|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
DEVELOPMENT AND DISEASE |
The Pulmonary Center, Boston University School of Medicine, 715 Albany Street, Boston, Massachusetts 02118, USA
*Author for correspondence (e-mail: dkotton{at}yahoo.com)
Accepted October 5, 2001
| SUMMARY |
|---|
|
|
|---|
and aquaporin-5. These observations challenge the current belief that adult alveolar type I epithelial cells invariably arise from local precursor cells and raise the possibility of using injected marrow-derived cells for therapy of lung diseases characterized by extensive alveolar damage.
Key words: Alveolar epithelium, Bone marrow, Stem cells, Type I pneumocytes
| INTRODUCTION |
|---|
|
|
|---|
To date, systemically injected mouse bone marrow-derived cells have been demonstrated to differentiate into parenchymal cells of various non-hematopoietic tissues including muscle, cartilage, bone, liver, heart, brain, intestine and lung (Alison et al., 2000; Eglitis and Mezey, 1997; Ferrari et al., 1998; Gussoni et al., 1999; Hou et al., 1999; Kopen et al., 1999; Krause et al., 2001; Lagasse et al., 2000; Nilsson et al., 1999; Orlic et al., 2001; Petersen et al., 1999; Prockop et al., 2000; Woodbury et al., 2000). The engrafted marrow cells are able to adopt the morphologic and molecular phenotype of their new resident organ. In the lung, bone marrow-derived cells have been detected in recipient lung tissue as fibroblast-type cells (Ding et al., 1999; Ono et al., 1999; Pereira et al., 1995; Pereira et al., 1998) and recently as differentiated bronchial epithelium and alveolar type II pneumocytes, raising the possibility of utilizing marrow to generate lung epithelium (Krause et al., 2001). The easy accessibility of bone marrow cells, along with their ability to adopt new phenotypes, has broad implications for disease therapy of many organ systems.
Fresh bone marrow cultured in plastic dishes can be separated into two general populations (Bianco and Robey, 2000; Phinney et al., 1999; Prockop, 1997). Cells that remain floating in the culture dish supernatant media are classical hematopoietic stem cells. Cells that adhere to the plastic culture dish grow into heterogeneous colonies of three discernible morphologic subtypes: small rounded cells positive for factor VIII antigen and CD-31 that may be of endothelial stem cell lineage, small stellate cells positive for mac-1/CD11b and CD-45 that are likely of myeloid lineage, and large polygonal fibroblast-like cells that synthesize matrix proteins such as collagen I, collagen IV, laminin and fibronectin (Conget and Minguell, 1999; Pittenger et al., 1999; Prockop, 1997). This latter cell type can serve as precursor for bone, muscle, fat and cartilage tissue (Bianco and Robey, 2000; Hou et al., 1999; Mackay et al., 1998; Nilsson et al., 1999; Phinney et al., 1999; Pittenger et al., 1999; Prockop, 1997), and can, under certain experimental conditions, transdifferentiate into non-mesodermal cell types (Kopen et al., 1999; Liechty et al., 2000; Prockop et al., 2000; Woodbury et al., 2000). A notable example of transdifferentiation is the adoption of a neural cell morphology and molecular phenotype during culturing (Woodbury et al., 2000) and following direct injection of these cells into the brain (Kopen et al., 1999).
We have explored the fate and phenotype of cultured plastic-adherent bone marrow cells that engraft in lung tissue. Our results demonstrate that engrafted cells can acquire the morphological and molecular features of type I cells of the alveolar epithelium. While limited engraftment occurs in the normal lung, we found that engraftment is facilitated after bleomycin-induced lung injury. These novel findings extend the list of differentiated cell types that bone marrow can adopt in vivo. In addition, they provide a new experimental model for characterizing the molecular signals that control lung epithelial cell differentiation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Bone marrow cell harvest
Whole marrow was harvested by flushing femurs, tibiae, and humeri with ice cold Dulbeccos Modified Eagle Medium (DMEM; Gibco, Grand Island, NY). Marrow cells were plated in plastic dishes at 106 cells/cm2 and re-fed every 2-3 days (DMEM with 10% FBS and 1% penicillin-streptomycin). Subconfluent plastic-adherent cultured cells were harvested at 1 week by trypsinization (0.25% trypsin/1 mM EDTA) for 5 minutes at 37°C followed by gentle scraping. Cells were collected by centrifugation (800 rpm) and washed with PBS.
Bleomycin-induced lung injury followed by bone marrow cell injection
Recipient mice were anesthetized and treated with intratracheal bleomycin (0.075 Units bleomycin in 0.1 ml PBS) or PBS alone. Plastic-adherent cultured bone marrow cells (1-2x106 in 0.2 ml PBS) were injected into the tail vein 5 days later. At 1, 2.5, 5, 14 or 30 days after marrow cell injection, mice were sacrificed by cervical dislocation followed by transection of the abdominal aorta.
Histological analysis of recipient lungs
Lungs were fixed for 15 minutes by instillating 0.25% glutaraldehyde in PBS (pH 7.4, 22°C) through a tracheal catheter. The fixative was removed before PBS lavage. X-gal solution (0.1% X-gal, 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 2 mM MgCl2 in PBS, pH 7.4) was instilled. After tracheal ligation, harvested lungs were incubated in X-gal solution overnight, washed with PBS, and fixed in 4% paraformaldehyde (Polysciences, Warrington, PA.) Intact lungs were screened under a dissecting microscope to localize engrafted blue-stained donor cells. Blue "dots" representing clusters of stained cells were microdissected, and embedded in paraffin or plastic (methyl methacrylate) and sectioned by standard methods. In addition, 20 random lung paraffin sections from the right lung of each recipient were processed for analysis.
Type I pneumocyte cell markers in engrafted cells
After sections containing lacZ-expressing cells were photographed, the coverslips were removed and the sections were processed for immunostaining or lectin binding. Before staining, sections were treated with hydrogen peroxide in methanol (0.3%, 15 minutes, 22°C) to quench endogenous peroxidases. For lectin binding, sections were incubated with 1% rabbit serum in PBS for 15 minutes, washed with PBS, and exposed to biotinylated Lycopersicon esculentum lectin (2 µg/ml; Vector Laboratories, Burlingame, CA) for 30 minutes. HRP-labeled avidin (5 µg/ml; Vector Laboratories) was applied for 30 minutes followed by the chromogen diaminobenzadine. The slides were counter-stained with Nuclear Fast Red. For T1
immunohistochemistry, antigen retrieval was performed by heating sections to 90°C in a citric acid buffer (antigen retrieval solution; Vector Laboratories) for 20 minutes, slowly cooling to room temperature, prior to quenching. Sections were blocked with 1% goat serum in PBS (60 minutes), incubated overnight (4°C) with a monoclonal hamster anti-mouse T1
antibody (Developmental Studies Hybridoma Bank, University of Iowa, Hybridoma #8.1.1, www.uiowa.edu/~dshbwww/, courtesy of Dr Andrew Farr) (Farr et al., 1992), and treated with HRP-labeled goat anti-hamster IgG (ICN, Costa Mesa, CA) for 30 minutes at room temperature. Signals were amplified using tyramide (TSA-Biotin System, NEN Life Science Products, Boston, MA) according to the manufacturers protocol before exposure to diaminobenzadine (6.5 minutes). Cell proliferation was assessed immunohistochemically by staining for proliferating cell nuclear antigen (PCNA), using an anti-PCNA antibody according to manufacturer instructions (PCNA Staining Kit, Zymed Laboratories, San Francisco, CA).
Polymerase chain reaction (PCR) analyses
PCR analysis for the lacZ/neomycin resistance gene (lacZ/neo) (Friedrich and Soriano, 1991) was performed on DNA extracted from recipient tissue using primers that span the fusion gene (forward primer: CCGCATCCCCTGCTGTCCCGTGCA, reverse primer: CTCCCCCAACCCCCTGTCTGCTGT; 94°C 30 seconds, 53°C 60 seconds, 72°C 60 seconds, 35 cycles). The identity of the 140 base pair PCR product was confirmed by sequencing. To assess fidelity of PCR, the mouse surfactant protein C gene (SP-C) was also amplified in each sample. Lung tissue from the donor B6,129GtRosa 26 mouse strain served as positive control and lung tissue from a wild-type recipient B6,129SF1 served as negative control.
Immunohistochemical staining of bone marrow cultures and whole bone
Bone marrow obtained as above was plated on plastic chambered slides (3.5x105 cells/well) (Lab-Tek 8 well chambered Permanox Slides, Naperville, IL,) and cultured as above. After 1 week, subconfluent adherent cultured cells were fixed with ice-cold 5% acetic acid in ethanol. Using the above staining methods, cells were immunostained for T1
protein expression. Whole murine femur was fixed in 4% paraformaldehyde, decalcified by immersion in Immunocal (Decal Chemical, Congers, NY) for 2 weeks before washing with deionized water, embedding in paraffin, sectioning and immunostaining for T1
.
Expression of lung epithelial mRNAs in bone marrow cells
10 µg of total RNA, isolated from fresh marrow aspirates and marrow cultured on plastic for 1 week was reverse transcribed (Promega Reverse Transcription System, Madison WI) before PCR amplification of T1
, aquaporin-5 (AQP-5), and surfactant protein-C (SP-C) cDNAs (forward primers: for T1
TGTGGACCGTGCCAGTGTTGTT, for AQP-5 CCTTATCCATTGGCTTGTCGG, for SP-C ATTACTCGGCAGGTCCCAGGAGCCA; reverse primers: for T1
TCATCTTCCTCCACAGGAAGAGGA, for AQP-5 TCTGAGCTGTGGCAGTCGTTC, for SP-C AGATATAGTAGAGTGGTAGCTCTCC; 94°C 30 seconds, 55°C 60 seconds, 72°C 60 seconds, 30 cycles). Using identical amplification conditions, nested PCR was subsequently performed with a second set of primers (forward primers for T1
for AAGGCACCTCTGGTACCAACG, for AQP-5 TCTTCTGGGTAGGACCGATCG, for SP-C TTGTGGTGGTGGTCCTCGTT; reverse primers for T1
ACAATGAAGATCCCTCCGACG, for AQP-5 GAGAGGTGCTCCAAACTCTTCGT, for SP-C AGGTCTCTCCCGGAAGAATC). The identity of bands was confirmed by size estimation and restriction mapping.
Statistical analysis
A recipient animal was defined as showing lung engraftment of donor-derived cells if at least one lacZ-expressing cell was found by X-gal staining. An engrafted cell cluster was arbitrarily defined as more than 3 engrafted cells seen in one high power field by X-gal staining. The proportion of animals in each group (bleomycin exposed versus PBS exposed) showing lung engraftment or showing cluster pattern engraftment was assessed by performing a Fishers exact test. P<0.05 was taken as a statistically significant difference.
| RESULTS |
|---|
|
|
|---|
|
Engraftment as type I pneumocytes
To examine the cell type of the lung-engrafted lacZ-positive cells, we performed a microscopic analysis of paraffin-embedded recipient lungs that contained blue X-gal-stained clusters (Fig. 2). These studies revealed clusters of flat blue lines along the alveolar surface. This morphology matches the normal location, size, and orientation of type I pneumoctyes of the alveolar epithelium (Fig. 2A,B). For better cellular definition, blue dots from injured recipient lungs were also embedded in plastic. Analysis of plastic sections (1-2 µm) confirmed that the lacZ-labeled donor cells had become flattened cells that lined alveoli, contained ovoid nuclei that bulged slightly into the alveolar lumen, and were located adjacent to type II cells. These are features that uniquely define type I pneumocytes of the alveolar epithelium (Dobbs et al., 1988) (Fig. 2D). In areas where engrafted type I cells abutted type II cells, the blue X-gal staining of the type I cell cytoplasm abruptly ceased at the type I-type II cell interface.
|
|
immunohistochemistry to assess expression of type I cell-specific markers on engrafted lacZ-expressing cells. We first examined lung engrafted cells for binding to the Lycopersicon esculentum lectin. In lung tissue, this lectin binds to the surface of type I pneumocytes, but does not bind to type II cells or lung endothelium (Bankston et al., 1991). A representative lung section containing engrafted cells subjected to lectin staining, is shown in Fig. 4. We found that all lung engrafted X-gal-stained cells bound Lycopersicon esculentum lectin.
|
in the engrafting cell population in recipient lungs. In normal rodent lung, this protein is expressed only in type I cells and is targeted to the apical surface (Cao et al., 2000; Danto et al., 1992; Ramirez et al., 1997; Rishi et al., 1995; Williams et al., 1996). The hamster anti-mouse T1
monoclonal antibody employed in this analysis has staining characteristics identical to T1
antibodies used on rat tissue, and as expected, specifically identifies a single protein of
38 kDa in homogenates of mouse lung (Y. X. Cao, M. I. Ramirez and M. C. W., unpublished). Immunostaining of lacZ-positive donor lungs (Fig. 5A-C) demonstrates that both lacZ and T1
markers can be identified on a single section and illustrates the typical linear staining pattern for a type I pneumocyte marker (Dobbs et al., 1988; Williams et al., 1996). Panels A-C establish the antigen specificity of this antibody after X-gal staining and re-confirm that the T1
protein is not expressed in type II pneumocytes (Fig. 5A), endothelium (Fig. 5B), and alveolar macrophages (Fig. 5C). We immunostained recipient lungs (Fig. 5D,E) and found that the blue engrafted donor cells express T1
, further evidence that these marrow-derived cells adopt molecular phenotypic features of type I pneumocytes.
|
|
|
Expression of type I pneumocyte markers in bone marrow cultures
Plastic-adherent cultures of donor bone marrow cells display three discernible morphologic subtypes (Fig. 8A). These include small rounded cells, small stellate cells and large polygonal fibroblast-like cells (Phinney et al., 1999; Wang and Wolf, 1990). To examine whether any of these cell types express type I pneumocyte markers during culturing, we performed T1
immunohistochemistry. Approximately 10% of cells are T1
positive after 1 week of culturing on plastic (Fig. 8B). T1
expression appears to be limited to cells with the morphology of the fibroblast-like cell sub-population, as shown by their polygonal shape (Fig. 8C). Within an aggregate of fibroblast-like cells, T1
expression is variable, as not all cells express this marker at detectable levels (Fig. 8D). For comparison, we immunostained cultures for a pan-endothelial marker (Leppink et al., 1989; Phinney et al., 1999). Consistent with reported work, this antigen is expressed in the small rounded cells that likely represent endothelial precursors; this sub-population was T1
negative (data not shown).
|
mRNA is expressed (Fig. 9). In addition, T1
mRNA is expressed in fresh bone marrow aspirates (Fig. 9). Aquaporin-5, another type I cell-specific marker (Funaki et al., 1998), is also expressed in both marrow cell preparations (Fig. 9). No signal was observed in either cell sample for surfactant protein C (SP-C) mRNA, a marker specific for alveolar type II cells (Fisher et al., 1989).
|
in bone marrow cells, we immunostained a decalcified murine femur embedded in paraffin. We found that a population of ovoid cells located in the bone immediately subjacent to the marrow cavity was T1
positive (Fig. 10). There were no cells within the marrow cavity that stained positive for T1
. These findings are in agreement with previous work showing that T1
is expressed in a subset of osteoblasts at the time of their encapsulation in the bony matrix (Wetterwald et al., 1996).
|
| DISCUSSION |
|---|
|
|
|---|
The distinct cellular localization, morphology and molecular features of the engrafted cells indicate that the engrafted cells express the type I pneumocyte phenotype, and the PCR data confirm that positive blue X-gal staining arises from locally expressed E. coli-derived lacZ. We considered the possibility that the observed staining patterns resulted from the diffusion of the X-gal reaction product from another cellular source. We did not detect, however, positive staining in any other cell type within the alveolus. This is consistent with previous work showing that cell-specific expression of lacZ in the alveolar epithelium remains localized and does not leak into neighboring cells. (Strayer et al., 1998). Since no staining was observed in lungs from animals that received wild-type bone marrow cells that do not carry the lacZ transgene, positive blue staining cannot be attributed to endogenous murine galactosidase expression. In keeping with these results, previous work showed that endogenous galactosidase activity is only observed at acidic pH (Dimri et al., 1995; Severino et al., 2000; Weiss et al., 1997; Weiss et al., 1999); notably all our experiments were performed at pH 7.4.
We found that animals exposed to bleomycin are more likely to show lung engraftment of bone marrow-derived cells than PBS-treated animals. The oxidative damage produced by bleomycin leads to both alveolar endothelial and epithelial injury, inflammatory exudation, and fibroblast recruitment which in turn lead to enhanced alveolar cell turnover, increased permeability, and localized release of effector substances (Adamson and Bowden, 1979). These events could all conceivably contribute to the engraftment process. In our studies, marrow cell injection coincided with the point at which bleomycin-induced edema and necrosis of alveolar endothelial cells has already occurred, and type I pneumocyte injury is just beginning.
We believe our findings differ from previous work on lung engraftement by Krause et al., because of significant differences in experimental protocols. Krause et al., demonstrated that an uncultured bone marrow-derived stem cell was able to achieve multi-lineage engraftment in irradiated recipient mice, including lung engraftment as bronchial epithelium and type II pneumocytes, 11 months after bone marrow transplantation (Krause et al., 2001). In contrast, we observed lung engraftment of marrow-derived cells only as type I pneumocytes and did not find detectable marrow engraftment. Our use of recipients with intact bone marrow, induction of lung injury with bleomycin, and selective expansion of plastic-adherent cells could all conceivably account for our unique results. These cells, expanded on plastic, constitute only a small percentage of normal marrow. In addition, their functions and phenotypes may be altered by culturing. Finally, whether the type of marrow-derived cell used by Krause et al., was present in our cultures is not known. Our results, therefore, are consistent with the possibility that marrow-derived cells can engraft as other lung phenotypes under different experimental conditions.
No donor-derived type II pneumocytes were detected at any time, but we cannot completely exclude the possibility that engrafted type II cells were present prior to the first time point we studied (24 hours). If donor-derived type II cells were present, they could serve as a transient amplifying population that subsequently gives rise to type I cells, as is known to be the case in lung injuries (Adamson and Bowden, 1974). This possibility seems unlikely, however, since type II cells are a self-renewing local stem cell population. Residual type II cells expressing the genomic lacZ marker should be present if type II cell engraftment had initially occurred. Indeed, previous work studying tritiated thymidine-labeled type II pneumocytes in vivo showed that type II daughter cells remain labeled even after one of the progeny has differentiated into a type I cell (Adamson and Bowden, 1974), and Krause et al.s report achieving marrow engraftment as type II cells showed these cells were detectable as early as 5 days and as late as 11 months after injection (Krause et al., 2001). It is also important to note that the type II cells in our X-gal-stained donor lungs constitutively express lacZ (Fig. 5A), indicating that any engrafted type II cell should similarly be detectable by X-gal staining.
We identified a clustered pattern of cell engraftment in injured lungs beginning 5 days after injection. These clusters could theoretically arise in several ways: a single marrow-derived cell might engraft in lung tissue and then clonally expand into a cell cluster, multiple individual cells might engraft separately in the same location, or a clump of injected cells could lodge in a lung vessel and engraft en masse. Our data do not yet distinguish between these possibilities. However, in preliminary work, we found no cell clusters present before 5 days after injection, and no cell clumps larger than 3 cells lodged in any pulmonary vessel. Furthermore, we found no evidence of proliferating engrafted cells studied by PCNA staining at 1, 2.5, and 5 days after injection, suggesting that clonal expansion may not be responsible for cluster formation. This clustered pattern of engraftment has also been observed in liver when marrow-derived cells engraft as differentiated hepatocytes during metabolically induced injury (Lagasse et al., 2000). Engraftment as cell clusters is therefore not unique to the lung.
These studies demonstrate that bone marrow cells are capable of expressing markers specific for type I cells, including T1
and aquaporin-5, and the RT-PCR data indicate the presence of T1
-expressing cells within aspirates prior to culturing. In cultured cells, we found T1
-expressing cells within colonies of cells with a polygonal morphology. This cell sub-type is believed to serve as pluripotent stem cells for muscle, bone, and fat (Phinney et al., 1999; Pittenger et al., 1999; Prockop, 1997). Colonies of these cells are believed to evolve in culture as a result of clonal expansion from a single adherent marrow cell (Bianco and Robey, 2000; Wang and Wolf, 1990). By immunostaining whole de-calcified bone, we found, as has been reported (Wetterwald et al., 1996), a T1
-positive long thin cell on the interior aspect of the bone facing the marrow cavity. These cells are believed to be osteoblasts or pre-osteocytes (Wetterwald et al., 1996). We do not yet know whether this cell was present in our original marrow aspirates and subsequently served as a precursor to the population of T1
-positive cultured cells.
The functional relationship between expression of type I pneumocyte markers by adherent bone marrow cells and engraftment potential in the alveolar epithelium is uncertain at this time. Our observations raise intriguing questions regarding the relative role of lung derived cues in establishing a lung epithelial phenotype. It is possible that cultured bone marrow-derived cells display certain features of lung differentiation prior to engraftment. It is also possible that multipotent marrow cells lose their engraftment potential as they express differentiation markers, such as T1
during culturing.
In conclusion, we believe that these studies provide a rationale for the eventual use of bone marrow progenitors in the treatment of conditions in which failure of the intrinsic regenerative capacity of damaged organs is a central pathological feature. In the lung, such an approach may be relevant for conditions associated with acute and extensive injury to the gas exchange surface.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adamson, I. Y. R. and Bowden, D. H. (1974). The type 2 cell as progenitor of alveolar epithelial regeneration. Lab. Invest. 30, 35-42.[Medline]
Adamson, I. Y. R. and Bowden, D. H. (1979). Bleomycin-induced injury and metaplasia of alveolar type 2 cells. Am. J. Pathol. 96, 531-544.[Abstract]
Alison, M. R., Poulsom, R., Jeffrey, R., Dhillon, A. P., Quaglia, A., Jacob, J., Novelli, M., Prentice, G., Williamson, J. and Wright, N. A. (2000). Hepatocytes from non-hepatic adult stem cells. Nature 406, 257-[Medline]
Bankston, P. W., Porter, G. A. and Milici, A. J. P. G. E. (1991). Differential and specific labeling of epithelial and vascular endothelial cells of the rat lung by Lycopersicon esculentum and Griffonia simplicifolia I lectins. Eur. J. Cell Biol. 54, 187-195.[Medline]
Bianco, P. and Robey, P. G. (2000). Marrow stromal stem cells. J. Clin. Invest. 105, 1663-1668.[Medline]
Cao, Y. X., Jean, J. C. and Williams, M. C. (2000). Cytosine methylation of an Sp1 site contributes to organ-specific and cell-specific regulation of expression of the lung epithelial gene T1
alpha. Biochem. J. 350, 883-890.
Conget, P. A. and Minguell, J. J. (1999). Phenotypical and functional properties of human bone marrow mesenchymal progenitor cells. J. Cell. Physiol. 181, 67-73.[Medline]
Danto, S. I., Zabski, S. M. and Crandall, E. D. (1992). Reactivity of alveolar epithelial cells in primary culture with type I cell monoclonal antibodies. Am. J. Respir. Cell. Mol. Biol. 6, 296-306.
Dimri, G. P., Lee, X., Basile, G., Acosta, M., Scott, G., Roskelley, C., Medrano, E. E., Linskens, M., Rubelj, I., Pereira-Smith, O. et al. (1995). A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl. Acad. Sci. USA 92, 9363-9367.
Ding, L., Lu, S., Batchu, R., III, R. S. and Munshi, N. (1999). Bone marrow stromal cells as a vehicle for gene transfer. Gene Ther. 6, 1611-1616.[Medline]
Dobbs, L. G., Williams, M. C. and Gonzalez, R. (1988). Monoclonal antibodies specific to apical surfaces of rat alveolar type I cells bind to surfaces of cultured, but not freshly isolated type II cells. Biochim. Biophys. Acta 970, 146-156.[Medline]
Eglitis, M. A. and Mezey, E. (1997). Hematopoietic cells differentiate into both microglia and macroglia in the brains of adult mice. Proc. Natl. Acad. Sci. USA 94, 4080-4085.
Farr, A. G., Berry, M. L., Kim, A., Nelson, A. J., Welch, M. P. and Aruffo, A. (1992). Characterization and cloning of a novel glycoprotein expressed by stromal cells in T-dependent areas of peripheral lymphoid tissues. J. Exp. Med. 176, 1477-1482.
Ferrari, G., Cusella-De Angelis, G., Coletta, M., Paolucci, E., Stornaiuolo, A., Cossu, G. and Mavilio, F. (1998). Muscle regeneration by bone marrow-derived myogenic progenitors [see comments] [published erratum appears in Science 1998 Aug 14;281 (5379):923]. Science 279, 1528-1530.
Fisher, J. H., Shannon, J. M., Hofmann, T. and Mason, R. J. (1989). Nucleotide and deduced amino acid sequence of the hydrophobic surfactant protein SP-C from rat: expression in alveolar type II cells and homology with SP-C from other species. Biochim. Biophys. Acta 995, 225-230.[Medline]
Friedrich, G. and Soriano, P. (1991). Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice. Genes Dev. 5, 1513-1523.
Funaki, H., Yamamoto, T., Koyama, Y., Kondo, D., Yaoita, E., Kawasaki, K., Kobayashi, H., Sawaguchi, S., Abe, H. and Kihara, I. (1998). Localization and expression of AQP5 in cornea, serous salivary glands, and pulmonary epithelial cells. Am. J. Physiol. 275, C1151-C1157.
Gussoni, E., Soneoka, Y., Strickland, C. D., Buzney, E. A., Khan, M. K., Flint, A. F., Kunkel, L. M. and Mulligan, R. C. (1999). Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature 401, 390-394.[Medline]
Hou, Z., Nguyen, Q., Frenkel, B., Nilsson, S. K., Milne, M., Van Wijnen, A. J., Stein, J. L., Quesenberry, P., Lian, J. B. and Stein, G. S. (1999). Osteoblast-specific gene expression after transplantation of marrow cells: implications for skeletal gene therapy. Proc. Natl. Acad. Sci. USA 96, 7294-7299.
Kopen, G. C., Prockop, D. J. and Phinney, D. G. (1999). Marrow stromal cells migrate throughout forebrain and cerebellum, and they differentiate into astrocytes after injection into neonatal mouse brains. Proc. Natl. Acad. Sci. USA 96, 10711-10716.
Krause, D. S., Theise, N. D., Collector, M. I., Henegariu, O., Hwang, S., Gardner, R., Neutzel, S. and Sharkis, S. J. (2001). Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 105, 369-377.[Medline]
Lagasse, E., Connors, H., Al-Dhalimy, M., Reitsma, M., Dohse, M., Osborne, L., Wang, X., Finegold, M., Weissman, J. L. and Grompe, M. (2000). Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat. Med. 6, 1229-1234.[Medline]
Lemischka, I. (1999). The power of stem cells reconsidered? Proc. Natl. Acad. Sci. USA 96, 14193-14195.
Leppink, D. M., Bishop, D. K., Sedmak, D. D., Henry, M. L., Ferguson, R. M., Streeter, P. R., Butcher, E. C. and Orosz, C. G. (1989). Inducible expression of an endothelial cell antigen on murine myocardial vasculature in association with interstitial cellular infiltration. Transplantation 48, 874-877.[Medline]
Liechty, K. W., MacKenzie, T. C., Shaaban, A. F., Radu, A., Moseley, A. M., Deans, R., Marshak, D. R. and Flake, A. W. (2000). Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation in sheep. Nat. Med. 6, 1282-1286.[Medline]
Mackay, A. M., Beck, S. C., Murphy, J. M., Barry, F. P., Chichester, C. O. and Pittenger, M. F. (1998). Chondrogenic differentiation of cultured human mesenchymal stem cells from marrow. Tissue Eng. 4, 415-428.[Medline]
Nilsson, S. K., Dooner, M. S., Weier, H. U., Frenkel, B., Lian, J. B., Stein, G. S. and Quesenberry, P. J. (1999). Cells capable of bone production engraft from whole bone marrow transplants in nonablated mice. J. Exp. Med. 189, 729-734.
Ono, K., Takii, T., Onozaki, K., Ikawa, M., Okabe, M. and Sawada, M. (1999). Migration of exogenous immature hematopoietic cells into adult mouse brain parenchyma under GFP-expressing bone marrow chimera. Biochem. Biophys. Res. Commun. 262, 610-614.[Medline]
Orlic, D., Kajstura, J., Chimenti, S., Jakoniuk, I., Anderson, S. M., Li, B., Pickel, J., McKay, R., Nadal-Ginard, B., Bodine, D. M., Leri, A. and Anversa, P. (2001). Bone marrow cells regenerate infarcted myocardium. Nature 410, 701-705.[Medline]
Pereira, R. F., Halford, K. W., OHara, M. D., Leeper, D. B., Sokolov, B. P., Pollard, M. D., Bagasra, O. and Prockop, D. J. (1995). Cultured adherent cells from marrow can serve as long-lasting precursor cells for bone, cartilage, and lung in irradiated mice. Proc. Natl. Acad. Sci. USA 92, 4857-4861.
Pereira, R. F., OHara, M. D., Laptev, A. V., Halford, K. W., Pollard, M. D., Class, R., Simon, D., Livezey, K. and Prockop, D. J. (1998). Marrow stromal cells as a source of progenitor cells for nonhematopoietic tissues in transgenic mice with a phenotype of osteogenesis imperfecta. Proc. Natl. Acad. Sci. USA 95, 1142-1147.
Petersen, B. E., Bowen, W. C., Patrene, K. D., Mars, W. M., Sullivan, A. K., Murase, N., Boggs, S. S., Greenberger, J. S. and Goff, J. P. (1999). Bone marrow as a potential source of hepatic oval cells. Science 284, 1168-1170.
Phinney, D. G., Kopen, G., Isaacson, R. L. and Prockop, D. J. (1999). Plastic adherent stromal cells from the bone marrow of commonly used strains of inbred mice: variations in yield, growth, and differentiation. J. Cell. Biochem. 72, 570-585.[Medline]
Pittenger, M. F., Mackay, A. M., Beck, S. C., Jaiswal, R. K., Douglas, R., Mosca, J. D., Moorman, M. A., Simonetti, D. W., Craig, S. and Marshak, D. R. (1999). Multilineage potential of adult human mesenchymal stem cells. Science 284, 143-147.
Prockop, D. J. (1997). Marrow stromal cells as stem cells for nonhematopoietic tissues. Science 276, 71-74.
Prockop, D. J., Azizi, S. A., Colter, D., Digirolamo, C., Kopen, G. and Phinney, D. G. (2000). Potential use of stem cells from bone marrow to repair the extracellular matrix and the central nervous system. Biochem. Soc. Trans. 28, 341-345.[Medline]
Ramirez, M. I., Rishi, A. K., Cao, Y. X. and Williams, M. C. (1997). TGT3, thyroid transcription factor I, and Sp1 elements regulate transcriptional activity of the 1.3-kilobase pair promoter of T1
alpha, a lung alveolar type I cell gene. J. Biol. Chem. 272, 26285-26294.
Rishi, A. K., Joyce-Brady, M., Fisher, J., Dobbs, L. G., Floros, J., VanderSpek, J., Brody, J. S. and Williams, M. C. (1995). Cloning, characterization, and development expression of a rat lung alveolar type I cell gene in embryonic endodermal and neural derivatives. Dev. Biol. 167, 294-306.[Medline]
Severino, J., Allen, R. G., Balin, S., Balin, A. and Cristofalo, V. J. (2000). Is beta-galactosidase staining a marker of senescence in vitro and in vivo? Exp. Cell Res. 257, 162-171.[Medline]
Strayer, M. S., Guttentag, S. H. and Ballard, P. L. (1998). Targeting type II and Clara cells for adenovirus-mediated gene transfer using the surfactant protein B promoter. Am. J. Respir. Cell Mol. Biol. 18, 1-11.
Wang, Q. R. and Wolf, N. S. (1990). Dissecting the hematopoietic microenvironment. VIII. Clonal isolation and identification of cell types in murine CFU-F colonies by limiting dilution. Exp. Hematol. 18, 355-359.[Medline]
Waseem, N. H. and Lane, D. P. (1990). Monoclonal antibody analysis of the proliferating cell nuclear antigen (PCNA). Structural conservation and the detection of a nucleolar form. J. Cell. Sci. 96, 121-129.
Weiss, D. J., Liggitt, D. and Clark, J. G. (1997). In situ histochemical detection of beta-galactosidase activity in lung: assessment of X-Gal reagent in distinguishing lacZ gene expression and endogenous beta-galactosidase activity. Hum. Gene Ther. 8, 1545-1554.[Medline]
Weiss, D. J., Liggitt, D. and Clark, J. G. (1999). Histochemical discrimination of endogenous mammalian beta-galactosidase activity from that resulting from lac-Z gene expression. Histochem. J. 31, 231-236.[Medline]
Wetterwald, A., Hoffstetter, W., Cecchini, M. G., Lanske, B., Wagner, C., Fleisch, H. and Atkinson, M. (1996). Characterization and cloning of the E11 antigen, a marker expressed by rat osteoblasts and osteocytes. Bone 18, 125-132.[Medline]
Williams, M. C., Cao, Y., Hinds, A., Rishi, A. K. and Wetterwald, A. (1996). T1
alpha protein is developmentally regulated and expressed by alveolar type I cells, choroid plexus, and ciliary epithelia of adult rats. Am. J. Respir. Cell. Mol. Biol. 14, 577-585.[Abstract]
Woodbury, D., Schwarz, E. J., Prockop, D. J. and Black, I. B. (2000). Adult rat and human bone marrow stromal cells differentiate into neurons. J. Neurosci. Res. 61, 364-370.[Medline]
This article has been cited by other articles:
![]() |
T. van Haaften, R. Byrne, S. Bonnet, G. Y. Rochefort, J. Akabutu, M. Bouchentouf, G. J. Rey-Parra, J. Galipeau, A. Haromy, F. Eaton, et al. Airway Delivery of Mesenchymal Stem Cells Prevents Arrested Alveolar Growth in Neonatal Lung Injury in Rats Am. J. Respir. Crit. Care Med., December 1, 2009; 180(11): 1131 - 1142. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kumamoto, T. Nishiwaki, N. Matsuo, H. Kimura, and K. Matsushima Minimally cultured bone marrow mesenchymal stem cells ameliorate fibrotic lung injury Eur. Respir. J., September 1, 2009; 34(3): 740 - 748. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Fritzell Jr., Q. Mao, S. Gundavarapu, T. Pasquariello, J. M. Aliotta, A. Ayala, J. F. Padbury, and M. E. De Paepe Fate and Effects of Adult Bone Marrow Cells in Lungs of Normoxic and Hyperoxic Newborn Mice Am. J. Respir. Cell Mol. Biol., May 1, 2009; 40(5): 575 - 587. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. M.A. Lombaert, J. F. Brunsting, P. K. Wierenga, H. H. Kampinga, G. de Haan, and R. P. Coppes Cytokine Treatment Improves Parenchymal and Vascular Damage of Salivary Glands after Irradiation Clin. Cancer Res., December 1, 2008; 14(23): 7741 - 7750. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. I. Peinado, S. Pizarro, and J. A. Barbera Pulmonary Vascular Involvement in COPD Chest, October 1, 2008; 134(4): 808 - 814. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Stripp Hierarchical Organization of Lung Progenitor Cells: Is there An Adult Lung Tissue Stem Cell? Proceedings of the ATS, August 15, 2008; 5(6): 695 - 698. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Krause Bone Marrow-derived Lung Epithelial Cells Proceedings of the ATS, August 15, 2008; 5(6): 699 - 702. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Summer and A. Fine Mesenchymal Progenitor Cell Research: Limitations and Recommendations Proceedings of the ATS, August 15, 2008; 5(6): 707 - 710. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Loebinger, E. K. Sage, and S. M. Janes Mesenchymal Stem Cells as Vectors for Lung Disease Proceedings of the ATS, August 15, 2008; 5(6): 711 - 716. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Nichols and J. Cortiella Engineering of a Complex Organ: Progress Toward Development of a Tissue-engineered Lung Proceedings of the ATS, August 15, 2008; 5(6): 723 - 730. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Liebler, C. Lutzko, A. Banfalvi, D. Senadheera, N. Aghamohammadi, E. D. Crandall, and Z. Borok Retention of human bone marrow-derived cells in murine lungs following bleomycin-induced lung injury Am J Physiol Lung Cell Mol Physiol, August 1, 2008; 295(2): L285 - L292. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kogo, T. Aiba, and T. Fujimoto Cell Type-specific Occurrence of Caveolin-1{alpha} and -1{beta} in the Lung Caused by Expression of Distinct mRNAs J. Biol. Chem., June 11, 2004; 279(24): 25574 - 25581. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Pitt and L. A. Ortiz Stem cells in lung biology Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L621 - L623. [Full Text] [PDF] |
||||
![]() |
R. Voswinckel, T. Ziegelhoeffer, M. Heil, S. Kostin, G. Breier, T. Mehling, R. Haberberger, M. Clauss, A. Gaumann, W. Schaper, et al. Circulating Vascular Progenitor Cells Do Not Contribute to Compensatory Lung Growth Circ. Res., August 22, 2003; 93(4): 372 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. M. Barbash, P. Chouraqui, J. Baron, M. S. Feinberg, S. Etzion, A. Tessone, L. Miller, E. Guetta, D. Zipori, L. H. Kedes, et al. Systemic Delivery of Bone Marrow-Derived Mesenchymal Stem Cells to the Infarcted Myocardium: Feasibility, Cell Migration, and Body Distribution Circulation, August 19, 2003; 108(7): 863 - 868. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Stenmark and S. A. Gebb Lung Vascular Development: Breathing New Life Into An Old Problem Am. J. Respir. Cell Mol. Biol., February 1, 2003; 28(2): 133 - 137. [Full Text] [PDF] |
||||
![]() |
J. E. Grove, C. Lutzko, J. Priller, O. Henegariu, N. D. Theise, D. B. Kohn, and D. S. Krause Marrow-Derived Cells as Vehicles for Delivery of Gene Therapy to Pulmonary Epithelium Am. J. Respir. Cell Mol. Biol., December 1, 2002; 27(6): 645 - 651. [Abstract] [Full Text] [PDF] |
||||
![]() |
Poster presentations Thorax, December 1, 2002; 57(90003): iii48 - 94. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||