spacer gif spacer gif spacer gif spacer gif ARCHIVE ANNOUNCEMENT! spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Acampora, D.
Right arrow Articles by Simeone, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Acampora, D.
Right arrow Articles by Simeone, A.
Development 128, 4801-4813 (2001)
© 2001 The Company of Biologists Limited

OTD/OTX2 functional equivalence depends on 5' and 3' UTR-mediated control of Otx2 mRNA for nucleo-cytoplasmic export and epiblast-restricted translation

Dario Acampora1,2,{ddagger}, Pietro Pilo Boyl1,{ddagger}, Massimo Signore1, Juan Pedro Martinez-Barbera1, Cristina Ilengo3, Eduardo Puelles1, Alessandro Annino2, Heinrich Reichert4, Giorgio Corte3,5 and Antonio Simeone1,2,*

1 MRC Centre for Developmental Neurobiology, King’s College London, Guy’s Campus, New Hunts House, London SE1 9RT, UK
2 International Institute of Genetics and Biophysics, CNR, Via G. Marconi 12, 80125 Naples, Italy
3 IST-National Institute for Cancer Research,
5 Dipartimento di Oncologia Clinica e Sperimentale, Università di Genova, Largo Benzi, 16132 Genova, Italy
4 Institute of Zoology, University of Basel, Rheinsprung 9, CH-4051 Basel, Switzerland
{ddagger} These authors contributed equally to the work

*Author for correspondence (e-mail: antonio.simeone{at}kcl.ac.uk)

Accepted September 12, 2001


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
How gene activity is translated into phenotype and how it can modify morphogenetic pathways is of central importance when studying the evolution of regulatory control mechanisms. Previous studies in mouse have suggested that, despite the homeodomain-restricted homology, Drosophila orthodenticle (otd) and murine Otx1 genes share functional equivalence and that translation of Otx2 mRNA in epiblast and neuroectoderm might require a cell type-specific post-transcriptional control depending on its 5' and 3' untranslated sequences (UTRs).

In order to study whether OTD is functionally equivalent to OTX2 and whether synthesis of OTD in epiblast is molecularly dependent on the post-transcriptional control of Otx2 mRNA, we generated a first mouse model (otd2) in which an Otx2 region including 213 bp of the 5' UTR, exons, introns and the 3' UTR was replaced by an otd cDNA and a second mutant (otd2FL) replacing only exons and introns of Otx2 with the otd coding sequence fused to intact 5' and 3' UTRs of Otx2.

otd2 and otd2FL mRNAs were properly transcribed under the Otx2 transcriptional control, but mRNA translation in epiblast and neuroectoderm occurred only in otd2FL mutants. Phenotypic analysis revealed that visceral endoderm (VE)-restricted translation of otd2 mRNA was sufficient to rescue Otx2 requirement for early anterior patterning and proper gastrulation but it failed to maintain forebrain and midbrain identity.

Importantly, epiblast and neuroectoderm translation of otd2FL mRNA rescued maintenance of anterior patterning as it did in a third mouse model replacing, as in otd2FL, exons and introns of Otx2 with an Otx2 cDNA (Otx22c). The molecular analysis has revealed that Otx2 5' and 3' UTR sequences, deleted in the otd2 mRNA, are required for nucleo-cytoplasmic export and epiblast-restricted translation. Indeed, these molecular impairments were completely rescued in otd2FL and Otx22c mutants. These data provide novel in vivo evidence supporting the concept that during evolution pre-existing gene functions have been recruited into new developmental pathways by modifying their regulatory control.

Key words: otd, Otx2, UTR, Translational control, VE, Anterior patterning, Brain evolution, Mouse


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Early brain development in higher vertebrates is a complex process characterised by the induction and maintenance of the anterior neuroectoderm, which subsequently becomes regionalised into forebrain, midbrain and hindbrain (Beddington and Robertson, 1999). Further differentiation of these territories leads to the generation of neuronal populations with a restricted identity and specific functional properties (Lumsden, 1990; Lumsden and Krumlauf, 1996; Rubenstein et al., 1998).

In the last decade, a considerable amount of data has been collected on the role of developmental control of genes involved in brain morphogenesis in mammals. Most of them are the vertebrate homologues of Drosophila genes that encode transcription factors or signalling molecules (Lemaire and Kodjabachian, 1996; Holland, 1999; Rubenstein et al., 1998). Among these is the orthodenticle gene family, which includes the Drosophila orthodenticle (otd) and the murine Otx1 and Otx2 genes (Simeone et al., 1992; Simeone et al., 1993; Finkelstein and Boncinelli, 1994).

Previous studies have indicated that the Otx genes play an important role in brain development [see reviews by Simeone and Acampora (Simeone, 1998; Acampora and Simeone, 1999; Simeone 2000; Acampora et al., 2001)]. These studies have established that Otx2 is required in the VE for early induction of anterior neural patterning and proper gastrulation, and subsequently, in the epiblast-derived tissues such as axial mesendoderm (ame) and anterior neuroectoderm for maintenance of forebrain and midbrain regional identities (Acampora et al., 1995; Acampora et al., 1998b; Rhinn et al., 1998; Acampora and Simeone, 1999; Beddington and Robertson, 1999). In particular, the analysis of embryos replacing Otx2 with the human Otx1 (hOtx1) cDNA has also revealed that while the hOtx1 mRNA is transcribed in both the VE and epiblast, the hOTX1 protein is synthesised only in the VE (Acampora et al., 1998b). This unexpected phenomenon has suggested the possibility that a differential post-transcriptional control may exist between VE and epiblast and that the Otx2 replaced region, including 213 bp of the 5' untranslated region (UTR), exons, introns and the 3' UTR, may contain regulatory elements required for epiblast-restricted translation of Otx2 mRNA. In terms of brain development this potential control of Otx2 mRNA translation might represent a crucial aspect since lack or reduction of OTX2 protein is invariably associated with lack or reduction of the forebrain and midbrain.

In this context, we have very recently reported that embryos carrying a 300 bp insertion of exogenous DNA from the {lambda} phage (Otx2{lambda}) into the Otx2 3' UTR, exhibit severe brain abnormalities and drastic reduction of OTX2 protein for an impairment of Otx2{lambda} mRNA to form efficient polyribosome complexes (Pilo Boyl et al., 2001).

However, although OTX1 and OTX2 appear to be equivalent in the VE and OTD/OTX1 properties largely overlap, it could not be predicted whether OTD is also equivalent to OTX2 in instructing proper brain morphogenesis.

Understanding how the genetic mechanisms that control brain morphogenesis have evolved represents a central aspect of comparative developmental biology. Despite the enormous morphological diversity between invertebrates and vertebrates, striking examples of functional conservation of genetic programmes for morphogenesis are found in these animal groups. Among these are the invertebrate HOM-C and vertebrate Hox genes which control the specification of axial patterning (Lewis, 1978; Krumlauf, 1994; Lumsden and Krumlauf, 1996), the short gastrulation/Chordin and decapentaplegic/Bmp4 genes, which control dorsoventral (DV) patterning (De Robertis and Sasai, 1996) and the Drosophila eyeless (ey) and vertebrate Pax6 genes, which control eye morphogenesis (Callaerts et al., 1997).

Recently, functional conservation among members of the otd/Otx group has been demonstrated in cross-phylum genetic rescue experiments (Acampora et al., 1998a; Leuzinger et al., 1998; Nagao et al., 1998; Sharman and Brand, 1998). Nevertheless, homeodomain-restricted homology between OTD and OTX2 proteins as well as the huge diversity existing between mouse and Drosophila early head morphogenesis suggest that otd should be unable to share functional equivalence with Otx2 in VE (specification of the early anterior patterning and proper gastrulation) and neuroectoderm (maintenance of forebrain and midbrain identities).

In order to assess whether OTD is equivalent to OTX2 and, importantly, whether translation of otd mRNA requires Otx2 post-transcriptional control in epiblast and neuroectoderm, we generated a first mouse model (otd2) where an otd cDNA replaces an Otx2 genomic region including 213 bp of the 5' UTR, coding sequences, introns and the entire 3' UTR. In a second mutant (otd2FL), only the Otx2 coding sequence and introns were replaced by the otd coding sequence. While the otd2 and otd2FL expression was correctly driven by Otx2 transcriptional control, mRNA translation in epiblast and neuroectoderm occurred only in otd2FL mutants, being otd2 mRNA translation restricted only to VE. A third mutant (Otx22c) carrying an Otx2 cDNA in place of the Otx2 coding sequence and introns, was generated to compare OTD and OTX2 functions. Phenotypic analysis of otd2, otd2FL and Otx22c homozygous mutants indicated that OTD fulfilled OTX2 functions required in VE and neuroectoderm for murine brain development when the two genes undergo the same genetic modifications. A detailed molecular analysis has indicated that the Otx2 5'and 3' UTRs deleted in otd2 mutant were responsible for a severe impairment of both nucleo-cytoplasmic export and epiblast-restricted translation of the otd2 mRNA.

Importantly, these molecular abnormalities were completely rescued in otd2FL and Otx22c mutants and confirmed in hOtx12 embryos. In this study, we have shown that the otd mRNA is translated in epiblast and neuroectoderm only if the Otx2 post-transcriptional control is provided, and then in turn, the OTD protein can perform OTX2 functions required for murine head morphogenesis. Together with previous studies, this work provides more conclusive evidence indicating that this control may play a central role in development and evolution of the vertebrate head.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Targeting vectors, ES cell transfection and selection of targeted clones
The gene replacement vectors were generated from the same plasmid (pGN31) used to produce Otx2–/– mice (Acampora et al., 1995). For the otd2 construct, a Bsu36I/XmnI fragment of the otd cDNA containing 56 bp of its 5' UTR, the entire coding sequence and 450 bp of its 3'UTR was cloned in place of the lacZ gene in the former targeting vector. In this molecule, the otd cDNA was fused to the Otx2 5'UTR lacking 213 bp in front of the methionine.

For the otd2FL allele, a chimeric fragment containing the 213 bp of the Otx2 5'UTR (missing in the otd2 locus), the otd coding sequence and the Otx2 3'UTR from the stop codon up to a sequence 57 bp upstream of the Otx2 polyadenylation signal, was generated by PCR, sequenced and cloned in the same targeting vector. The control Otx22c locus was generated using the same criteria as for otd2FL, the Otx2 cDNA coding sequence being the only difference. To facilitate both genotyping and molecular analysis, the Otx2 cDNA was a chimeric fragment made up of human sequences from the methionine to the NsiI site in exon 3 (Fig. 6A). Downstream of their 3' UTR, all of the three molecules carried a SV40 polyadenylation signal to ensure transcription termination. The three targeting vectors were all electroporated into HM-1 embryonic stem cells. Homologous recombinant clones were identified by PCR using the same primers and conditions previously described (Acampora et al., 1995) (black arrows in Fig. 1A and Fig. 6A) and confirmed by hybridising HindIII digested genomic DNA with probes c and f (Fig. 1A,B, Fig. 6A,B and data not shown). Once established, all the mutant lines were kept in the B6D2 F1 genetic background.



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 6. Genomic organisation of the Otx22c targeted locus. (A) The targeted locus is shown in the third line; first and last lines show HindIII fragments (5.3 and 3.0 kb) detected by Southern blot using the same probes (hatched boxes c and f) as in Fig. 1A. Abbreviations are as in legend to Fig. 1. (B) Southern blot analysis of one representative targeted cell line and wild-type HM-1 ES cells hybridised with probe c (see A). (C) PCR genotyping of a litter from two heterozygotes using the primers indicated in (A) as filled arrowheads (wild-type allele) and open arrowheads (Otx22c allele). (D-K) Compared to 10.5 and 16 d.p.c. wild-type embryos (D,H), Otx22c/Otx22c (E-G,I-K) phenotypes were classified on the basis of head abnormalities as severe (E,I), moderate (F,J) and mild (G,K). Note the similarity between Otx22c/Otx22c and otd2FL/otd2FL (Fig. 2) phenotypes. Abbreviations as in previous figures.

 


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 1. Genomic organisation of the otd2 and otd2FL targeted loci (A). The targeted loci are shown in the third and fourth line; first and last lines show HindIII fragments (5.3 and 3.0 kb) detected by southern blot analysis using probes (hatched boxes) external to the targeting vector (probe c) or within the neomycin gene (probe f). S, SmaI; H, HindIII; N, NsiI; met, methionine; stop, stop codon; pA, polyadenylation signal. Dark hatched rectangles represent Otx2 5' and 3' UTRs, thinner open rectangles Drosophila otd UTRs. (B) Southern blot analysis of one representative targeted cell line for both molecules and wild-type HM-1 ES cells hybridised with probe c (see A). (C) PCR genotyping of two litters from two heterozygotes using the primers indicated in A as filled arrowheads (wild-type allele), open arrowheads (otd2 allele) and open arrows (otd2FL allele). (D-G) In situ hybridisation of an otd2/+ and an otd2FL/+ embryo at 10.5 d.p.c. with Otx2 (D,E) and otd-specific probes (probe a and e in A; F,G). fb, forebrain; mb, midbrain; hb, hindbrain.

 
Mouse genotyping
Genotyping was performed by PCR using two primers specific for the wild-type allele that were common for all the mouse lines (black arrowheads in Fig. 1A and 6A) (sense primer, GTGACTGAGAAACTGCTCCC; antisense primer, GTGTCTACATCTGCCCTACC) and three different pairs of primers for each mutated allele, otd2 (open arrowheads in Fig. 1A) (sense primer, ATCAAGACGCACCACAGTTCCT; antisense primer, TCCTTTAGCTGATCATAGGGCG), otd2FL (open arrows in Fig. 1A) (sense primer, CTTCTGGCACAATCAGTACCAGC; antisense primer, TGCTGGTTGATGGACCCTTC) and Otx22c (open arrowheads in Fig. 6A) (sense primer, TCACTCGGGCGCAGCTAGATGTG; antisense primer, AGAGGAGGTGGACAAGGGATCT). These primers amplify a 223 bp wild-type fragment and 444, 429 and 371 bp long fragments corresponding to the otd2, otd2FL and Otx22c mutant alleles, respectively (Fig. 1C and Fig. 6C).

RNAse protection assay
RNAse protection was performed as previously described (Simeone et al., 1993) using as probes, three fragments generated by PCR in corresponding regions (hatched boxes b, d in Fig. 1A and g in Fig. 6A). Phosphorimager scanning was performed to quantify RNA levels.

Immunohistochemistry and western blot analysis
Embryos were processed for immunohistochemistry with {alpha}OTD (1:1000) and {alpha}OTX2 (1:1500) polyclonal antisera as previously described (Acampora et al., 1998b). The {alpha}OTD polyclonal antiserum was generated following the same procedure previously used for the {alpha}OTX2 antiserum (Briata et al., 1996). Total extracts were prepared from three independent pools of 10.5 and 7.5 d.p.c. embryos for each mutant, processed for standard western blot assay and probed with {alpha}OTD (1:5000) and {alpha}OTX2 antiserum (1:5000). Films were processed for densitometric scanning.

In situ hybridisation and probes
In situ hybridisation experiments on sections and whole embryos were performed as previously described (Hogan et al., 1994; Simeone, 1999).

Wnt1, Tbr1, Bf1, Fgf8, Six3, Gbx2, Nog, Chd, cer-l, Hesx1 and Lim1 probes are the same previously described (Acampora et al., 1997; Acampora et al., 1998b; Pilo Boyl et al., 2001). The otd probe (probe e in Fig. 1A and Fig. 6A) is a PCR fragment spanning the last 800 bp of the otd coding region. The Otx2 probe for in situ hybridisation on sections corresponds to probe a in Fig. 1A. The Otx22c-specific probe for in situ hybridisation experiments on sections corresponds to probe h in Fig. 6A.

Polysome gradients and RNA purification
Sucrose gradients were performed essentially as described (Loreni and Amaldi, 1992; Pilo Boyl et al., 2001). Nuclear and cytoplasmic mRNAs were purified as previously described (Pilo Boyl et al., 2001). Stability of Otx2, otd2, otd2FL and Otx22c mRNAs was determined by administering 15 µg/ml of actinomycin D to the heterozygous ES cell clones followed by RNA extraction at the time indicated in Fig. 8F.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 8. Quantitative analysis of OTD and OTX2 proteins, otd2, otd2FL and Otx22c mRNAs and their stability in ES cells. (A) Western blot analysis of extracts from HeLa cells, HeLa cells transfected with an otd-expressing vector, and 7.5 d.p.c. wild-type, otd2/+ and otd2FL/+ embryos. (B) Western blot analysis on extracts from 7.5 d.p.c wild-type, Otx2+/– and Otx22c/Otx22c embryos. (C,D) Coomassie Blue staining of the gels in A and B. (E) otd2, otd2FL and Otx22c cytoplasmic and nuclear mRNA levels were determined in otd2/+, otd2FL/+ and Otx22c/+ embryos and are reported as percentages of the Otx2 mRNA. otd2 mRNA was also analysed at 7.5 d.p.c. Note that while the otd2 cytoplasmic mRNA is considerably reduced, the otd2 nuclear mRNA has accumulated significantly. (F) Stability of otd2, otd2FL and Otx22c mRNA is comparable to that of Otx2 mRNA in actinomycin D experiments performed on heterozygous ES cell lines.

 

    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Generation of mice replacing Otx2 with two otd cDNA carrying different 5' and 3' UTRs
In order to assess whether OTD is equivalent to OTX2 and whether this equivalence is subordinated to the Otx2 post-transcriptional control, we generated two different mouse models replacing Otx2 with otd.

In the first mutant locus (otd2) an otd cDNA containing 56 bp of the 5' UTR, the full coding sequence, and 450 bp of the 3' UTR region was introduced into an Otx2 disrupted locus and fused at its 5' end to the Otx2 5' UTR and at its 3' end to the SV40 poly(A) cassette of the pGN targeting vector (Acampora et al., 1995) (Fig. 1A). Otx2 deleted or misplaced sequences included 213 bp upstream of the start methionine in the 5' UTR, exons, introns and 3' UTR (Fig. 1A).

In the second mutant locus (otd2FL) the entire Otx2-5' UTR and the Otx2-3' UTR, excluding only the last 57 bp upstream of the polyadenylation signal, were fused to the methionine and stop codon of the otd coding sequence, respectively (Fig. 1A). The resulting heterozygotes (otd2/+ and otd2FL/+) were healthy and fertile. Expression of the two mutated alleles was monitored in heterozygous embryos at 6.5 and 10.5 days post coitum (d.p.c.) by using Otx2 and otd allele-specific probes (probes a and e in Fig. 1A). At 10.5 d.p.c. the Otx2 (Fig. 1D,E), otd2 (Fig. 1F) and otd2FL (Fig. 1G) transcripts were properly co-expressed along the forebrain and midbrain of otd2/+ and otd2FL/+ embryos, even though the amount of otd2 transcripts appeared heavily reduced in otd2/+ embryos.

Similar experiments performed at 6.5 d.p.c., revealed that during gastrulation the amount of otd2 mRNA was higher (Fig. 3 and Fig. 8).



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 3. Distribution of otd2, otd2FL and Otx2 mRNAs and proteins during gastrulation. (A-N’) Adjacent sagittal sections of 6.5 and 7.75 d.p.c. wild-type (A,B,A’,B’), otd2/+ (C,D,C’,D’) otd2/otd2 (E,F,E’,F’,K,L,L’), otd2FL/+ (G,H,G’,H’) and otd2FL/otd2FL (I,J,I’,J’,M,N,N’) embryos hybridised with probes specific for Otx2 (A,C,E,G,I,K,M) and otd (B,D,F,H,J,L,N) mRNAs or immunostained with {alpha}OTX2 (A’,C’,E’,G’,I’) and {alpha}OTD (B’,D’,F’,H’,J’,L’,N’) antibodies. Abbreviations: AVE, anterior visceral endoderm; epi, epiblast.

 
Head abnormalities in otd2/otd2 and otd2FL/otd2FL embryos
All otd2/otd2 embryos at 10.5 d.p.c. (23 out of 23) had a striking headless phenotype (Table 1; Fig. 2B); approximately one third of them (7 out of 23) also had a reduced body size. Moreover in otd2/otd2 mutants, the maxillary process, the mandibular arch and their derivatives were strongly impaired or absent (Fig. 2B,G).


View this table:
[in this window]
[in a new window]
 
Table 1.
 


View larger version (65K):
[in this window]
[in a new window]
 
Fig. 2. Morphology of otd2/otd2 and otd2FL/otd2FL embryos. (A-J) Compared to 10.5 and 16 d.p.c. wild-type embryos (A,F), otd2/otd2 mutants exhibits a headless phenotype and normal body axis (B,G); while otd2FL/otd2FL embryos at 10.5 d.p.c. were classified on the basis of head abnormalities as severe (C), moderate (D,H,I) and mild (E,J). Abbreviations as in the previous figure.

 
In contrast, otd2FL/otd2FL mutants exhibited an evident morphological rescue of the anterior defects observed in otd2/otd2 embryos, even though, head and brain development still appeared compromised (Table 1; Fig. 2C-E,H-J). Nevertheless, phenotype analysis (see also below) indicated that most of the otd2FL /otd2FL embryos (>=80%) exhibited forebrain and midbrain identities as well as ocular and olfactory sense organs (moderate and mild phenotypes in Table 1). Moderate phenotype was characterised by exencephaly and forebrain reduction (Fig. 2D,H,I); mild phenotype by a variable anterior shift of the presumptive midbrain-hindbrain boundary (MHB), and a well developed forebrain and anterior sense organs (Fig. 2E,J). Only a residual fraction (approx. 15%) of otd2FL/otd2FL embryos exhibited a severe phenotype (Table 1; Fig. 2C). However, also these embryos showed midbrain-specific and, occasionally, forebrain-specific gene expression (data not shown). Only 1 out of the 28 otd2FL/otd2FL embryos scored, displayed a headless phenotype (Table 1).

These data suggest that, despite the huge diversity between the Drosophila OTD and the murine OTX2, the fly protein was able to compensate OTX2 functions that are required for head development.

Epiblast and neuroectoderm synthesis of OTD requires Otx2 5' and 3' UTR sequences
The phenotype of otd2/otd2 embryos revealed striking similarity with that of mice in which exactly the same Otx2 region had been replaced with a human Otx1 cDNA (hOtx12) (Acampora et al., 1998b). In this mutant, the hOtx1 mRNA was transcribed in the VE and epiblast but translated only in the VE. Therefore transcription and translation was studied in otd2 and otd2FL mutants. A detailed analysis of otd2 and otd2FL mRNAs and proteins was performed at early streak (6.5 d.p.c.) and late streak (7.75 d.p.c.) stages in wild-type, otd2/+, otd2/otd2, otd2FL/+ and otd2FL/otd2FL embryos (Fig. 3). Genotypes were determined by hybridising adjacent sections with Otx2 and otd allele-specific probes (probe a and e in Fig. 1A, respectively). Two additional series of adjacent sections were assayed for the presence of OTX2 and OTD proteins with {alpha}OTX2 and {alpha}OTD antibodies. No staining was detected with either of the two antibodies on Otx2–/– embryos (data not shown) (Acampora et al., 1998b).

Otx2 transcripts and protein distribution fully colocalised in the epiblast and VE of wild-type (Fig. 3A,A’), otd2/+ (Fig. 3C,C’) and otd2FL/+ (Fig. 3G,G’) embryos at 6.5 d.p.c. and similar results were obtained at 7.75 d.p.c. (data not shown).

In otd2/+ and otd2/otd2 embryos, otd2 transcripts were detected in VE and epiblast at 6.5 d.p.c. (Fig. 3D,F) and in the anterior neuroectoderm and ame at 7.75 d.p.c. (Fig. 3L and data not shown). Also, as previously mentioned, their amount did not differ greatly from that of the Otx2 mRNA. In contrast with the otd2 mRNA distribution in both VE and epiblast, at 6.5 d.p.c. the OTD protein appeared restricted to the VE of otd2/+ (Fig. 3D’) and otd2/otd2 (Fig. 3F’) embryos and was not evident in the epiblast. Also at 7.75 d.p.c., OTD was not detected (Fig. 3L’).

Importantly, in otd2FL/+ and otd2FL/otd2FL embryos, both otd2FL mRNA and protein colocalised in the VE and epiblast at 6.5 d.p.c. (Fig. 3H,H’,J,J’) as well as in the neuroectoderm and ame at 7.75 d.p.c. (Fig. 3N,N’ and data not shown).

These data provide in vivo evidence that Otx2 5' and 3' UTRs are required for translation of the Otx2 mRNA in epiblast and derived tissues. Moreover, the finding that the otd2 mRNA is not translated in the epiblast of otd2/+ embryos suggests that this control does not require OTX2. Nevertheless, on the basis of these data it cannot be excluded whether this control requires both Otx2 coding sequence and 5' and 3' UTRs in a cis configuration.

otd2/otd2 and otd2FL/otd2FL embryos rescue Otx2 requirement in the VE and exhibit normal patterning of the early neural plate
Previous data indicated that the earliest defects of Otx2–/– embryos are related to an OTX2 requirement in the VE that is abnormally located at the distal tip of the embryo as revealed by the expression of Lim1, cerberus-like (cer-l), Hesx1 (Acampora et al., 1995; Acampora et al., 1998b; Ang et al., 1996). To assess whether the OTD protein could rescue these impairments, otd2/otd2 embryos were studied at 6.5 and 7.5 d.p.c. In otd2/otd2 embryos, otd2 mRNA was detected in the VE and epiblast (Fig. 4B) and Lim1, cer-l and Hesx1 were correctly expressed (Fig. 4D,F,H).



View larger version (136K):
[in this window]
[in a new window]
 
Fig. 4. Normal gastrulation and early anterior patterning in otd2/otd2 embryos. (A-R) Sagittal sections of 6.5 d.p.c. (A-H) and 7.5 d.p.c. (I-R) wild-type (A,C,E,G,I,K,M,O,Q) and otd2/otd2 (B,D,F,H,J,L,N,P,R) embryos hybridised with Otx2 (A,I), otd (B,J), Lim1 (C,D), cer-l (E,F), Hesx1 (G,H), Six3 (K,L), Gbx2 (M,N), Nog (O,P) and Chd (Q,R).

 
Therefore, VE abnormalities and molecular impairments detected in Otx2–/– embryos were rescued by the VE-restricted translation of the otd2 mRNA. This suggests that OTD and OTX2 proteins exhibit functional equivalence in the VE.

At late streak-headfold stage, Otx2–/– embryos were severely impaired in morphology and expression of early forebrain, midbrain and hindbrain markers (Acampora et al., 1995; Acampora et al., 1998b; Matsuo et al., 1995; Ang et al., 1996; Rhinn et al., 1998). In otd2/otd2 embryos, otd2 transcripts were restricted to the presumptive forebrain and midbrain (Fig. 4J), Six3 was expressed in the rostralmost neuroectoderm (Fig. 4L) and Gbx2 throughout the presumptive hindbrain (Fig. 4N).

Otx2 null embryos also showed severe impairments of the gastrulation process. Accordingly, Noggin (Nog) and Chordin (Chd) transcripts were either absent or only barely detected in disorganised cells (Acampora et al., 1995; Acampora et al., 1998b; Ang et al., 1996). As revealed by Nog (Fig. 4P) and Chd (Fig. 4R) expression, these defects were recovered in otd2/otd2 embryos. This analysis was also performed in 6.5 and 7.5 d.p.c. otd2FL/otd2FL embryos which, as expected, did not show any abnormalities (data not shown).

Thus, the morphological defects and the molecular impairments that affect VE, rostral neuroectoderm, primitive streak, as well as the node and its derivatives of Otx2–/– embryos are rescued by VE-restricted translation of otd2 mRNA. It is noteworthy that the additional presence of OTD protein in the epiblast of otd2FL/otd2FL embryos does not improve the rescue observed when the OTD protein is restricted to the VE. This strengthens the idea that in Otx2–/– embryos, Otx2-mediated impairments of the early anterior patterning and primitive streak are determined in the VE.

Maintenance of anterior patterning is rescued in otd2FL/otd2FL embryos
We previously showed that hOtx12/hOtx12 embryos failed to maintain anterior patterning and exhibited headless phenotype (Acampora et al., 1998b).

Embryo morphology and lack of OTD protein in epiblast and neuroectoderm are very similar in otd2/otd2 and hOtx12/hOtx12 embryos. On this basis, maintenance of forebrain and midbrain identity should be lost in otd2/otd2 mutants. To assess this issue, the expression of a number of regionally restricted markers such as Fgf8, Gbx2, Wnt1, Bf1 and Tbrain1 (Tbr1) was analysed together with otd at 8.5 and 10.5 d.p.c.

Compared to wild-type embryos (Fig. 5A-J), in otd2/otd2 embryos at 8.5 and 10.5 d.p.c., otd2 transcripts were undetectable along the neuroectoderm (Fig. 5A’); Fgf8 (Fig. 5B’,G’), Gbx2 (Fig. 5C’) and Wnt1 (Fig. 5D’,H’) expression was markedly displaced anteriorly; Bf1 (Fig. 5E’,I’) and Tbr1 (Fig. 5J’) were no longer detected in presumptive forebrain. In otd2FL/otd2FL embryos recovery of forebrain and midbrain regional identity was observed.



View larger version (98K):
[in this window]
[in a new window]
 
Fig. 5. Lack of forebrain and midbrain identities in the otd2/otd2 mutant is rescued in otd2FL/otd2FL embryos. (A-E’’) Whole-mount in situ hybridisation of 8.5 d.p.c. wild-type (A-E), otd2/otd2 (A’-E’) and otd2FL/otd2FL (A’’-E’’) embryos with Otx2 (A) otd (A’,A’’), Fgf8 (B,B’,B’’), Gbx2 (C,C’,C’’), Wnt1 (D,D’,D’’) and Bf1 (E,E’,E’’). (F-J’’) Adjacent sagittal sections of 10.5 d.p.c. wild-type (F-J), otd2/otd2 (F’-J’) and otd2FL/otd2FL (F’’-J’’) embryos hybridised with Otx2 (F), otd (F’,F’’), Fgf8 (G,G’,G’’), Wnt1 (H,H’,H’’), Bf1 (I,I’,I’’) and Tbr1 (J,J’,J’’). Abbreviations as in previous figures.

 
Indeed, compared to otd2/otd2 embryos, otd2FL expression was detected and maintained along the anterior neural plate (Fig. 5A’’,F’’); Fgf8 (Fig. 5B’’) and Gbx2 (Fig. 5C’’) expression domains were shifted posteriorly almost at their normal position; Wnt1 (Fig. 5D’’) transcripts were detected in a broader domain corresponding to the presumptive midbrain; Bf1 (Fig. 5E’’,I’’) was abundant in the rostral neuroectoderm, and Tbr1 (arrow in Fig. 5J’’), which labelled post-mitotic neuroblasts in the dorsal telencephalon, was properly expressed.

However, even though the forebrain and midbrain rescue determined by the fly OTD protein was evident in most of otd2FL/otd2FL mutants, it was never complete. Indeed, at 10.5 d.p.c. the midbrain territory defined by otd2FL and Wnt1 expression domains (Fig. 5F’’,H’’) was smaller and this reduction was balanced by an enlargement of the rostalmost hindbrain. Moreover, Fgf8 (Fig. 5G’’) expression was abnormally expanded within the otd2FL and Wnt1 domains.

Finally, it is noteworthy that all the embryos with a moderate phenotype (Table 1 and Fig. 2D) recovered forebrain and midbrain expression of Bf1, Tbr1, Wnt1 and otd2FL (data not shown) and that 3 out of 6 embryos with a severe phenotype (Table 1 and Fig. 2C) exhibited spotted expression of Bf1 (data not shown).

Therefore, this analysis indicates that (i) the Drosophila OTD and the murine OTX2 proteins share functional equivalence also in the neural plate where OTD is able to maintain the anterior patterning and direct forebrain and midbrain regionalisation; and (ii) OTD/OTX2 equivalence in maintenance of forebrain and midbrain depends on the translation of the otd2FL mRNA in the epiblast and neural plate and this process requires Otx2 5' and 3' UTRs.

Embryos replacing Otx2 with an Otx2 cDNA (Otx22c/Otx22c) display the same phenotype exhibited by otd2FL/otd2FL mutants
The phenotypic features of otd2FL/otd2FL embryos are reminiscent of those previously described in mutant embryos with reduced level of OTX2 or both OTX2 and OTX1 proteins (Acampora et al., 1997; Suda et al., 1997; Pilo Boyl et al., 2001). This suggests that the level of OTD protein is not sufficient to fulfil all of the OTX2 requirements. Alternatively, it may suggest that OTD and OTX2 proteins share partial functional equivalence.

To address this issue, we have generated a third mouse model replacing Otx2 with an Otx2 cDNA (Otx22c) with the same strategy used to generate the otd2FL recombined locus (compare Fig. 6A with Fig. 1A). The Otx22c recombined locus was therefore identical to the otd2FL locus, except for the Otx2 coding sequence and, thereby, it should represent the most appropriate control of the otd2FL mutated locus.

Otx22c/Otx22c and otd2FL/otd2FL embryos exhibited striking phenotypic similarities. Indeed, also Otx22c/Otx22c embryos were classified in three groups on the basis of head abnormalities (Table 2) (Fig. 6E-G,I-K). At 7.5 d.p.c. Otx22c mRNA and protein colocalised in the anterior neuroectoderm and ame of Otx22c/Otx22c embryos (data not shown) and Six3, Chd and Gbx2 were correctly expressed (data not shown). Maintenance of the anterior patterning was assessed at 8.5 and 10.5 d.p.c. by analysing the expression of Otx22c, Fgf8, Gbx2 and Bf1 as well as the distribution of the OTX2 protein. At 8.5 d.p.c., Otx22c/Otx22c embryos showed that Otx22c was transcribed along the presumptive forebrain and midbrain (Fig. 7A’), and Fgf8 (Fig. 7B’) and Gbx2 (Fig. 7C’) expression domains appeared slightly expanded anteriorly. At 10.5 d.p.c. in Otx22c/Otx22c embryos, Otx22c transcripts (data not shown) and protein (Fig. 7E’) colocalised and were less abundant in the posterior midbrain; Fgf8 (Fig. 7F’) was broadly expressed up to the presumptive position of the telen-diencephalic boundary; Gbx2 transcripts (Fig. 7G’) were slightly displaced anteriorly and a robust expression of Bf1 (Fig. 7D’,H’) was detected in the forebrain at 8.5 and 10.5 d.p.c.


View this table:
[in this window]
[in a new window]
 
Table 2.
 


View larger version (118K):
[in this window]
[in a new window]
 
Fig. 7. Otx22c/Otx22c embryos exhibit similarities with otd2FL/otd2FL embryos in forebrain and midbrain patterning. (A-D’) Whole-mount in situ hybridisation of 8.5 d.p.c. wild-type (A-D) and Otx22c/Otx22c (A’-D’) embryos with Otx2 (A,A’), Fgf8 (B,B’), Gbx2 (C,C’) and Bf1 (D,D’). (E-H’) Adjacent sagittal sections of 10.5 d.p.c. wild-type (E-H) and Otx22c/Otx22c (E’-H’) embryos, immunostained with {alpha}OTX2 (E,E’) or hybridised with Fgf8 (F,F’), Gbx2 (G,G’) and Bf1 (H,H’). Abbreviations as in the previous figures.

 
Therefore, these findings and those reported for otd2FL/otd2FL embryos suggest that OTD and OTX2 functional properties may be fully equivalent. However, from our data it cannot be excluded that OTD is unable to fully rescue the Otx2 mutant phenotype when only the Otx2 coding sequence is replaced.

Otx2 5' and 3' UTRs are required for nucleo-cytoplasmic export and epiblast-restricted translation of Otx2 mRNA
In order to determine the molecular events that were impaired in otd2/otd2, otd2FL/otd2FL and Otx22c/Otx22c embryos as well as those that were rescued by the presence of the Otx2 5' and 3' UTRs, a detailed analysis was performed to assess protein levels and to determine whether otd2, otd2FL and Otx22c mRNAs were efficiently transcribed, processed and translated. Protein levels were assessed in western blot assays on three independent pools of wt, Otx2+/–, otd2/+, otd2FL/+ and Otx22c/Otx22c embryos at 7.5 and 10.5 d.p.c. At 7.5 d.p.c. OTD protein was detected only in otd2FL/+ embryos (Fig. 8A) and its quantification indicated that, it was only 27% that of OTX2. A very similar result was obtained at 10.5 d.p.c. (data not shown). However, we were aware that the accuracy of this quantitative analysis could be affected by different affinity and specificity of the two antibodies ({alpha}OTD and {alpha}OTX2), mainly in denaturing conditions. Indeed, based on {alpha}OTD and {alpha}OTX2 calibration experiments performed on HeLa cell extracts transfected with Otx2- and otd-expressing vectors and normalised for Otx2 and otd mRNAs, we strongly suspected that the OTD level detected (27%) was underestimated (data not shown). This was also supported by the quantitative analysis performed in Otx22c/Otx22c embryos at 7.5 d.p.c. (Fig. 8B), which showed that the OTX2 level was 37% and 85% of that detected in wild-type and Otx2+/– embryos, respectively. Hence, this analysis confirms that head abnormalities observed in otd2FL and Otx22c homozygous embryos are probably the consequence of a reduction in the amount of OTD and OTX2.

Next, we analysed whether otd2, otd2FL and Otx22c mRNAs were efficiently transcribed and processed. In order to compare wild-type and mutant mRNAs in the same cells, this analysis was performed in heterozygous embryos.

In these experiments, allele-specific probes (Fig. 1A, Fig. 6A) designed in the same region and of similar length were employed in order to minimise experimental heterogeneity. Compared to the Otx2 mRNA, the cytoplasmic otd2 mRNA detected in 10.5 d.p.c. embryos was considerably diminished (14%), while at 7.5 d.p.c. it was remarkably higher (32%) (Fig. 8E). In contrast, the amount of the nuclear otd2 mRNA was abnormally high, being up to 50% that of the Otx2 mRNA at 10.5 d.p.c and 90% at 7.5 d.p.c. (Fig. 8E).

The same analysis was performed in otd2FL/+ and Otx22c/+ embryos at 10.5 d.p.c. In these mutants cytoplasmic and nuclear mRNA levels decreased by approximately 60% and 50%, respectively (Fig. 8E).

Hence, as nuclear and cytoplasmic mRNAs underwent a similar reduction, nucleo-cytoplasmic export and processing should be unaffected in these embryos. In contrast, the remarkable accumulation of the nuclear otd2 mRNA suggests that nucleo-cytoplasmic export is heavily affected. This implies that sequences within the Otx2 5' and 3' UTRs play a relevant role in this process.

In this context, the quantitative reduction observed in otd2FL/+ and Otx22c/+ embryos should be ascribed to perturbation in transcription and/or stabilisation of the mutant mRNAs. Actinomycin D experiments performed on otd2/+, otd2FL/+ and Otx22c/+ ES cell lines indicated that the half-life of the mutant mRNAs was very similar to that of the Otx2 mRNA (t1/2=90 minutes) (Fig. 8F).

This suggests that lack of introns and insertion of the targeting vector may severely interfere with the transcription of the Otx2 locus and, thereby, be responsible for the partial rescue observed in otd2FL/otd2FL and Otx22c/Otx22c embryos.

Finally, the ability of otd2, otd2FL and Otx22c mRNAs to form efficient polyribosome complexes was studied. Cytoplasmic extracts from 10.5 d.p.c. otd2/+ heads were fractionated on a sucrose gradient and mRNA purified from each fraction. Distribution of ß-actin and Otx2 mRNAs along the gradient was analysed with the mutant mRNA. According to the length of ß-actin (350 amino acids) and OTX2 (289 amino acids) coding sequences, >=50% of their mRNAs was concentrated in the first two fractions that contained polyribosome complexes with >10 and 8-10 ribosomes (Fig. 9A,B). Similarly, the otd2 mRNA that encodes a 548 amino acid long protein should be concentrated in the fractions with the highest number of ribosomes, if efficiently translated. In contrast, approx. 60% of the otd2 mRNA was distributed among the central fractions of the gradient containing <=5-7 ribosomes. This finding indicates that the otd2 mRNA is severely affected in its ability to form efficient polyribosome complexes.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 9. otd2, otd2FL, Otx22c and hOtx1 mRNAs form polyribosome complexes with different efficiencies. (A) RNAse protection experiments showing the distribution of Otx2, otd2, otd2FL, Otx22c and ß-actin mRNAs along the fractions of polysome sucrose gradients. (B-D) Ribosome affinity profiles comparing the distribution of Otx2 and ß-actin mRNAs with that of otd2 (B), otd2FL (C) and Otx22c (D) mRNAs. (E) Quantitative analysis of hOtx1 cytoplasmic and nuclear mRNA showing a strong accumulation of nuclear RNA. (F) Ribosome affinity profile of the hOtx1 mRNA indicates a severe impairment in forming efficient polyribosome complexes. Note that mRNA profiles are not influenced by any quantitative variation of the mRNA analysed.

 
The same experiment was performed on otd2FL/+ and Otx22c/+ embryos (Fig. 9A,C,D). Importantly, in these embryos the otd2FL (Fig. 9A,C) and the Otx22c (Fig. 9A,D) mRNAs were correctly distributed and >=60% of the otd2FL mRNA was concentrated in the first two fractions (Fig. 9C) and >=60% of the Otx22c mRNA colocalised with the Otx2 mRNA. This result provides direct in vivo evidence that the Otx2 5' and 3' UTR sequences deleted in otd2 mutants are essential for both otd2FL and Otx22c mRNAs to be correctly translated.

Distribution and quantitative mRNA analysis as well as translational efficiency were also studied in the hOtx12 mutant. Indeed, also in this case lack of protein in the epiblast and its derivatives correlated with the deletion of the same Otx2 5' and 3' UTRs deleted in the otd2 mutant. In this mutant, the cytoplasmic hOtx1 mRNA was approx. 40% of the Otx2 mRNA, while the hOtx1 nuclear mRNA accumulated up to approx. 140% of the Otx2 nuclear mRNA (Fig. 9E). This indicates that impairment of nucleo-cytoplasmic export, identified in otd2 mutants, was also observed in hOtx12 mutant embryos. The ability of the hOtx1 mRNA to form polyribosome complexes was also greatly impaired and only <=25% of its mRNA was detected in the first two fractions where, based on the length of the protein (355 amino acids), most of the hOtx1 mRNA should be concentrated.

Therefore, also in the hOtx12 mutant, heavy accumulation of nuclear mRNA and impairment in translation correlate as in the otd2 mutant, with lack of Otx2 5' and 3' UTRs. This molecular analysis has demonstrated by both gain- and loss-of-function experiments in four different mouse models that the Otx2 5' and 3' UTRs are crucial in controlling nucleo-cytoplasmic export and translation of the Otx2 mRNA.

However, although these data cannot demonstrate whether the nucleo-cytoplasmic export is also affected only in the epiblast and neuroectoderm, they provide further support to the concept that murine brain development requires accurate epiblast-restricted translational control of the Otx2 mRNA.


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Until recently, it has been generally assumed that the insect and vertebrate CNS are non-homologous structures that evolved independently (Garstang, 1928; Lacalli, 1994).

For example, the so-called auricularia hypothesis postulates that the chordate CNS is homologous to the entire outer ectoderm of the insect embryo, based on both anatomical studies made in echinoderms (particularly auricularia larvae) and urochordates as well as on comparative expression of the HOX genes (Garstang, 1928; Lacalli, 1994). In contrast to such hypotheses, and beginning with the highly debated proposal by Geoffroy Saint-Hilaire (Lacalli, 1994; Peterson, 1995; Arendt and Nübler-Jung, 1999), an increasing body of evidence has now accumulated that suggests a common evolutionary origin of the insect and vertebrate CNS (Arendt and Nübler-Jung, 1996; Arendt and Nübler-Jung, 1999; De Robertis and Sasai, 1996).

A growing number of molecular genetic studies support the idea of a common evolutionary origin of the CNS in different phyla. In Drosophila and vertebrates, the conserved families of HOM-C/HOX, otd/Otx, empty spiracles (ems)/Emx as well as en/En and wingless (wg)/Wnt genes play a fundamental role in the regional specification of the neuroectoderm destined to form nerve cord/posterior brain and anterior brain as well as in the establishment of boundary regions between them (Joyner, 1996; Lumsden and Krumlauf, 1996; Hanks et al., 1998; Araki and Nakamura, 1999; Reichert and Simeone, 1999).

Despite the overall morphological differences, expression pattern and mutant phenotypes for Drosophila otd and mouse Otx genes can have obvious parallels.

Nevertheless, OTD and OTX proteins are highly conserved only in the homeodomain, which represents roughly one-tenth of the whole OTD protein and about one-sixth and one-fifth of OTX1 and OTX2 proteins, respectively (Simeone et al., 1993). This suggests that Otx genes have either acquired new functions during evolution and these reside outside the homeodomain or, alternatively, that the functional properties of the non-homeodomain regions are common to both OTD and OTX but they are difficult to identify in the amino acid sequence. This study and previous reports (Acampora et al., 1998a; Leuzinger et al., 1998; Nagao et al., 1998) indicate that, despite the restricted homology in their amino acid sequence, OTD/OTX proteins share a remarkable and unexpected functional equivalence in mice and flies.

Indeed, although an OTD-mediated rescue of OTX1 functions could be expected in neuronal cells (Acampora et al., 1998a), it is totally unexpected, in our opinion, that the fly gene is able to rescue OTX2-dependent properties that are encoded by the VE and neuroectoderm for early induction of the anterior patterning and maintenance of forebrain and midbrain regionalisation. It may suggest that even though OTD/OTX proteins have gained new role(s) during evolution, their basic properties have been retained. In this sense it is noteworthy that the absence of the lateral semicircular duct of the inner ear of Otx1–/– mice is never recovered either by otd or Otx2, thus indicating that the ability to specify this sensorial structure may, therefore, represent a new Otx1-specific property (Acampora et al., 1996; Acampora et al., 1998a; Acampora et al., 1999; Morsli et al., 1999). However, the molecular nature of functional equivalence between sequences outside the OTD/OTX homeodomain is still unclear and remains to be investigated in detail. Assuming that otd and Otx2 gene functions are conserved, it is unclear why the brain vesicles of protochordates have been so deeply and suddenly modified in a much more complex brain that has been maintained in its basic topography until mammals. A rather obvious answer to this question is that new genetic functions have been recruited and stabilised, thus creating new versions of pre-existing developmental pathways (Acampora and Simeone, 1999; Holland 1999; Acampora et al., 2001). Indeed, it might be that conserved functions such as those encoded by OTD/OTX proteins become able to perform new roles even while retaining an evolutionary functional equivalence because they acquire the ability to be expressed in new cell types. Based on this hypothesis, it is expected that drastic evolutionary events should act on the regulatory control (transcription and translation) of Otx-related genes rather than on their coding sequences.

Here, we report that OTD is functionally equivalent to OTX2 only when the OTD encoding mRNA is provided with the 5' and 3' UTRs of Otx2. This implies that besides the Otx2 transcriptional control, synthesis of OTD protein also requires the Otx2 regulatory control for nucleo-cytoplasmic export and, importantly, epiblast-specific translation of its mRNA. These functions were established when 213 bp of the 5' UTR and the 3' UTR were fused to the otd coding sequence. We have recently reported that mice carrying a 300 bp insertion in the Otx2-3' UTR exhibited epiblast-restricted impairment in the translation of the mutated Otx2 mRNA (Pilo Boyl et al., 2001). Here we have also shown that hOtx12 mutants, which lack the same Otx2 sequences that were absent in otd2 mutants, display identical molecular impairments. Together these data provided in vivo evidence of both gain and loss of protein synthesis in epiblast and neuroectoderm, depending on the presence of 5' and 3' UTRs of Otx2. While we have reported that the 3' UTR may be relevant in the translation of the Otx2 mRNA (Pilo Boyl et al., 2001), we believe that also the 5' UTR plays an important role in this control. This is supported by preliminary data indicating that mice lacking only 150 bp within the 213 bp long region deleted in otd mutants, develop a sharp headless phenotype (D. A. and A. S., unpublished results).

In sum, these data support the notion that otd/Otx functions have been established in a common ancestor of fly and mouse and retained throughout evolution, while regulatory control of their expression has been modified and re-adapted by evolutionary events that have led to the specification of the increasingly complex vertebrate brain (Sharman and Brand, 1998; Simeone, 1998; Acampora and Simeone, 1999; Reichert and Simeone, 1999).

A likely consequence of modification of regulatory control of gene expression may result in a greater number of molecular interactions. This may contribute to modifying relevant morphogenetic processes that, in turn, can confer a change in shape and size of the body plan as well as in the generation of cell types with new developmental potentials (Holland, 1999; Acampora and Simeone, 1999). On this basis, Otx gene duplication and subsequent or contemporary modification of regulatory control might have contributed to the evolution of the mammalian brain, for example by controlling the position of the midbrain-hindbrain boundary (MHB).

Previous work has indicated that Otx genes control the positioning of MHB (Simeone, 2000; Wurst and Bally-Cuif, 2001). Importantly, this control is strictly dependent on the level of OTX proteins in the neuroectoderm. Data presented in this study and those previously reported, clearly indicate that reduction in OTX levels is invariably reflected in anterior displacement of the MHB and progressive loss of forebrain and midbrain identities. Our data demonstrate that OTD protein may restore a quite normal positioning of the MHB, thus indicating that a crucial process in murine brain development can be performed by the invertebrate function.

Nevertheless, this process may occur only if the Otx2 regulatory control is provided. On this basis, we hypothesise that, once established, this control has been recruited and maintained throughout vertebrate head evolution.


    ACKNOWLEDGMENTS
 
We wish to thank Andrew Lumsden for critical reading of the manuscript and helpful discussions. We also thank A. Secondulfo and S. Piga for manuscript preparation, Amanda McGuigan and the staff for the excellent animal care. This work was supported by the MRC (Grant Number: G9900955), the Wellcome Trust (Grant Number: 062642/Z/00), the Italian Association for Cancer Research (AIRC), the EU BIOTECH programme (Number: BIO4-CT98-0309), the CNR Target Project on Biotechnology, the MURST-CNR Programme Legge 488/92 (cluster 02) and the Fondation Bettencourt Schueller.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Acampora, D. and Simeone, A. (1999). Understanding the roles of Otx1 and Otx2 in controlling brain morphogenesis. Trends Neurosci. 22, 116-122.[Medline]

Acampora, D., Mazan, S., Lallemand, Y., Avantaggiato, V., Maury, M., Simeone, A. and Brûlet, P. (1995). Forebrain and midbrain regions are deleted in Otx2–/– mutants due to a defective anterior neuroectoderm specifiction during gastrulation. Development 121, 3279-3290.[Abstract]

Acampora, D., Mazan, S., Avantaggiato, V., Barone, P., Tuorto, F., Lallemand, Y., Brûlet, P. and Simeone, A. (1996). Epilepsy and brain abnormalities in mice lacking Otx1 gene. Nature Genet. 14, 218-222.[Medline]

Acampora, D., Avantaggiato, V., Tuorto, F. and Simeone, A. (1997). Genetic control of brain morphogenesis through Otx gene dosage requirement. Development 124, 3639-3650.[Abstract]

Acampora, D., Avantaggiato, V., Tuorto, F., Barone, P., Reichert, H., Finkelstein, R. and Simeone, A. (1998a). Murine Otx1 and Drosophila otd genes share conserved genetic functions required in invertebrate and vertebrate brain development. Development 125, 1691-1702.[Abstract]

Acampora, D., Avantaggiato, V., Tuorto, F., Briata, P., Corte, G. and Simeone, A. (1998b). Visceral endoderm-restricted translation of Otx1 mediates recovering of Otx2 requirements for specification of anterior neural plate and proper gastrulation. Development 125, 5091-5104.[Abstract]

Acampora, D., Avantaggiato, V., Tuorto, F., Barone, P., Perera, M., Choo, D., Wu, D., Corte, G. and Simeone, A. (1999). Differential transcriptional control as the major molecular event in generating Otx1–/– and Otx2–/– divergent phenotypes. Development 126, 1417-1426.[Abstract]

Acampora, D., Gulisano, M., Broccoli, V. and Simeone, A. (2001). Otx genes in brain morphogenesis. Prog. Neurobiol. 64, 69-95[Medline]

Ang, S.-L., Jin, O., Rhinn, M., Daigle, N., Stevenson, L. and Rossant, J. (1996). Targeted mouse Otx2 mutation leads to severe defects in gastrulation and formation of axial mesoderm and to deletion of rostral brain. Development 122, 243-252.[Abstract]

Araki, I. and Nakamura, H. (1999). Engrailed defines the position of dorsal di-mesencephalon boundary by repressing diencephalic fate. Development 126, 5127-5135.[Abstract]

Arendt, D. and Nübler-Jung, K. (1996). Common ground plans in early brain development in mice and flies. BioEssays 18, 255-259.[Medline]

Arendt, D. and Nübler-Jung, K. (1999). Comparison of early nerve cord development in insects and vertebrates. Development 126, 2309-2325.[Abstract]

Beddington, R. S. and Robertson, E. J. (1999). Axis development and early asymmetry in mammals. Cell 96, 195-209.[Medline]

Briata, P., Di Blas, E., Gulisano, M., Mallamaci, A., Iannone, R., Boncinelli, E. and Corte, G. (1996). EMX1 homeoprotein is expressed in cell nuclei of the developing cerebral cortex and in the axons of the olfactory sensory neurons. Mech. Dev. 57, 169.[Medline]

Callaerts, P., Halder, G. and Gehring, W. J. (1997). Pax-6 in development and evolution. Annu. Rev. Neurosci. 20, 483-532.[Medline]

De Robertis, E. M. and Sasai, Y. (1996). A common plan for dorsoventral patterning in the Bilateria. Nature 380, 37-40.[Medline]

Finkelstein, R. and Boncinelli, E. (1994). From fly head to mammalian forebrain: the story of otd and Otx. Trends Genet. 10, 310-315.[Medline]

Garstang, W. (1928). The morphology of the Tunicata, and its bearing on the phylogeny of the Chordata. Q. J. Microsc. Sci. 72, 51-187.

Hanks, M. C., Loomis, C. A., Harris, E., Tong, C.-X., Cartwright, L., Auerbach, A. and Joyner, A. (1998). Drosophila engrailed can substitute for mouse Engrailed1 function in mid-hindbrain, but not limb development. Development 125, 4521-4530.[Abstract]

Hogan, B., Beddington, R., Costantini, F. and Lacy, E. (1994). In Manipulating the Mouse Embryo. A Laboratory Manual. 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Holland, P. W. H. (1999). The future of evolutionary developmental biology. Nature 402 Suppl. C41-C44.[Medline]

Joyner, A. L. (1996). Engrailed, Wnt and Pax genes regulate midbrain-hindbrain development. Trends Genet. 12, 15-20.[Medline]

Krumlauf, R. (1994). Hox genes in vertebrate development. Cell 78, 191-201.[Medline]

Lacalli, T. (1994). Apical organs, epithelial domains, and the origin of the chordate central nervous system. Amer. Zool. 34, 533-541.

Lemaire, P. and Kodjabachian, L. (1996). The vertebrate organizer: structure and molecules. Trends Genet. 12, 525-531.[Medline]

Leuzinger, S., Hirth, F., Gerlich, D., Acampora, D., Simeone, A., Gehring, W., Finkelstein, R., Furukubo-Tokunaga, K. and Reichert, H. (1998). Equivalence of the fly orthodenticle gene and the human OTX genes in embryonic brain development of Drosophila. Development 125, 1703-1710.[Abstract]

Lewis, E. B. (1978). A gene complex controlling segmentation in Drosophila. Nature 276, 565-570.[Medline]

Li, Y., Allende, M. L., Finkelstein, R. and Weinberg, E. S. (1994). Expression of two zebrafish orthodenticle-related genes in the embryonic forebrain. Mech. Dev. 48, 229-244.[Medline]

Liu, A., Losos, K. and Joyner, A. L. (1999). FGF8 can activate gbx2 and ransform regions of the rostral mouse brain into a hindbrain fate. Development 126, 4827-4838.[Abstract]

Loreni, F. and Amaldi, F. (1992). Translational regulation of ribosomal protein synthesis in Xenopus cultured cells: mRNA relocation between polysomes and RNA during nutritional shifts. Eur. J. Biochem. 205, 1027-1032.[Medline]

Lumsden, A. (1990). The cellular basis of segmentation in the developing hindbrain Trends Neurosci. 13, 329-335.[Medline]

Lumsden, A. and Krumlauf, R. (1996). Patterning the vertebrate neuraxis. Science 274, 1109-1115.[Abstract/Free Full Text]

Matsuo, I., Kuratani, S., Kimura, C., Takeda, N. and Aizawa, S. (1995). Mouse Otx2 functions in the formation and patterning of rostral head. Genes Dev. 9, 2646-2658.[Abstract/Free Full Text]

Morsli, H., Tuorto, F., Choo, D., Posiglione, M. P., Simeone, A. and Wu, D. K. (1999). Otx1 and Otx2 activities are required for the normal development of the mouse iner ear. Development 126, 2335-2343.[Abstract]

Nagao, T., Leuzinger, S., Acampora, D., Simeone, A., Finkelstein, R., Reichert, H. and Furukubo-Tokunaga, K. (1998). Developmental rescue of Drosophila cephalic defects by the human Otx genes. Proc. Natl. Acad. Sci. USA 95, 3737-3742.[Abstract/Free Full Text]

Peterson, K. J. (1995). Dorsoventral axis inversion. Nature 373, 111-112.[Medline]

Pilo Boyl, P., Signore, M., Acampora, D., Martinez-Barbera, J. P., Ilengo, C., Annino, A., Corte, G. and Simeone, A. (2001). Fore-midbrain development requires epiblast-restricted Otx2 translational control mediated by its 3' UTR. Development 128, 2989-3000.[Abstract/Free Full Text]

Reichert, H. and Simeone, A. (1999). Conserved usage of gap and homeotic genes in patterning the CNS. Curr. Opin. Neurobiol. 9, 589-595.[Medline]

Rhinn, M., Dierich, A., Shawlot, W., Behringer, R. R., Le Meur, M. and Ang, S.-L. (1998). Sequential roles for Otx2 in visceral endoderm and neuroectoderm for forebrain and midbrain induction and specification. Development 125, 845-856.[Abstract]

Rubenstein, J. L. R., Shimamura, K., Martinez, S. and Puelles, L. (1998). Regionalization of the prosencephalic neural plate. Annu. Rev. Neurosci. 21, 445-477.[Medline]

Sharman, A. C. and Brand, M. (1998). Evolution and homology of the nervous system: cross-phylum rescues of otd/Otx genes. Trends Genet. 14, 211-214.[Medline]

Simeone, A. (1998). Otx1 and Otx2 in the development and evolution of the mammalian brain. EMBO J. 17, 6970-6978.

Simeone, A. (1999). Detection of mRNA in tissue sections with radiolabelled riboprobes. In In Situ Hybridization. A Practical Approach. 2nd edition (ed. D. G. Wilkinson), pp. 69-86, Oxford: IRL, Oxford University Press.

Simeone, A. (2000). Positioning the isthmic organizer where Otx2 and Gbx2 meet. Trends Genet. 16, 237-240.[Medline]

Simeone, A., Acampora, D., Gulisano, M., Stornaiuolo, A. and Boncinelli, E. (1992). Nested expression domains of four homeobox genes in developing rostral brain. Nature 358, 687-690.[Medline]

Simeone, A., Acampora, D., Mallamaci, A., Stornaiuolo, A., D’apice, M. R., Nigro, V. and Boncinelli, E. (1993). A vertebrate gene related to orthodenticle contains a homeodomain of the bicoid class and demarcates anterior neuroectoderm in the gastrulating mouse embryo. EMBO J. 12, 2735-2747.[Medline]

Suda, Y., Matsuo, I. and Aizawa, S. (1997). Cooperation between Otx1 and Otx2 genes in developmental patterning of rostral brain. Mech. Dev. 69, 125-141.[Medline]

Wurst, W. and Bally-Cuif, L. (2001). Neural plate patterning: upstream and downstream of the isthmic organizer. Nature Rev. Neurosci. 2, 99-108[Medline]




This article has been cited by other articles: