located approximately 1 kb upstream of the P0 transcription start to an SpeI located at the transcription start. The SV40 small t splice and polyadenylation signals were downstream of the truncated Fgfr1 cDNA.
RT-PCR expression analysis
RT-PCR was carried out on separated presumptive lens ectoderm and optic vesicle from E9.0-E9.5 Tfr7/Tfr7 transgenic mice. Separated tissues were obtained by harvesting mouse embryos at E9.0-9.5, removing and bisecting heads and then separating, using fine forceps, the head ectoderm from the epithelium of the neural tube. As the lens placode is very firmly adhered to the presumptive retina of the optic vesicle at E9.5, small volumes of 2 mg/ml dispase (Boehringer Mannheim, #1284908) were pipetted onto the lens placode-optic vesicle junction while the tissue was immersed in room temperature phosphate-buffered saline (PBS). After one or two dispase treatments, the lens placode could be separated from the optic vesicle with ease. The separated tissues were then trimmed to ensure that only presumptive lens ectoderm and optic vesicle was harvested. The Ultaspec reagent (Biotecx, TX) used to isolate total RNA and this reverse transcribed with the Reverse Transcription System (Promega) and oligo-dT primer. The resulting cDNA was then used as template in PCR amplifications with SV40 and GAPDH primers. The amplification conditions were 94°C for 45 seconds, 54°C for 30 seconds and 72°C for 30 seconds for 35 cycles. The SV40 sequence primers are specific for the transgene while the GAPDH primers were used as a positive control. Primer sequences are as follows: SV40-250, 5'TTTGCTCAGAAGAAATGCCA; SV40-450, 3'GCAGTGCAGCTTTTTCCTTT; GAPDH, 5'CTACATGGTCTACATGTTCCAGTA; and GAPDH 3'GTGATGGCATGGACTGTGGTCAT.
Histological analysis
Tissues for histological analysis included staged mouse embryos or whole eyes from postnatal animals. Tissue samples were prepared and stained either with Hematoxylin and Eosin or only Hematoxylin using conventional methods (Culling et al., 1985). An assessment of cellular proliferation through S-phase labeling of cells with 5-bromo-2'-deoxyuridine (BrdU) was performed according to standard procedures (Takahashi et al., 1993).
Immunofluorescence
Staged embryos were fixed with 4% paraformaldehyde, cryoprotected in 30% sucrose and 20 µm frozen sections prepared. These were immunofluorescently labeled according to conventional methods (Harlow and Lane, 1988). The anti-Pax6 antibody is an affinity-purified rabbit polyclonal available from Covance (cat#PRB-278P) that was used at a 1:500 dilution in an overnight incubation at 4°C.
In situ hybridization
All embryos were washed in PBS and fixed in 4% paraformaldehyde at 4°C. Antisense RNA probes were labeled with digoxigenin during in vitro transcription and whole-mount in situ hybridization performed as described previously (Nieto et al., 1996). The probe regions comprised, for murine Foxe3, the entire intronless genomic clone on a ApaI-KpnI fragment of 1064 bp (Brownell et al., 2000) and for murine Sox2, a 1047 bp Xho-AccI fragment that encompasses most of the coding region (Wood and Episkopou, 1999).
Determining the rate and pattern of cell proliferation in the lens
The pattern of cell proliferation in normal and transgenic lenses at E13.5 was assessed by mapping BrdU-labeled cells onto a lens coordinate system adapted from previous analyses (McAvoy, 1978; Mikulicich and Young, 1963). Data were expressed as the proportion of total cells that were BrdU positive (the BrdU labeling index) in a given sector. Pregnant female mice were injected with BrdU at the appropriate stage of pregnancy, the mother euthanized 1 hour later and the embryos removed from the uterus by dissection. Heads from E13.5 embryos were fixed overnight in PBS-formalin (4%) and then processed for paraffin embedding. This quantitation was performed using sections that were within three sections either side of the lens center (defined by identifying the largest section) and counts from a minimum of four mice of each genotype pooled. Analysis on E10.5 embryos was performed in a similar way except that fixation was in 4% paraformaldehyde, counting was counting was restricted the lens pit and we used a secondary antibody that was conjugated with the Alexa594 fluorochrome (Molecular Probes) and Hoechst 33258 as a nuclear counterstain. The Students t-test was used to assess the significance of the data derived.
| Results |
|---|
|
|
|---|
In explant experiments, we used the inhibitor SU9597 to examine the requirement for Fgfr signaling. This is one member of a family of compounds that bind Fgfr kinases at the ATP-binding site and suppress their activity. SU9597 (Sun et al., 1999) is a more cell-permeant variant of the more commonly used SU5402 (Mohammadi et al., 1997). Others have previously shown that these compounds are effective in inhibiting Fgf receptor kinase activity in the 5-20 µM concentration range and that in this range, they have no effect on the epidermal growth factor receptor, insulin-like growth factor receptor and platelet-derived growth factor receptor kinases (Mohammadi et al., 1997). Both SU5402 and SU9597 have also been used previously to demonstrate Fgfr signaling requirements in developmental systems (Makarenkova et al., 2000; McCabe et al., 1999; Schneider et al., 1999).
In one set of experiments, E8.5 embryos were harvested from homozygous P6 5.0-lacz reporter mice, the heads bisected at the midline and explanted into collagen gel either with or without SU9597 at 10 µM. Explants were allowed to incubate for 8 hours until they reached the equivalent of approximately E9.0 and then they were fixed and stained with X-gal in whole mount so that lacZ reporter activity could be detected. Compared with control explants, SU9597-treated 8 hour explants had a consistently observed but only slightly reduced level of X-gal staining (compare Fig. 1A with 1B).
|
As evidence is emerging that at least two transcriptional enhancers regulate Pax6 expression in the lens placode (Dimanlig et al., 2001; Kleinjan et al., 2001) it was advantageous to assess Pax6 levels in the eye primordium using indirect immunofluorescence. So that we could objectively compare levels of immunoreactivity in control and inhibitor-treated explants, sections were processed and labeled in the same experiment, images acquired digitally under identical lighting conditions, and all figure panels adjusted en masse in the same digital image file. In the Figure panels shown (Fig. 1G-L) both green and yellow represent immunoreactivity for Pax6. The peak signal intensity was replaced with the color yellow and, as such, indicates the highest levels of Pax6.
While Pax6 immunoreactivity was readily detectable in the lens placode of control E8.5 explants cultured for 24 hours (Fig. 1G,H) explants treated with SU9597 showed a reduced level (Fig. 1I,J). Pax6 immunoreactivity was also consistently reduced in the optic vesicle (Fig. 1G-J, ov). In explants harvested at E9.5 and cultured for 24 hours, control explants generated a lens pit with thickened epithelium and strong Pax6 immunoreactivity (Fig. 1K). The presence of SU9597 consistently reduced the width of the lens pit, the thickness of the pit epithelium and suppressed the level of Pax6 immunoreactivity (Fig. 1L). Combined, these data provide evidence that Fgfr kinase activity is required for a normal level of Pax6 expression in the presumptive lens ectoderm, lens placode and lens pit. As Pax6 is known to be critical for lens development (Ashery-Padan et al., 2000; Fujiwara et al., 1994; Wawersik et al., 1999) we can suggest that Fgfr signaling activity is required for normal lens induction.
A truncated Fgf receptor expressed in the presumptive lens ectoderm perturbs early lens development
The described inhibitor experiments have the disadvantage that the inhibitor is active in all cells in the explant and as a result, we cannot determine whether Fgfr activity in the presumptive lens, presumptive retina or both, is required for Pax6 expression. To overcome this limitation, we adopted a second experimental strategy and generated transgenic mice in which a truncated, dominant-negative Fgfr1IIIc was expressed only in cells of the lens placode and lens pit.
To this end, we took advantage of the Pax6-derived lens enhancer (used in the P6 5.0-lacZ reporter mouse described above) that directs transgene expression to the presumptive lens ectoderm. Thus, we generated a transgene construct (Fig. 2A, designated Tfr) that combines the lens enhancer (Williams et al., 1998), the P0 promoter of the Pax6 gene (Xu et al., 1999) and the coding region of a truncated mouse Fgfr1IIIc (Bernard et al., 1991; Reid et al., 1990). SV40 sequences provide splicing and polyadenylation signals. Based on previous experimentation, this construct would be expected to be expressed in the presumptive lens ectoderm beginning at E8.75 (Williams et al., 1998) and to inhibit Fgfr-mediated signaling (Chow et al., 1995; Li et al., 1994; Peters et al., 1994; Robinson et al., 1995a).
|
A-crystallin gave the anticipated strong lens signal in a wild-type E10.5 embryo (Fig. 2B). An antisense probe to SV40 sequences present in the transgene mRNA gave a similar, albeit weaker, pattern of signal in a Tfr7 embryo at E10.5 (Fig. 2C). Importantly, there was no indication of hybridization signal in the retina. A lens-specific hybridization signal was also observed in the Tfr7 line at E11.5 (Fig. 2D) and in the Tfr3 line at E12.0 (Fig. 2E).
|
As initial analysis of hemizygous Tfr transgenic mice indicated only a mild phenotype, both lines were bred to homozygosity to increase the level of transgene expression. This resulted in a more severe and informative range of phenotypes in both line 3 and line 7 (see summary, Table 1). Because Tfr7 mice showed the most pronounced phenotype, this line has been emphasized. The observation that both lines showed similar changes (including reduced proliferation rates; see below) all but eliminated the possibility of transgene-mediated insertional mutagenesis. Clearly, lens defects can also be rationalized given the expression pattern of the transgene.
Transgenes driven by the Pax6 ectoderm enhancer and P0 promoter are first expressed in the surface ectoderm overlying the optic vesicle at E8.75 but show higher levels at E9.5 as the lens placode forms (Williams et al., 1998). Histological examination of the lens placode in E9.75 Tfr7/Tfr7 transgenic mice revealed a subtle but reproducible decrease in placode thickness and a delay in the initial stages of lens pit invagination (compare Fig. 3A, wild-type, with 3B, Tfr7/Tfr7). Similarly, at E10.5, Tfr7/Tfr7 mice show a lens pit that is reproducibly narrower than in wild-type mice (compare Fig. 3C with 3D). The narrow lens pit observed is a very similar change to that observed in wild-type eye explants exposed to the Fgfr inhibitor (Fig. 1I and J) and is consistent with a role for Fgfr activity in progression of the lens placode to the lens pit.
|
There was a degree of variability in the eye phenotypes observed both between and within the two transgenic lines. While the lens was clearly smaller in the Tfr3/Tfr3 mice, we did not observe a persistent lens stalk (Table 1). Tfr7/Tfr7 mice also showed phenotypic variability. Besides the typical changes described, in a few transgenic mice, the phenotype was more severe with an extremely small lens and ultimately, a degeneration of the lens and retina (data not shown). Despite this late degeneration response in a few mice, there was no indication of an increased level of programmed cell death in the early stages of lens development. An analysis of the expression pattern of the differentiation markers
-crystallin, ß-crystallin (McAvoy, 1978) and MIP26 (Bok et al., 1982) showed that the development of lens fiber cells is delayed in the Tfr7/Tfr7 mice (data not shown). In summary, the morphological analysis of Tfr7/Tfr7 mice indicates that the dominant-negative Fgfr has an effect on all stages of lens development. Important for this analysis however, is the observation that there is an effect on the earliest discernible stage of lens morphogenesis.
The truncated Fgfr suppresses proliferation in the lens pit and lens epithelium
In seeking an explanation for the small size of lenses in Tfr7/Tfr7 mice, we quantified the relative cell proliferation rate in controls and transgenics. We performed this analysis on the lens pit at E10.5 and on maturing lenses at E13.5 to determine whether an effect might be observed at multiple stages of lens development. For the assessment at E10.5 we labeled a series of sections (using indirect immunofluorescence; for example, Fig. 4A) from the central lens pit of wild-type and Tfr7/Tfr7 mice and counted total cells and BrdU-positive cells within defined boundaries (Fig. 4A, white lines). The proportion of labeled cells was calculated, a statistical analysis performed and the results presented graphically (Fig. 4B). This indicated that there was a significant reduction of the proliferative index in Tfr7/Tfr7 mice.
|
Fgf receptor and Bmp7 signaling cooperate in lens induction
Two models describing signaling events in early lens development suggest that Bmps participate (Dudley et al., 1995; Furuta and Hogan, 1998; Wawersik et al., 1999). In particular, analysis of null mice has indicated that the Bmp7 gene is required for lens induction at the placode stage and that Bmp7 signaling lies upstream of Pax6 expression in a genetic pathway (Wawersik et al., 1999). A role for Bmp7 in lens induction is consistent with the observation that it is expressed in the presumptive lens ectoderm at E9.0 and persists in the lens placode and lens pit until it is downregulated at E11.0 (Wawersik et al., 1999). With this, we could use a third strategy for determining whether Fgfr activity was involved in lens induction by determining whether there was a genetic interaction between Fgfr signaling (as defined by the Tfr7 transgene) and the established lens induction gene Bmp7 [defined by the null allele (Dudley et al., 1995)].
To this end, we crossed Bmp7 heterozygous null and Tfr7/Tfr7 mice through two generations to produce mice with informative genotypes. Mice were initially assessed at the day of birth. A comparison of wild-type (Fig. 5A) and Tfr7/Tfr7 lenses (Fig. 5B) indicated the expected small lens size in the transgenics. Bmp7/ animals have a full range of phenotypes ranging from microophthalmia and associated small lenses (Fig. 5C) to anophthalmia (Fig. 5D). By contrast, Bmp7 heterozygous mice have no discernible eye defects (Wawersik et al., 1999) (data not shown). Interestingly, mice that are Tfr7/Tfr7 and heterozygous for the Bmp7-null allele show a more severe phenotype (the two examples represent the typical (Fig. 5E) and mild (Fig. 5F) forms of the phenotype). This was apparent from several features of the Tfr7/Tfr7, Bmp7+/ eye, including small lens size and the lack of lens vesicle separation and closure (compare Fig. 5B with 5E,F). The lack of lens vesicle closure is indicated by the extrusion of
-crystallin immunoreactive material (data not shown) into the conjunctival sac (Fig. 5E,F, black arrows). In some Tfr7/Tfr7, Bmp7+/ lenses, there were also extrusions of lens material into the vitreous (Fig. 5F, black arrowheads). Also interesting was the observation that in those Tfr7/Tfr7, homozygous Bmp7 animals with eyes, lens formation was disproportionately affected when compared with other tissues. (Fig. 5G,H). This is illustrated by some lenses that were small, had ruptured capsules and were attached to the cornea (Fig. 5G), and others which were displaced and minute (Fig. 5G,H, arrowheads). By contrast, the retinae of Tfr7/Tfr7, Bmp7/ animals were not dramatically reduced in size and showed pseudostratification similar to that observed in wild-type mice. To assess the frequency with which different features arose in wild-type, Tfr7/Tfr7 and Tfr7/Tfr7, Bmp7+/ mice, we performed histological examination of groups of 10 mice of each genotype. This indicated that regardless of whether we examined lens size, lens vesicle separation, lens vesicle closure or capsule failure, the frequency of occurrence was higher in Tfr7/Tfr7, Bmp7+/ mice than in Tfr7/Tfr7 or wild type (Table 2). Together with histological observations, this quantitation provides evidence for a genetic interaction between the Bmp7 gene and the Tfr7 transgene. In turn, this implies that Fgfr and Bmp7 signaling cooperate at some stage of lens development.
|
|
|
Foxe3 and Sox2 lie downstream of Fgfr and Bmp7 signaling in lens induction pathways
In order to understand further how Fgfr and Bmp7 signaling might function in a genetic pathway controlling lens induction, we chose to examine expression of additional lens lineage marker genes in the eyes of Tfr7/Tfr7 and Tfr7/Tfr7, Bmp7+/ embryos.
The forkhead family transcription factor Foxe3 has been implicated in lens development by its expression pattern and by the phenotype of the mouse mutant dysgenetic lens (dyl) (Blixt et al., 2000; Brownell et al., 2000). In this mouse, there is a failure of lens vesicle separation, inhibition and proliferation, and development of a dysplastic, cataractous lens (Blixt et al., 2000; Brahma and Sanyal, 1984; Brownell et al., 2000; Sanyal and Hawkins, 1979). As this phenotype was very similar to that observed in the Tfr7/Tfr7 mice, we decided to determine whether the expression of Foxe3 was affected. This analysis was performed on E10.5 embryos when the lens pit has just formed. As expected, Foxe3 mRNA was detected in the lens pit of wild-type animals (Fig. 6I). In Tfr7/Tfr7, the Foxe3 mRNA appeared at slightly reduced levels (Fig. 6J) while, in contrast, the Tfr7/Tfr7, Bmp7+/ mice reproducibly showed a distinct down-regulation (Fig. 6K). This indicated that both Fgfr and Bmp7 signaling are required for a full level of Foxe3 expression that Foxe3 can be placed downstream of both in a genetic pathway.
The transcription factor Sox2 has also been implicated in lens development through regulation of crystallin genes (Kamachi et al., 1995; Kamachi et al., 2001). The Sox2 gene has been used as a marker of lens induction in experiments examining the requirement for Bmp4 and Pax6 (Ashery-Padan et al., 2000; Fujiwara et al., 1994). To determine whether cooperative Bmp7 and Fgfr signaling might function upstream of Sox2 expression, we performed whole-mount in situ hybridization with an antisense Sox2 probe on E10.5 wild-type, Tfr7/Tfr7, and Tfr7/Tfr7, Bmp7+/ embryos; thick sections permitted the examination of Sox2 expression in the lens pit. Wild-type mice showed the expected pattern of Sox2 signal in the lens pit and the presumptive retina (Fig. 6L, arrowheads and pr, respectively). Tfr7/Tfr7 mice did not show any detectable Sox2 signal in the lens pit (Fig. 6M, arrowheads) and also appeared to have a modified pattern or level of Sox2 expression in the presumptive retina (Fig. 6N, pr). Similarly, Tfr7/Tfr7, Bmp7+/ mice showed no detectable Sox2 expression in the lens pit and a modified level in the presumptive retina. These analyses indicate that combined Fgfr and Bmp7 signaling function upstream of Pax6, Foxe3 and Sox2 in a genetic pathway for lens development.
| DISCUSSION |
|---|
|
|
|---|
Fgf signaling plays a role in lens induction
Previous analysis has defined lens induction at multiple levels. Morphologically, the first indication of lens development (at E9.0-9.5 in the mouse) is the formation of the thickened lens placode in surface ectoderm that overlies the optic vesicle. At E9.5-10.5, the lens placode invaginates in coordination with the lens vesicle and forms the lens pit. At the molecular level, expression of a number of marker genes has defined lens induction. Among these, Pax6 is probably best characterized; it is upregulated in the lens placode beginning at E8.75 and based on both tissue recombination (Fujiwara et al., 1994) and conditional mutation experiments (Ashery-Padan et al., 2000) is necessary for lens development. Misexpression of Pax6 in Xenopus laevis embryos has shown that in this context, Pax6 is also sufficient for lens development (Altmann et al., 1997; Chow et al., 1999). Finally, Bmp7-null mice show a variably penetrant absence of lens development that correlates with the loss of Pax6 expression in the lens placode (Wawersik et al., 1999). When combined, these data provide a strong argument that Pax6 expression in the lens placode defines lens induction. Similarly, it has been argued that increased expression of Sox2 in the early eye is an excellent marker of lens induction; this is based on analysis of both the Bmp4 (Furuta and Hogan, 1998) and Bmp7 (Wawersik et al., 1999) null mice where lens development does not occur and Sox2 expression is not upregulated.
With this, the analysis we have performed makes a strong case for involvement of Fgfr signaling in lens induction. Treatment of eye primordium explants with the Fgfr kinase inhibitor SU9597 downregulates Pax6 expression in the lens placode according to both a Pax6 gene-based reporter construct and immunofluorescent detection of the gene product. This response can be observed at both E9.5 and E10.5 and in the latter case, morphological changes to lens development (formation of a narrow lens pit) are also observed. While the use of small molecule Fgfr inhibitors has proven valuable for characterization of many developmental systems (Makarenkova et al., 2000; McCabe et al., 1999; Schneider et al., 1999) the strategy suffers from the limitation that all cells in an explant are subject to inhibitor effects and as a result, it cannot be determined whether the downregulation of Pax6 expression in the lens placode is an autonomous response of placodal cells or an indirect consequence of the lack of Fgfr activity in the adjacent optic vesicle.
To overcome this limitation, we adopted a second experimental strategy and expressed a truncated, dominant-negative Fgfr1IIIc in the presumptive lens ectoderm. This technique has been employed widely to examine the function of Fgfr signaling in development and has the advantage that, depending upon the spectrum of Fgf ligands represented, a dominant negative mutant receptor may have inhibition activity against all the Fgf receptor isoforms. Thus, with this approach, we can effectively answer a question about the requirement for Fgf receptor signaling even in a system that may involve multiple ligands and multiple receptors and as a consequence, may be refractory to analysis using induced mutations. In these experiments, a truncated mutant of Fgfr1IIIc (Li et al., 1994; Reid et al., 1990) was expressed in the lens lineage beginning at E8.75 using an enhancer from the Pax6 gene (Williams et al., 1998). Two lines of transgenic mice were generated, both of which were used as homozygotes in order to increase transgene expression levels and enhance the phenotypic consequences. The demonstration that both lines of transgenic mice had the same defect in suppression of lens size and lens epithelial cell proliferation indicated that the phenotype observed was not a consequence of insertional mutagenesis. Finally, the confirmation that Tfr7 transgene expression is restricted to lens lineage cells also indicates that cells of the lens placode and lens pit normally respond directly to Fgfr signaling during early lens development.
The morphological and molecular phenotype of the Tfr7/Trf7 transgenic mice provides a strong argument for Fgfr signaling involvement in lens induction. First, we observe distinct morphological defects in lens development from the earliest stages. In particular, there is a delay in formation of the lens placode and its invagination to form the lens pit. At E9.75, The lens placode is thinner than normal, forms a narrow lens pit at E10.5, and throughout embryogenesis the lens of Tfr7/Tfr7 transgenics is smaller than in wild-type mice. Second and more compelling is the observation that the Tfr7/Tfr7 transgenic mice have reduced levels of expression of several genes that are either markers of, or are functionally involved in, lens development. Pax6 expression is distinctly downregulated in the presumptive lens ectoderm of Tfr7/Tfr7 transgenic mice at E9.5 and, importantly, this change is observed before any sign of a morphological defect. A downregulation of Pax6 levels is also observed at E10.5 when the lens pit has formed. The observation that the Tfr7/Tfr7 mice develop Peters anomaly is consistent with downregulation of Pax6 in the lens lineage as this phenotype is often associated with Pax6 heterozygosity (Hanson et al., 1994). So too, expression of Sox2 is diminished in the lens pit of Tfr7/Tfr7 transgenic mice. As previous definitions of lens induction have used Pax6 and Sox2 expression in the lens lineage as key markers (Ashery-Padan et al., 2000; Furuta and Hogan, 1998; Wawersik et al., 1999) the current analysis, showing that Sox2 and Pax6 expression are reduced when Fgfr signaling is inhibited, indicates a role for Fgfr signaling in lens induction.
As a third strategy for determining whether Fgfr signaling was involved in lens induction, we determined whether there was a genetic interaction between the Tfr7 transgene and the Bmp7 null allele. This analysis showed that Tfr7/Tfr7, Bmp7+/ mice have an exacerbated lens phenotype compared with either Bmp7+/ mice or Tfr7/Tfr7 mice. At the morphological level, Tfr7/Tfr7, Bmp7+/ mice have a smaller lens and more frequent lens vesicle closure and separation defects than either Tfr7/Tfr7 or wild-type mice. This observation is particularly striking given previous analysis showing that Bmp7 heterozygous mice have no detectable defects (Dudley et al., 1995; Wawersik et al., 1999). Furthermore, we show that the most severe lens defects arise in animals that are homozygous for both Bmp7 and Tfr7. This assessment is complicated by the fact that some Bmp7 homozygous null mice have no eyes, but in those Bmp7/, Tfr7/Tfr7 that do, the consequences for lens development is disproportionate; the retina is near normal in size and morphology while lenses are highly disrupted and very small. From a genetic standpoint, these observations argue that Bmp7 and Fgfr signaling cooperate in an early lens development pathway.
To enhance our understanding of how Fgfr and Bmp7 signaling cooperate, we examined the expression of lens lineage marker genes during induction phases of lens development. This was performed on embryos of wild-type, Tfr7/Tfr7 and Tfr7/Tfr7, Bmp7+/ genotypes using the markers Pax6, Foxe3 and Sox2 (Furuta and Hogan, 1998; Wawersik et al., 1999). We examined Pax6 immunoreactivity in the lens placode at E9.5 and the lens pit at E10.5 and showed that the lowest levels could be observed in embryos with the Bmp7/, Tfr7/Tfr7 genotype. Similarly, at E10.5, Foxe3 expression levels were reduced progressively in the lens pits of Tfr7/Tfr7 and Tfr7/Tfr7, Bmp7+/ embryos. Combined, these data indicate that the placodal phases of Pax6 and Foxe3 expression require both Bmp7 and Fgfr signaling. Interestingly, Sox2 expression was undetectable in Tfr7/Tfr7 embryos and remained so in Tfr7/Tfr7, Bmp7+/ embryos. As it has also been shown that Sox2 expression is lost in the Bmp7 null lens pit (Wawersik et al., 1999) this might imply that either signaling pathway is necessary for Sox2 expression. This interpretation must be applied cautiously, however, as in both this and previous analysis (Wawersik et al., 1999) there may be a limit on Sox2 transcript detection sensitivity given the techniques employed. Regardless of this, this analysis indicates that Sox2 expression in the lens lineage is dependent on both Bmp7 and Fgfr signaling. Because Bmp7 is an established lens inducer, the interaction between the Bmp7 null allele and the Tfr7 transgene indicates that Fgfr signaling is also involved in lens induction. A future challenge will be to identify the ligands for Fgfrs that regulate early lens development. Good candidates are Fgf8 (Lovicu and Overbeek, 1998; Vogel-Hopker et al., 2000) and Fgf15 (McWhirter et al., 1997) as they are both expressed with a timing that might imply an early role.
A genetic pathway defining lens induction
These experiments define the relationship between several elements of a genetic pathway for lens induction (Fig. 7). Two phases of Pax6 expression in the lens lineage have been defined previously (Grindley et al., 1995). Pax6 is expressed in the pre-placodal head ectoderm (Wawersik et al., 1999) (defined here as Pax6preplacode) but also later in the lens placode (defined as Pax6placode). The placodal phase of Pax6 expression is dependent on the activity of Pax6 in the earlier phase (Grindley et al., 1995). The first novel feature of the pathway described is the requirement for Fgfr signaling for Pax6placode (this relationship could help explain why there is a mild phenotype in the Tfr7/Tfr7 transgenic mice as expression of the dominant-negative Fgfr1 will impose a feedback suppression on the transgene). Furthermore, the model suggests that Pax6preplacode, Bmp7 and Fgfr signaling act in concert to permit the full level of expression of Pax6placode (Fig. 7). This model is also consistent with previous analysis of the Bmp7-null mice that indicates Bmp7 is upstream of Pax6placode (Wawersik et al., 1999).
|
Sox2 is an sry-related HMG family transcription factor that has been implicated in the regulation of lens crystallins (Kamachi et al., 1995; Kamachi et al., 2001) and has been used as a marker to define the process of lens induction (Furuta and Hogan, 1998; Kamachi et al., 1998; Wawersik et al., 1999). It is normally upregulated in both the presumptive lens ectoderm and the optic vesicle at E9.5 when the lens placode thickens (Furuta and Hogan, 1998). Sox2 expression is not upregulated in small eye or Bmp7-null mice and this has suggested that Sox2 lies downstream of both Pax6 and Bmp7 (Furuta and Hogan, 1998; Wawersik et al., 1999). In the current analysis, we show that in both Tfr7/Tfr7, and Tfr7/Tfr7, Bmp7+/ embryos, Sox2 expression in the lens pit is undectectable. This suggests that Sox2 also lies downstream of Fgfr signaling in a lens induction pathway (Fig. 7). A weakness in the current model is our lack of understanding about the relationship between Sox2 and remaining pathway elements. This uncertainty could be resolved by determining whether Sox2 expression is perturbed in the dyl mouse and, as Bmp4 lies between Pax6 and Sox2 in a lens development pathway (Furuta and Hogan, 1998), whether Foxe3 expression is affected in the Bmp4 null. Inclusion of the sFRP2 marker (Wawersik et al., 1999) in our analysis will also help define distinct stages of lens development.
A future challenge will be to understand which cell-cell interactions are mediated by Fgfr and Bmp7 signaling. It is possible, for example, that placodal Fgf or Bmp7 could initiate an exchange of signals between presumptive lens and retina that is required for placodal Pax6 expression. Some evidence for this comes the observation that when Fgfr or Bmp7 activity is inhibited in the lens placode, Pax6 and Sox2 expression is reduced in the presumptive retina (Fig. 6) (Wawersik et al., 1999). Alternatively, Bmp7 may act in a paracrine or autocrine manner within the placode. The genetic pathway we have described here will form a basis for defining the process of lens induction in molecular detail.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Altmann, C. R., Chow, R. L., Lang, R. A. and Hemmati-Brivanlou, A. (1997). Lens induction by Pax-6 in Xenopus laevis. Dev. Biol. 185, 119-123.[Medline]
Ashery-Padan, R., Marquardt, T., Zhou, X. and Gruss, P. (2000). Pax6 activity in the lens primordium is required for lens formation and for correct placement of a single retina in the eye. Genes Dev. 14, 2701-2711.
Bernard, O., Li, M. and Reid, H. (1991). Expression of two different forms of fibroblast growth factor receptor 1 in different mouse tissues and cell lines. Proc. Natl. Acad. Sci. USA 88, 7625-7629.
Blixt, A., Mahlapuu, M., Aitola, M., Pelto-Huikko, M., Enerback, S. and Carlsson, P. (2000). A forkhead gene, FoxE3, is essential for lens epithelial proliferation and closure of the lens vesicle. Genes Dev. 14, 245-254.
Bok, D., Dockstader, J. and Horwitz, J. (1982). Immunocytochemical localization of the lens main intrinsic polypeptide (MIP26) in communicating junctions. J. Cell Biol. 92, 213-220.
Brahma, S. K. and Sanyal, S. (1984). Immunohistochemical studies of lens crystallins in the dysgenetic lens (dyl) mutant mice. Exp. Eye Res. 38, 305-311.[Medline]
Brownell, I., Dirksen, M. and Jamrich, M. (2000). Forkhead Foxe3 maps to the dysgenetic lens locus and is critical in lens development and differentiation. Genesis 27, 81-93.[Medline]
Chamberlain, C. G. and McAvoy, J. W. (1987). Evidence that fibroblast growth factor promotes lens fibre differentiation. Curr. Eye Res. 6, 1165-1169.[Medline]
Chamberlain, C. G. and McAvoy, J. W. (1989). Induction of lens fiber differentiation by acidic and basic fibroblast growth factor (FGF). Growth Factors 1, 125-134.[Medline]
Chow, R. L., Altmann, C. R., Lang, R. A. and Hemmati-Brivanlou, A. (1999). Pax6 induces ectopic eyes in a vertebrate. Development 126, 4213-4222.[Abstract]
Chow, R. L., Roux, G. D., Roghani, M., Palmer, M. A., Rifkin, D. B., Moscatelli, D. A. and Lang, R. A. (1995). FGF suppresses apoptosis and induces differentiation of fibre cells in the mouse lens. Development 121, 4383-4393.[Abstract]
Culling, C. F. A., Allison, R. T. and Barr, W. T. (1985). Cellular Pathology Technique. London: Butterworth & Co. Ltd.
de Iongh, R. U., Lovicu, F. J., Chamberlain, C. G. and McAvoy, J. W. (1997). Differential expression of fibroblast growth factor receptors during rat lens morphogenesis and growth. Invest. Ophthalmol. Vis. Sci. 38, 1688-1699.
de Iongh, R. U., Lovicu, F. J., Hanneken, A., Baird, A. and McAvoy, J. W. (1996). FGF receptor-1 (flg) expression is correlated with fibre differentiation during rat lens morphogenesis and growth. Dev. Dyn. 206, 412-426.[Medline]
Dimanlig, P. V., Faber, S. C., Auerbach, W., Makarenkova, H. P. and Lang, R. A. (2001). The upstream ectoderm enhancer in Pax6 has an important role in lens induction. Development 128, 4415-4424.
Doherty, P. and Walsh, F. S. (1996). CAM-FGF receptor interactions: a model for axonal growth. Mol. Cell. Neurosci. 8, 99-111.[Medline]
Dudley, A. T., Lyons, K. M. and Robertson, E. J. (1995). A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye. Genes Dev. 9, 2795-2807.
Fujiwara, M., Uchida, T., Osumi-Yamashita, N. and Eto, K. (1994). Uchida rat (rSey): a new mutant rat with craniofacial abnormalities resembling those of the mouse Sey mutant. Differentiation 57, 31-38.[Medline]
Furuta, Y. and Hogan, B. L. M. (1998). BMP4 is essential for lens induction in the mouse embryo. Genes Dev. 12, 3764-3775.
Govindarajan, V. and Overbeek, P. A. (2001). Secreted FGFR3, but not FGFR1, inhibits lens fiber differentiation. Development 128, 1617-1627.[Abstract]
Grindley, J. C., Davidson, D. R. and Hill, R. E. (1995). The role of Pax-6 in eye and nasal development. Development 121, 1433-1442.[Abstract]
Halder, G., Callaerts, P. and Gehring, W. J. (1995). Induction of ectopic eyes by targeted expression of the eyeless gene in Drosophila. Science 267, 1788-1792.
Hanson, I. M., Fletcher, J. M., Jordan, T., Brown, A., Taylor, D., Adams, R. J., Punnett, H. H. and van Heyningen, V. (1994). Mutations at the PAX6 locus are found in heterogeneous anterior segment malformations including Peters anomaly. Nat. Genet. 6, 168-173.[Medline]
Harlow, E. and Lane, D. (1988). Antibodies: A Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory.
Hill, R. E., Favor, J., Hogan, B. L., Ton, C. C., Saunders, G. F., Hanson, I. M., Prosser, J., Jordan, T., Hastie, N. D. and van Heyningen, V. (1991). Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature 354, 522-525.[Medline]
Hogan, B., Costantini, F. and Lacy, E. (1986). Manipulating the Mouse Embryo: A Laboratory Manual. NY: Cold Spring Harbor Laboratory Press.
Kamachi, Y., Sockanathan, S., Liu, Q., Breitman, M., Lovell-Badge, R. and Kondoh, H. (1995). Involvement of SOX proteins in lens-specific activation of crystallin genes. EMBO J. 14, 3510-3519.[Medline]
Kamachi, Y., Uchikawa, M., Collignon, J., Lovell-Badge, R. and Kondoh, H. (1998). Involvement of Sox1, 2 and 3 in the early and subsequent molecular events of lens induction. Development 125, 2521-2532.[Abstract]
Kamachi, Y., Uchikawa, M., Tanouchi, A., Sekido, R. and Kondoh, H. (2001). Pax6 and SOX2 form a co-DNA-binding partner complex that regulates initiation of lens development. Genes Dev. 15, 1272-1286.
Kammandel, B., Chowdhury, K., Stoykova, A., Aparicio, S., Brenner, S. and Gruss, P. (1999). Distinct cis-essential modules direct the time-space pattern of the Pax6 gene activity. Dev. Biol. 205, 79-97.[Medline]
Kleinjan, D. A., Seawright, A., Schedl, A., Quinlan, R. A., Danes, S. and van Heyningen, V. (2001). Aniridia-associated translocations, DNase hypersensitivity, sequence comparison, and transgenic analysis redefine the functional domain of PAX6. Hum. Mol. Genet. (in press).
Li, Y., Basilico, C. and Mansukhani, A. (1994). Cell transformation by fibroblast growth factors can be suppressed by truncated fibroblast growth factor receptors. Mol. Cell. Biol. 14, 7660-7669.
Lovicu, F. J. and Overbeek, P. A. (1998). Overlapping effects of different members of the FGF family on lens fiber differentiation in transgenic mice. Development 125, 3365-3377.[Abstract]
Makarenkova, H. P., Ito, M., Venkatesh, G., Faber, S. C., Sun, L., McMahon, G., Overbeek, P. A. and Lang, R. A. (2000). FGF10 is an inducer and Pax6 a competence factor for lacrimal gland development. Development 127, 2563-2572.[Abstract]
Massague, J. (1998). TGF-beta signal transduction. Annu. Rev. Biochem. 67, 753-791.[Medline]
McAvoy, J. W. (1978). Cell division, cell elongation and distribution of alpha-, beta- and gamma-crystallins in the rat lens. J. Embryol. Exp. Morpol. 44, 149-165.
McCabe, K. L., Gunther, E. C. and Reh, T. A. (1999). The development of the pattern of retinal ganglion cells in the chick retina: mechanisms that control differentiation. Development 126, 5713-5724.[Abstract]
McWhirter, J. R., Goulding, M., Weiner, J. A., Chun, J. and Murre, C. (1997). A novel fibroblast growth factor gene expressed in the developing nervous system is a downstream target of the chimeric homeodomain oncoprotein E2A-Pbx1. Development 124, 3221-3232.[Abstract]
Mencl, E. (1903). Ein fall von beiderseitiger augenlinsenausbildung wahrend der abwesenheit von augenblasen. Arch. EntwMech. Org. 16, 328-339.
Mikulicich, A. G. and Young, R. W. (1963). Cell proliferation and displacement in the lens epithelium of young rats injected with tritiated thymidine. Invest. Ophthalmol. 2, 344-354.
Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh, B. K., Hubbard, S. R. and Schlessinger, J. (1997). Structures of the tyrosine kinase domain of fibroblast growth factor receptor in complex with inhibitors. Science 276, 955-960.
Nieto, M. A., Patel, K. and Wilkinson, D. G. (1996). In situ hybridization analysis of chick embryos in whole mount and tissue sections. Methods Cell Biol. 51, 219-235.[Medline]
Peters, K., Werner, S., Liao, X., Wert, S., Whitsett, J. and Williams, L. (1994). Targeted expression of a dominant negative FGF receptor blocks branching morphogenesis and epithelial differentiation of the mouse lung. EMBO J. 13, 3296-3301.[Medline]
Reid, H. H., Wilks, A. F. and Bernard, O. (1990). Two forms of the basic fibroblast growth factor receptor-like mRNA are expressed in the developing mouse brain. Proc. Natl. Acad. Sci. USA 87, 1596-1600.
Robinson, M. L., MacMillan-Crow, L. A., Thompson, J. A. and Overbeek, P. A. (1995a). Expression of a truncated FGF receptor results in defective lens development in transgenic mice. Development 121, 3959-3967.[Abstract]
Robinson, M. L., Overbeek, P. A., Verran, D. J., Grizzle, W. E., Stockard, C. R., Friesel, R., Maciag, T. and Thompson, J. A. (1995b). Extracellular FGF-1 acts as a lens differentiation factor in transgenic mice. Development 121, 505-514.[Abstract]
Sanyal, S. and Hawkins, R. K. (1979). Dysgenetic lens (dyl)a new gene in the mouse. Invest. Ophthalmol. Vis. Sci. 18, 642-645.
Schneider, A., Mijalski, T., Schlange, T., Dai, W., Overbeek, P., Arnold, H. H. and Brand, T. (1999). The homeobox gene NKX3.2 is a target of left-right signalling and is expressed on opposite sides in chick and mouse embryos. Curr. Biol. 9, 911-914.[Medline]
Shannon, J. M., Gebb, S. A. and Nielsen, L. D. (1999). Induction of alveolar type II cell differentiation in embryonic tracheal epithelium in mesenchyme-free culture. Development 126, 1675-1688.[Abstract]
Song, D. L., Chalepakis, G., Gruss, P. and Joyner, A. L. (1996). Two Pax-binding sites are required for early embryonic brain expression of an Engrailed-2 transgene. Development 122, 627-635.[Abstract]
Spemann, H. (1901). Uber Correlationen in der Entwickelung des Auges. Verh Anat Ges 15, 61-79.
Stewart, H. J., Zoidl, G., Rossner, M., Brennan, A., Zoidl, C., Nave, K. A., Mirsky, R. and Jessen, K. R. (1997). Helix-loop-helix proteins in Schwann cells: a study of regulation and subcellular localization of Ids, REB, and E12/47 during embryonic and postnatal development. J. Neurosci. Res. 50, 684-701.[Medline]
Sun, L., Tran, N., Tang, T., App, H., Hirth, P., McMahon, G. and Tang, C. (1999). 3-[(substituted pyrrol-2yl)methylindenyl]indolin-2-ones that block receptor tyrosine kinases. J. Med. Chem. (in press).
Takahashi, T., Nowakowski, R. S. and Caviness, V. S. (1993). Cell cycle parameters and and patterns of nuclear movement in the neocortical proliferative zone of the fetal mouse. J. Neurosci. 13, 820-833.[Abstract]
Taketo, M., Schroeder, A. C., Mobraaten, L. E., Gunning, K. B., Hanten, G., Fox, R. R., Roderick, T. H., Stewart, C. L., Lilly, F., Hansen, C. T. et al. (1991). An inbred mouse strain preferable for transgenic analyses. Proc. Natl. Acad. Sci. USA 88, 2065-2069.
Vogel-Hopker, A., Momose, T., Rohrer, H., Yasuda, K., Ishihara, L. and Rapaport, D. H. (2000). Multiple functions of fibroblast growth factor-8 (FGF-8) in chick eye development. Mech. Dev. 94, 25-36.[Medline]
Wawersik, S., Purcell, P., Rauchman, M., Dudley, A. T., Robertson, E. J. and Maas, R. (1999). BMP7 Acts in Murine Lens Placode Development. Dev. Biol. 207, 176-188.[Medline]
Williams, S. C., Altmann, C. R., Chow, R. L., Hemmati-Brivanlou, A. and Lang, R. A. (1998). A highly conserved lens transcriptional control element from the Pax-6 gene. Mech. Dev. 73, 225-229.[Medline]
Wood, H. B. and Episkopou, V. (1999). Comparative expression of the mouse Sox1, Sox2 and Sox3 genes from pre-gastrulation to early somite stages. Mech. Dev. 86, 197-201.[Medline]
Xu, P. X., Zhang, X., Heaney, S., Yoon, A., Michelson, A. M. and Maas, R. L. (1999). Regulation of Pax6 expression is conserved between mice and flies. Development 126, 383-395.[Abstract]
This article has been cited by other articles:
![]() |
S. Yun, Y. Saijoh, K. E. Hirokawa, D. Kopinke, L. C. Murtaugh, E. S. Monuki, and E. M. Levine Lhx2 links the intrinsic and extrinsic factors that control optic cup formation Development, December 1, 2009; 136(23): 3895 - 3906. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Chauhan, A. Disanza, S.-Y. Choi, S. C. Faber, M. Lou, H. E. Beggs, G. Scita, Y. Zheng, and R. A. Lang Cdc42- and IRSp53-dependent contractile filopodia tether presumptive lens and retina to coordinate epithelial invagination Development, November 1, 2009; 136(21): 3657 - 3667. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Martinez, M. Wijesinghe, K. Turner, H. E. Abud, M. M. Taketo, T. Noda, M. L. Robinson, and R. U. de Iongh Conditional Mutations of {beta}-Catenin and APC Reveal Roles for Canonical Wnt Signaling in Lens Differentiation Invest. Ophthalmol. Vis. Sci., October 1, 2009; 50(10): 4794 - 4806. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rajagopal, L. K. Dattilo, V. Kaartinen, C.-X. Deng, L. Umans, A. Zwijsen, A. B. Roberts, E. P. Bottinger, and D. C. Beebe Functions of the Type 1 BMP Receptor Acvr1 (Alk2) in Lens Development: Cell Proliferation, Terminal Differentiation, and Survival Invest. Ophthalmol. Vis. Sci., November 1, 2008; 49(11): 4953 - 4960. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Belecky-Adams, R. Adler, and D. C. Beebe Bone morphogenetic protein signaling and the initiation of lens fiber cell differentiation Development, March 10, 2003; 129(16): 3795 - 3802. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-X. Huang, M. Feldmeier, Y.-B. Shui, and D. C. Beebe Evaluation of Fibroblast Growth Factor Signaling during Lens Fiber Cell Differentiation Invest. Ophthalmol. Vis. Sci., February 1, 2003; 44(2): 680 - 690. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, A. Friedman, S. Heaney, P. Purcell, and R. L. Maas Meis homeoproteins directly regulate Pax6 during vertebrate lens morphogenesis Genes & Dev., August 15, 2002; 16(16): 2097 - 2107. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Faber, M. L. Robinson, H. P. Makarenkova, and R. A. Lang Bmp signaling is required for development of primary lens fiber cells Development, August 1, 2002; 129(15): 3727 - 3737. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. van Heyningen and K. A. Williamson PAX6 in sensory development Hum. Mol. Genet., May 15, 2002; 11(10): 1161 - 1167. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. V. Dimanlig, S. C. Faber, W. Auerbach, H. P. Makarenkova, and R. A. Lang The upstream ectoderm enhancer in Pax6 has an important role in lens induction Development, November 15, 2001; 128(22): 4415 - 4424. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||