|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||

1 Whitehead Institute, 9 Cambridge Center, Cambridge, MA 02142, USA
2 Division of Hematology/Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02115, USA
* These authors contributed equally to this work
Author for correspondence (e-mail: daley{at}wi.mit.edu)
Accepted August 14, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Embryonic stem cells, Hematopoiesis, Adult reconstitution, BCR/ABL
| INTRODUCTION |
|---|
|
|
|---|
The clonal analyses that proved the existence of the bone marrow-derived HSC involved lineage marking by unique radiation-induced karyotypes (Wu et al., 1968) or retroviral integration sites (Dick et al., 1985; Keller et al., 1987; Lemischka et al., 1986) followed by engraftment in irradiated adult mice. In humans, the first direct evidence for the hematopoietic stem cell was the presence of a unique chromosomal rearrangement, the Philadelphia chromosome, in lymphoid and myeloid cells of individuals with the disease chronic myeloid leukemia (CML) (Fialkow et al., 1977). Subsequent studies have shown that retroviral transduction into murine bone marrow of BCR/ABL, the oncoprotein encoded by the Philadelphia chromosome, transforms the hematopoietic stem cell and generates a CML-like myeloproliferative disorder in transplanted mice that manifests clonal repopulation of lymphoid and myeloid lineages (Daley et al., 1990; Li et al., 1999). The CML-associated BCR/ABL oncogene endows the adult HSC with clonal dominance while allowing lymphoid and myeloid differentiation. BCR/ABL augments the proportions of myeloid populations derived from infected HSCs, but does not alter the fundamental potential of the HSC to differentiate along lymphoid, myeloid or erythroid lineages. To date, clonal analysis of embryoid body hematopoietic progenitors has been precluded by the rarity of these progenitors and their inefficiency in engraftment of adults (Medvinsky and Dzierzak, 1996; Müller et al., 1994). Thus, we have used BCR/ABL as a tool to enable engraftment and clonal analysis of hematopoietic precursors from EBs. Our data demonstrate that a common progenitor of the primitive erythroid and definitive lymphoid-myeloid hematopoietic programs arises during the differentiation of ES cells into EBs in vitro.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Retroviral infection of EB-derived cells and co-culture on OP9 stroma
MSCV-BCR/ABLiresGFP and MSCViresGFP (control vector) retroviruses were transfected into 293T cells using the Ca2+ phosphate precipitation method (Grignani et al., 1998). Virus-containing supernatant was collected 48 hours after transfection and filtered through a 0.45 µm filter before use. During the EB growth period, OP9 stromal cells (generously provided by Dr Toru Nakano) were expanded in MEM
(Sigma) supplemented with 20% FCS and plated in six-well dishes 1 day before harvesting EBs. EBs were collected at 5 days post differentiation, washed in PBS and treated with 0.25% collagenase (Sigma) for 60 minutes at 37°C. EBs were disrupted to single cells by repeated passage through a 23 G needle. Approximately 3x105 cells were suspended in 10 ml of viral supernatant containing 5 ng/ml mouse IL3 (interleukin 3; Peprotech), 500 ng/ml human IL6 (interleukin 6; Peprotech), 500 ng/ml human SCF (stem cell factor; Peprotech), 50 µM ß-mercaptoethanol and 4 µg/ml polybrene (Sigma). Cells were transferred to six well dishes (Corning) pre-plated with semi-confluent OP9 stromal cells and centrifuged at 1300 g for 90 minutes on a Beckman centrifuge (GH-3.8 rotor). After an overnight incubation at 37°C with 5% CO2 in air, suspension cells were removed, centrifuged, suspended in fresh viral supernatant and replated onto the same OP9 stromal cells. Suspension cells were removed 18 hours post second infection, centrifuged, suspended in IMDM, 10% FCS, 50 ng/ml human IL6, 0.5 ng/ml mouse IL3, 50 ng/ml human SCF, 50 µM ß-mercaptoethanol and replated onto the same OP9 cells.
Culture of infected cells
After 8 days, the non-adherent cells were harvested, plated in methylcellulose medium (MCM) for primitive blast (media containing 5 ng/ml of vascular endothelial growth factor VEGF, 100 ng/ml of SCF and 25% of conditioned medium from the D4T cell line) (Kennedy et al., 1997), myeloid (3434; StemCell) and cytokine-independent colonies (MCM without growth factors; 3231; StemCell). Cells were also expanded in the absence of OP9 cells, vigorously growing cultures were passaged to new dishes as necessary to maintain appropriate cell densities. Clones were generated by plating cells in blast MCM (as described above). Five days later, individual primitive blast colonies were transferred to microtiter wells containing IMDM with human IL6, mouse IL3, human SCF and human FL (FLT3 ligand; Peprotech). Rapidly growing populations were passaged to larger cultures as required.
Reconstitution of irradiated recipient mice
Cells were injected intravenously (4x106 cells in 0.4 ml PBS) into 4 to 8 week old 129Sv/Ev (Taconic) or NOD/SCID (Jackson) mice, preconditioned with sublethal irradiation (500 and 350 rads, respectively). Mice were monitored daily for symptoms, including reduced body temperature, decreased activity and hunched posture. Peripheral blood was collected by retro-orbital venous sinus sampling. Moribund animals were sacrificed and analyzed by necropsy. Leukocytes were purified using red blood cell lysis buffer (Sigma). Spleens were dissected, weighed and minced to prepare single-cell suspensions. Femur and tibia were dissected and bone marrow cells were harvested in PBS 1% FCS by flushing with a 25 or 27 gauge syringe.
Fluorescent-activated cell sorting (FACS) analysis
We used R-phycoerythrin (PE)-conjugated antibodies to AA4 (provided by Dr Ihor Lemischka), Sca1, Kit, CD45, Thy1, Ter119, B220, CD4, CD8, CD19, Gr1, Mac1 and Flk1, and biotinylated antibodies to CD34 (Pharmingen). Cells were washed once in blocking buffer (PBS 1% FBS), suspended at 107 cells/ml in the same buffer containing 0.25 µg/106 cells of Fc block (Pharmingen) and placed on ice for 5 minutes. Antibody was added at 1 µg/106 cells and incubated at 4°C for 30 minutes before washing with blocking buffer. Biotinylated antibody (CD34) was then counterstained with PE-conjugated streptavidin for 30 minutes at 4°C, followed by washing with blocking buffer. Stained cells were analyzed on a FACScan cytometer (Becton-Dickinson) after addition of propidium iodide (Pharmingen) to exclude dead cells.
RT-PCR for globin analysis
Globin expression patterns in the cell lines and peripheral blood from reconstituted mice were determined using the global amplification strategy of Brady et al. (Brady et al., 1990). Total RNA was isolated using RNA STAT-60 reagent (Tel-Test B) as recommended by the manufacturer. First strand cDNA was produced using Superscript II reverse transcriptase (Gibco). Total RNA (1 µg) was hybridized with 140 ng random hexamers in first strand reverse transcriptase buffer (50mM Tris, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 500 µm dNTPs) followed by addition of 200 U Superscript II reverse transcriptase and incubation at 42°C for 50 minutes. Five percent of the first strand reaction was used for each ensuing PCR reaction. Primer sequences were as follows: ß-major forward, CTGACAGATGCTCTCTTGGG; ß-major reverse, CACAACCCCAGAAACAGACA; ß-H1 forward, AGTCCCCATGGAGTCAAAGA; ß-H1 reverse, CTCAAGGAGACCTTTGCTCA; ß-actin forward, GTGGGGCGCCCCAGGCACCA; and ß-actin reverse, CTCCTTAATGTCACGCACGATTTC.
| RESULTS |
|---|
|
|
|---|
|
|
Cells from bulk cultures engrafted substantially in hematopoietic organs of transplanted mice (Fig. 3A). Engraftment was evaluated between 5 and 9 weeks after transplantation. After this time, recipient mice succumbed to a myeloproliferative disorder characterized by splenomegaly and high white cell counts in the peripheral blood, with a particular expansion in the erythroid compartment. Flow cytometric analyses showed that GFP-positive cells had differentiated into Gr1/Mac1-positive myeloid cells, Ter119-positive erythroid cells and, to a lesser extent, B220-positive and CD4/CD8-positive lymphoid cells (Fig. 3C).
|
When plated in MCM, clonal cells generated only blast-type and primitive erythroid colonies (Fig. 2D). Flow cytometric analysis revealed that the clones were predominantly positive for Kit, and negative for lineage-specific antigens (Fig. 4A), including the endothelial marker Flk1 (data not shown). Southern analyses of bulk cells as well as all derived subclones demonstrated that the bulk population was already substantially clonal by day 16 of expansion and that all the subclones derived from the same original infected cell (data not shown). This observation of clonal dominance is typical of our studies with cultures of BCR/ABL-infected EB cells (Peters et al., 2001), and our earlier experience with retroviral infections of murine bone marrow, which has been attributed to the infrequency of the HSC target as opposed to secondary mutational events (Daley et al., 1990; Li et al., 1999).
|
Given the embryonic origin of these cells, we examined three clones for expression of adult (ß-major) and embryonic (ß-H1) forms of ß-globin. As expected, all the clones expressed both ß-major and ß-H1 globins (Fig. 4B). However, sorted cells (GFP-positive Ter119-positive) from spleen and bone marrow of two different mice expressed only adult ß-major (Fig. 4B), suggesting that the clones can undergo the globin gene switching associated with definitive adult erythropoiesis.
GFP-positive cells were FACS purified from bone marrow of engrafted mice and assayed for colony formation in methylcellulose. Multi-lineage myeloid colonies were observed (Fig. 5), in addition to large numbers of BL-CFCs. This confirms that the ES-derived cells undergo differentiation into myeloid colony-forming cells in vivo. Furthermore, bone marrow from primary mice could be transplanted into secondary animals, generating a more aggressive secondary disease which also contained lymphoid and myeloid components (not shown). These data demonstrate that the cell we have targeted with BCR/ABL is capable of primitive erythropoiesis as well as definitive lymphoid-myeloid-erythroid hematopoiesis and of self-renewal in primary and secondary animals.
|
| DISCUSSION |
|---|
|
|
|---|
EB-derived hematopoiesis mirrors that of the yolk sac in the types of CFC produced, the temporal sequence of their production and the lack of efficient lymphoid-myeloid repopulating activity when assayed in irradiated adult mice (Keller et al., 1993; Wiles and Keller, 1991). It has proven exceedingly difficult to demonstrate that EB-derived hematopoietic cells can efficiently repopulate adults under normal circumstances (Gutierrez-Ramos and Palacios, 1992; Hole et al., 1996; Müller and Dzierzak, 1993; Palacios et al., 1995; Potocnik et al., 1997). Moreover, rigorous proof that EB differentiation produces hematopoietic stem cells is lacking, because this requires clonal analyses to exclude the possibility that lymphoid and myeloid lineages derive from lineage-committed precursors that arose separately in culture. Without a marker to trace clonal relationships, engraftment alone does not prove that ES cells transit through a pluripotent hematopoietic stem cell stage during differentiation within EBs. The limitation in demonstrating extensive multilineage repopulation with cells of ES origin, under normal circumstances, has generated uncertainty as to whether a definitive HSC develops during EB differentiation. By enabling both clonal expansion and multi-lineage engraftment, BCR/ABL has allowed an HSC to be identified.
Recent studies have shown that CD34-positive/Kit-positive cells isolated from E9.0 yolk sacs are able to provide long-term repopulation when conditioned newborn mice instead of adults are used as recipients for transplantation (Yoder et al., 1997). Although these studies were carried out following the onset of circulation, which starts at E8.5, the fact that 37-fold more CD34-positive/Kit-positive cells were found in the yolk sac than in the embryo proper suggests that these LTR cells are of extra-embryonic origin. An AGM-derived cell line has recently been shown to induce adult-repopulating ability in cells derived from pre-circulation yolk sac, provided that the cells are co-cultured in vitro for a minimum of 4 days before transplantation (Matsuoka et al., 2001). In the absence of clonal analysis, the relationship of the adult-repopulating yolk sac cells demonstrated in these studies and the yolk sac primitive erythroid progenitors was unclear. However, taken together with our results, these data suggest that a yolk sac embryonic HSC exists, which has the potential to undergo both embryonic erythropoiesis as well as definitive lymphoid-myeloid hematopoiesis, and, furthermore, that repopulating activity is dependent on the environment, with that of the irradiated adult host being unsuitable for the embryonic HSC. It may be that the embryonic HSC does not home to the bone marrow, or alternatively that the adult microenvironment fails to provide the appropriate signals required to maintain the embryonic HSC. BCR/ABL overcomes this deficiency perhaps by some combination of altering the homing properties of the donor cell, complementing a missing cytokine signal or blocking apoptosis of the donor cell, providing it with time to acclimatize to the adult environment, allowing us to assay the lymphoid-myeloid potential of this cell (Fig. 6). It may also be the case that the embryonic HSC is by nature a transient cell type, and BCR/ABL endows it with enhanced self-renewal properties. We are currently investigating these hypotheses.
|
Where does the cell we have demonstrated fit into the proposed hierarchy of embryonic hematopoiesis? Based on its primitive and definitive erythroid potential and the absence of Flk1 expression by flow cytometry, we place it below the hemangioblast, which has been characterized as Flk1 positive (Choi et al., 1998; Nishikawa et al., 1998) and at or above the primitive-definitive bipotent erythroid precursor (Kennedy et al., 1997) (Fig. 6). Its preference for the production of primitive erythroid CFC in addition to self-renewal in vitro reflects its similarity to the yolk sac HSC, whose primary function is the production of embryonic erythrocytes. Its ability to generate the lineages characteristic of adult hematopoiesis suggests that its developmental potential is fundamentally similar to the adult HSC.
The results of this clonal analysis demonstrate the existence of an ES-cell derived hematopoietic progenitor with primitive erythroid potential in vitro and lymphoid-myeloid potential in engrafted mice, and suggests that an embryonic cognate of the adult repopulating hematopoietic stem cell arises during EB differentiation. Harnessing the potential of such a cell to reconstitute hematopoiesis in adult animals is a crucial step to modeling hematopoietic cell transplantation using ES cell sources.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Barker, J. E. (1968). Development of the mouse hematopoietic system. Dev. Biol. 18, 14-29.[Medline]
Borge, O. J., Adolfsson, J. and Jacobsen, A. M. (1999). Lymphoid-restricted development from multipotent candidate murine stem cells: distinct and complimentary functions of the c-kit and flt3-ligands. Blood 94, 3781-3790.
Brady, G., Barbara, M. and Iscove, N. (1990). Representative in vitro cDNA amplification from individual hemopoietic cells and colonies. Methods Mol. Cell. Biol. 2, 17-25.
Brotherton, T., Chui, D., Gauldie, J. and Patterson, M. (1979). Hemoglobin ontogeny during normal mouse fetal development. Proc. Natl. Acad. Sci. USA 76, 2853-2855.
Choi, K., Kennedy, M., Kazarov, A., Papadimitriou, J. C. and Keller, G. (1998). A common precursor for hematopoietic and endothelial cells. Development 125, 725-732.[Abstract]
Daley, G. Q., Etten, R. A. V. and Baltimore, D. (1990). Induction of chronic myelogenous leukemia in mice by the P210bcr/abl gene of the Philadelphia chromosome. Science 247, 824-830.
Dick, J. E., Magli, M. C., Huszar, D., Phillips, R. A. and Bernstein, A. (1985). Introduction of a selectable gene into primitive stem cells capable of long-term reconstitution of the hematopoietic system of W/Wv mice. Cell 42, 71-79.[Medline]
Fialkow, P. J., Jacobsen, J. R. and Papayannopoulou, T. (1977). Chronic myelocytic leukemia: clonal origin in a stem cell common to the granulocyte, erythrocyte, platelet and monocyte/macrophage. Am. J. Med. 63, 125-130.[Medline]
Gishizky, M. L. and Witte, O. N. (1992). Initiation of deregulated growth of multipotent progenitor cells by bcr-abl in vitro. Science 256, 836-839.
Godin, I., Dieterlen-Lievre, F. and Cumano, A. (1995). Emergence of multipotent hematopoietic cells in the yolk sac and para-aortic splanchnopleura in mouse embryos, beginning at 8.5 days postcoitus. Proc. Natl. Acad. Sci. USA 92, 773-777.
Grignani, F., Kinsella, T., Mencarelli, A., Valtieri, M., Riganelli, D., Grignani, F., Lanfrancone, L., Peschle, C., Nolan, G. P. and Pelicci, P. G. (1998). High-efficiency gene transfer and selection of human hematopoietic progenitor cells with a hybrid EBV/retroviral vector expressing the green fluorescence protein. Cancer Res. 58, 14-19.
Gutierrez-Ramos, J. C. and Palacios, R. (1992). In vitro differentiation of embryonic stem cells into lymphocyte precursors able to generate T and B lymphocytes in vivo. Proc. Natl. Acad. Sci. USA 89, 9171-9175.
Hole, N., Graham, G. J., Menzel, U. and Ansell, J. D. (1996). A limited temporal window for the derivation of multilineage repopulating hematopoietic progenitors during embryonal stem cell differentiation in vitro. Blood 88, 1266-1276.
Keller, G., Kennedy, M., Papayannopoulou, T. and Wiles, M. V. (1993). Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol. Cell. Biol. 13, 473-486.
Keller, G., Paige, C., Gilboa, E. and Wagner, E. F. (1987). Expression of a foreign gene in myeloid and lymphoid cells derived from multipotent haematopoietic precursors. Nature 318, 149-154.
Kennedy, M., Firpo, M., Choi, K., Wall, C., Robertson, S., Kabrun, N. and Keller, G. (1997). A common precursor for primitive erythropoiesis and definitive hematopoiesis. Nature 386, 488-493.[Medline]
Lemischka, I. R., Raulet, D. H. and Mulligan, R. C. (1986). Developmental potential and dynamic behavior of hematopoietic stem cells. Cell 45, 917-927.[Medline]
Li, S., Ilaria, R. L., Jr, Million, R. P., Daley, G. Q. and Van Etten, R. A. (1999). The P190, P210, and P230 forms of the BCR/ABL oncogene induce a similar chronic myeloid leukemia-like syndrome in mice but have different lymphoid leukemogenic activity. J. Exp. Med. 189, 1399-1412.
Matsuoka, S., Tsuji, K., Hisakawa, H., Xu, M-j., Ebihara, Y., Ishii, T., Sugiyama, D., Manabe, A., Tanaka, R., Ikeda, Y. et al. (2001). Generation of definitive hematopoietic stem cells from murine early yolk sac and paraaortic splanchnopleures by aorta-gonad-mesonephros region-derived stromal cells. Blood 98, 6-12.
McKenna, H. J., Stocking, K. L., Miller, R. E., Brasel, K., Smedt, T. D., Maraskovsky, E., Maliszewski, C. R., Lynch, D. H., Smith, J., Pulendram, B. et al. (2000). Mice lacking flt3 ligand have deficient hematopoiesis affecting hematopoietic progenitor cells, dendritic cells, and natural killer cells. Blood 95, 3489-3497.
Medvinsky, A. and Dzierzak, E. (1996). Definitive hematopoiesis is autonomously initiated by the AGM region. Cell 86, 897-906.[Medline]
Moore, M. A. S. and Metcalf, D. (1970). Ontogeny of the haematopoietic system: yolk sac origin of in vivo and in vitro colony forming cells in the developing mouse embryo. Br. J. Haematol. 18, 279-296.[Medline]
Müller, A. M. and Dzierzak, E. A. (1993). ES cells have only a limited lymphopoietic potential after adoptive transfer into mouse recipients. Development 118, 1343-1351.[Abstract]
Müller, A. M., Medvinsky, A., Strouboulis, J., Grosveld, F. and Dzierzak, E. (1994). Development of hematopoietic stem cell activity in the mouse embryo. Immunity 1, 291-301.[Medline]
Nishikawa, S.-I., Nishikawa, S., Hirashima, M. and Matsuyoshi, N. (1998). Progressive lineage analysis by cell sorting and culture identifies FLK1+VE-cadherin+ cells at a diverging point of endothelial and hematopoietic lineages. Development 125, 1747-1757.[Abstract]
Palacios, R., Golunski, E. and Samaridis, J. (1995). In vitro generation of hematopoietic stem cells from an embryonic stem cell line. Proc. Natl. Acad. Sci. USA 92, 7530-7534.
Palis, J., Chan, R. J., Koniski, A., Patel, R., Starr, M. and Yoder, M. C. (2001). Spatial and temporal emergence of high proliferative potential hematopoietic precursors during murine embryogenesis. Proc. Natl. Acad. Sci. USA 98, 4528-4533.
Palis, J., Robertson, S., Kennedy, M., Wall, C. and Keller, G. (1999). Development of erythroid and myeloid progenitors in the yolk sac and embryo proper of the mouse. Development 126, 5073-5084.[Abstract]
Peters, D. G., Klucher, K. M., Perlingeiro, R. C. R., Dessain, S. K., Koh, E. Y. and Daley, G. Q. (2001). Autocrine and paracrine effects of an ES-cell derived, BCR/ABL-transformed hematopoietic cell line that induces leukemia in mice. Oncogene 20, 2636-2646.[Medline]
Potocnik, A. J., Kohler, H. and Eichmann, K. (1997). Hemato-lymphoid in vivo reconstitution potential of subpopulations derived from in vitro differentiated embryonic stem cells. Proc. Natl. Acad. Sci. USA 94, 10295-10300.
Robertson, E. J. (1987). Embryo-derived stem cell lines. In Teratocarcinomas and Embryonic Stem Cells: A Practical Approach (ed. E.J. Robertson), pp. 71-112. Oxford: IRL Press.
Schmitt, R. M., Bruyns, E. and Snodgrass, H. R. (1991). Hematopoietic development of embryonic stem cells in vitro: cytokine and receptor gene expression. Genes & Development 5, 728-740.
Toles, J. F., Chui, D. H. K., Belbeck, L. W., Starr, E. and Barker, J. E. (1989). Hemopoietic stem cells in murine embryonic yolk sac and peripheral blood. Proc. Natl. Acad. Sci. USA 86, 7456-7459.
Weissman, I., Papaioannou, V. and Gardner, R. (1978). In Differentiation of Normal and Deoplastic Hematopoietic Cells, pp. 33-47. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Wiles, M. V. and Keller, G. (1991). Multiple hematopoietic lineages develop from embryonic stem (ES) cells in culture. Development 111, 259-267.[Abstract]
Wu, A. M., Till, J. E., Siminovitch, L. and McCulloch, E. A. (1968). Cytological evidence for a relationship between normal hematopoietic colony-forming cells and cells of the lymphoid system. J. Exp. Med. 127, 455-464.[Abstract]
Yoder, M. C., Hiatt, K., Dutt, P., Mukherjee, P., Bodine, D. M. and Orlic, D. (1997). Characterization of definitive lymphohematopoietic stem cells in the day 9 murine yolk sac. Immunity 7, 335-344.[Medline]
This article has been cited by other articles:
![]() |
T. Yamane, N. Hosen, H. Yamazaki, and I. L. Weissman Expression of AA4.1 marks lymphohematopoietic progenitors in early mouse development PNAS, June 2, 2009; 106(22): 8953 - 8958. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Jiang, E. Ng, C. Yip, W. Eisterer, Y. Chalandon, M. Stuible, A. Eaves, and C. J. Eaves Primitive interleukin 3 null hematopoietic cells transduced with BCR-ABL show accelerated loss after culture of factor-independence in vitro and leukemogenic activity in vivo Blood, November 15, 2002; 100(10): 3731 - 3740. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||