|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
1 Department of Cell Biology and Molecular Genetics, 3236 H.J. Patterson Hall, University of Maryland, College Park, MD 20742, USA
2 Syngenta, 3054 Cornwallis Road, Research Triangle Park, NC 27709, USA
*Author for correspondence (e-mail: ZL17{at}umail.umd.edu)
Accepted 12 October 2001
| SUMMARY |
|---|
|
|
|---|
Key words: LEUNIG, AGAMOUS, APETALA2, Co-repressor, Flower development, LIM domain binding protein, Arabidopsis thaliana
| INTRODUCTION |
|---|
|
|
|---|
The regulation of the C class floral homeotic gene AGAMOUS (AG) is the most extensively studied. In ag loss-of-function mutants, stamens are replaced by petals, and carpels are replaced by a new flower. The generation of flowers within a flower reveals a second role of AG in maintaining the determinancy of the floral meristem (Bowman et al., 1989; Bowman et al., 1991; Mizukami and Ma, 1997). AG encodes a DNA-binding transcription factor of the MADS box family (Yanofsky et al., 1990; Huang et al., 1993). In wild-type, AG mRNA is only turned on at stage 3, when the sepal primordia just arise from the floral meristem (Smyth et al., 1990), and is only detected in the inner two whorls of a flower (Yanofsky et al., 1990; Drews et al., 1991). Its precise regulation requires the activity of both positive regulators LEAFY (LFY), APETALA1 (AP1) and WUSCHEL (WUS) and negative regulators such as LEUNIG (LUG) and APETALA2 (AP2) (Bowman et al., 1991; Drews et al., 1991; Weigel et al., 1992; Weigel and Meyerowitz, 1993; Liu and Meyerowitz, 1995; Lenhard et al., 2001; Lohmann et al., 2001). LFY and WUS were shown to bind directly to the second intron of AG and activate AG expression (Busch et al., 1999; Lohmann et al., 2001). However, the mechanism of negative regulation is less well understood.
LUG and AP2 are two main negative regulators of AG. In lug and ap2 mutants, AG mRNA is ectopically expressed in the outer two whorls of a flower, resulting in the homeotic transformation from sepals toward carpels, petals toward stamens, and a reduction in the number of floral organs in whorls 2 and 3 (Bowman et al., 1991; Drews et al., 1991; Liu and Meyerowitz, 1995). In addition, precocious expression of AG has been reported in ap2 and lug mutants (Drews et al., 1991; Liu and Meyerowitz, 1995). Using GUS reporter genes fused to the cis-regulatory sequences of AG, the expression of the AG::GUS reporter genes was examined in lug and ap2 mutants. This analysis indicated that LUG and AP2 regulate AG expression at the level of transcription through the second intron of AG (Sieburth and Meyerowitz, 1997; Bomblies et al., 1999; Deyholos and Sieburth, 2000). AP2 encodes a protein with two 68 amino acid repeats, dubbed the AP2 domain, that is predicted to perform functions of protein-protein dimerization and DNA binding (Jofuku et al., 1994; Riechmann and Meyerowitz, 1998; Nole-Wilson and Krizek, 2000). LUG encodes a glutamine-rich protein with seven WD repeats and was predicted to act as a transcriptional co-repressor (Conner and Liu, 2000). lug and ap2 mutations enhance each others effects with respect to floral organ identity transformation and floral organ loss (Liu and Meyerowitz, 1995). It has been proposed that LUG, the putative co-repressor, may be recruited by AP2, a DNA-binding transcription factor, to repress AG expression in the outer two whorls of a flower. Nevertheless, a lack of evidence indicating a direct physical interaction between LUG and AP2 suggests that AP2 and LUG might need other co-regulators to bridge their interactions. Alternatively, AP2 and LUG may regulate each other indirectly via other transcription factors. In either scenario, the identification of additional regulators of AG is necessary.
We report the isolation and analyses of a new gene SEUSS (SEU). We showed that SEU functions as a repressor of AG and is a candidate co-regulator of LUG. seu mutants exhibit a phenotype similar to lug. Additionally, seu genetically enhances both ap2 and lug in floral organ identity transformation and organ loss, and this effect of seu is mediated by an enhanced ectopic AG expression. SEU encodes a Q-rich protein with a putative dimerization domain, which was found in the LIM-domain-binding (Ldb) family of transcription co-regulators (Jurata and Gill, 1997). We propose that SEU may be required to mediate the interaction between LUG and AP2 so as to repress AG expression in the outer two whorls of a flower. The detection of other genes with sequence similarity to SEU in a wide variety of plant species points to a crucial role of SEU and SEUSS-LIKE genes in higher plant development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
LUG, AP2 and AG all reside on chromosome 4 in the following order: AP2 (16 cM) LUG (10 cM) AG. SEU resides on chromosome 1 (see below). To generate seu lug and seu ap2 double mutants, seu-1 homozygous flowers were fertilized with pollen from lug-1, lug-2, lug-3, lug-8, ap2-1 or ap2-2, respectively. Seeds were collected from F2 seu individuals (selected based on plant height and floral defects) and the respective double mutants were observed in 1/4 of the F3 plants. To generate the seu-1 lug-1 ag-1 triple mutants, ag-1/+ plants were fertilized with lug-1 pollen. F2 lug-1 plants were crossed to seu-1/seu-1; ap2-1/ap2-1 double mutants to generate seu-1/+; + lug-1 ag-1/ap2-1 + +. Approximately 10% of the F2 families from this second cross segregated lug-1 ag-1 double mutants in 3/16 of the progeny and the seu-1 lug-1 ag-1 triple mutant in 1/16 of the progeny. The genotype of the ag-1 lug-1 seu-1 triple mutant was confirmed by Co-Dominant Amplified Polymorphic Sequences (CAPS)- or dCAPS-based markers (Konieczny and Ausubel, 1993; Neff et al., 1998) developed for lug-1 and seu-1 (Table 1). To generate seu-1/seu-1; lug-1 +/+ ap2-1 plants, lug-1 individuals were crossed to seu-1 ap2-1 double mutants. F2 families segregated seu-1/seu-1; lug-1 +/+ ap2-1 individuals with an enhanced seu phenotype in 1/8 of the progeny. The genotypes of these plants were confirmed by CAPS or dCAPS markers developed for seu-1, ap2-1 and lug-1 (Table 1).
|
Positional cloning of SEU
A mapping population was generated by crossing seu-1/seu-1 of the Ler ecotype with wild-type Columbia (Col) ecotype. Genomic DNA was isolated from 305 of the F2 seu-1 plants and assayed by PCR-based markers. Linkage of SEU to the chromosome I markers GAPB and F16N3 led to the physical map (Fig. 5A). Finer mapping subsequently placed SEU 0.16 cM north of the marker F9L16Sp6 (Fig. 5A; Table 1). This placed SEU on the BAC clone F28H19 (AC006423). Sequencing and annotation by the Arabidopsis Genome Initiative predicts 13 open reading frames (ORFs) on F28H19. Among these ORFs is a glutamine-rich protein (F28H19.10). Fragments spanning the F28H19.10 ORF were amplified by PCR from seu-1 and seu-2 plants, respectively, and then directly sequenced. The mutational changes in the seu-1 and seu-2 alleles were confirmed by repeating the amplification and sequencing analysis.
|
Molecular analyses of SEU
A 5' rapid amplification of cDNA ends (5'RACE) was carried out using the 5' RACE kit-version 2.0 (Gibco/BRL). Three nested primers from the 5' gene-specific region of SEU were used: oligo 293, 5'AAACCACTAAACCCGACGTT3'; oligo 265, 5' GGGTCAGACTCAGCACCACT3'; oligo 178, 5'TATTTGGAGCATTCCCAAGC3'. 5'RACE products were cloned into pCRII-TOPO vector (Invitrogen) and sequenced. Blast searches identified six SEU EST clones. Five clones (AV521646, AV522370, AV531945, AV546257, AV553478) were provided by the Kazusa DNA Research Institute and one clone (AI997332) was purchased from Genome Systems Inc./Incyte Pharmaceuticals Inc. AV546257 is a full-length cDNA clone.
In situ experiments were performed as previously described (Liu et al., 2000). For northern analyses, total RNA was isolated using the Tri-reagent RNA isolation system (Sigma) from leaves and inflorescences containing flowers at all stages. mRNA was subsequently isolated from the total RNA using the polyATrack mRNA isolation system III (Promega). 2.5 µg mRNA was fractionated on 1% denaturing formaldehyde-agarose gels, blotted, hybridized and washed according to the method of Ausubel et al. (Ausubel et al., 1991). A 874 bp KpnI fragment corresponding to the 3' end of SEU (2685-3559 bp) was used as a probe.
| RESULTS |
|---|
|
|
|---|
|
|
|
seu genetically enhances lug
With the exception of the reduced plant height, the floral, ovule, and vegetative defects of seu mutants are similar to, but weaker than, those of lug. To understand the relationship between seu and lug, we generated and characterized seu lug double mutants. seu lug double mutant flowers display a dramatically enhanced phenotype characterized by a reduction in flower size and floral organ number and an enhanced carpelloidy of whorl 1 organs (Fig. 2B-D; Table 2). Most often, only two whorl 1 organs are formed. These whorl 1 organs are often carpelloid as evidenced by their epidermal cell morphology, the formation of horns (a character of lug carpels), and the expression of AG (see later). Whorl 2 organs are completely absent. In whorl 3, one stamen is occasionally formed, averaging 0.4 per flower. Whorl 4 carpels develop into a small stub or mound of tissues. Interestingly, structures derived from carpel marginal meristems (i.e. ovule, stigma, style, and septum) are not observed on whorl 1 carpelloid organs, nor on whorl 4 mounds (Fig. 2B,C). An exception to this is the seu-1 lug-8 double mutant (lug-8 is a weak allele) where some ovule primordia were occasionally observed in either whorl 1 organs or whorl 4 mounds (Fig. 2D). Vegetative defects were also enhanced in the seu lug double mutants (Fig. 1I). Although lug single mutations have no effect on plant height, seu-1 lug-1 double mutants are only 12% of wild-type height (2.7±0.9 cm; n=20), much shorter than seu-1 (11.4±1.6 cm; n=10). In summary, the seu lug double mutant flowers exhibit increased carpelloidy in whorl 1, enhanced organ loss in whorls 1-3, a reduction of whorl 4 gynoecium, and a loss of carpel marginal tissues. An overall reduction of flower size and plant height was also observed.
seu genetically enhances ap2
Since AP2 plays a major role in AG repression and ap2 interacts with lug synergistically (Bowman et al., 1991; Liu and Meyerowitz, 1995), we sought to determine the relationship between ap2 and seu. Both weak ap2-1 and strong ap-2-2 alleles were used for the analysis. The weak ap2-1 flower develops leaf-like whorl 1 organs and staminoid whorl 2 petals (Fig. 2E) (Bowman et al., 1989; Bowman et al., 1991). In seu-1 ap2-1 double mutants, first whorl organs are converted to carpelloid structures as evidenced by the presence of stigmatic tissue and ovule primordia and the absence of leaf-like trichomes (Fig. 2F). In the strong ap2-2 flowers, whorl 1 organs are carpelloid, whorl 2 and 3 organs are absent, and in whorl 4 a relatively normal gynoecium is formed (Fig. 2G) (Bowman et al., 1989; Bowman et al., 1991). Similar to ap2-2, seu-1 ap2-2 double mutant whorl 1 organs are carpelloid (Fig. 2H). However, the seu-1 ap2-2 whorl 1 carpels have less stigmatic tissue and fewer ovules than ap2-2. The most obvious difference between ap2-2 single mutant and seu-1 ap2-2 double mutant is in whorl 4 where only a small mound of tissue develops (Fig. 2H). Hence, seu enhances the defects of weak ap2-1 in homeotic transformation and organ loss and enhances the defects of strong ap2-2 primarily in the whorl 4 gynoecial development.
In the homozygous seu mutant background, the strong ap2-2 allele behaves as a dominant enhancer of seu. While seu-1/seu-1 plants display homeotic transformations in only 7.4% of whorl 1 organs, seu-1/seu-1; ap2-2/+ plants display homeotic transformations in 25% of whorl 1 organs (Table 2) with a greater degree of homeotic transformation (Fig. 2I,J). Furthermore, the lug-1 allele behaves as a dominant enhancer in the seu-1/seu-1; ap2-1/+ background. Carpelloid and staminoid transformations are observed in 38% of whorl 1 organs in seu-1/seu-1; lug-1 +/+ ap2-1 flowers (Table 2; Fig. 2, compare 2K,L with J). In summary, the degree of mutant severity with respect to homeotic transformation can be ordered as follows: seu-1/seu-1 < seu-1/seu-1; ap2-2/+ < seu-1/seu-1; lug-1 +/+ ap2-1 < ap2-2/ap2-2 (<: less severe than). Therefore, seu, lug and ap2 exhibit both synergistic and dominant genetic interactions.
AG is ectopically expressed in seu single and seu lug double mutants
To test if the carpelloid and stamenoid homeotic transformation of whorl 1 organs and the reduction of organ number observed in the seu single and seu lug double mutant flowers are primarily caused by the ectopic expression of AG, we examined AG mRNA expression by in situ hybridization. In wild-type flowers, AG mRNA is first detected at stage 3 in the center of a floral meristem (Fig. 3A) (Drews et al., 1991). In contrast, AG mRNA was sometimes detected in all four whorls in stage 3 seu flowers (Fig. 3B). Additionally, AG mRNA was sometimes detected in stage 2 seu-1 floral primordia (Fig. 3B). Thus, seu causes both ectopic and precocious AG mRNA expression. In seu-1 lug-8 double mutant flowers, the ectopic AG expression was enhanced as shown both by a greater extent of ectopic AG expression in whorl 1 organs and by a higher percentage of whorl 1 organs that express AG (Fig. 3C). Most strikingly, precocious AG expression was detected in floral meristems as early as stage 1 or even in groups of cells that are about to form the stage 1 floral meristem (ie. pre-stage 1 cells) (Fig. 3C). This stage 1/pre-stage 1 expression of AG was never observed in lug or seu single mutants.
|
|
In ag-1 flowers, the whorl 4 gynoecium is replaced by an indeterminate flower that repeats the (sepal-petal-petal)n pattern, generating an average of 43±3.5 organs interior to whorl 3. In contrast, the seu-1 lug-1ag-1 triple mutant averaged only 16.9±5.7 organs interior to whorl 3 (Table 2). The reduced floral organ number in whorl 4 of the triple mutant likely results from an additive effect of the floral indeterminancy caused by ag-1 and the reduced whorl 4 primordium caused by the seu-1 lug-1 (Fig. 2B-D; Fig. 3C).
The SEU gene encodes a glutamine-rich protein with a putative dimerization domain
We isolated the SEU gene by positional cloning (Fig. 5; Materials and Methods). SEU was first mapped to the centromeric region of chromosome 1, approximately 2.4 cM south of the marker GAPB. Finer mapping using additional CAPS markers (Fig. 5A; Table 1) indicated that SEU resides 0.16 cM north of the CAPS marker F9L16Sp6. Our recombination data from this region of chromosome I indicate that 0.16 cM represents approximately 40 kb, thus SEU likely resides on BAC clone F28H19. Sequencing and annotation of F28H19 (AC006423) by the Arabidopsis Genome Initiative indicated the presence of 13 ORFs on F28H19 that were north of the marker F9L16Sp6. Six of these appeared to encode portions of transposable elements. The seven remaining ORFs are: three hypothetical proteins, one unknown protein, one putative acyl-acyl carrier protein desaturase, one serine carboxypeptidase, and one glutamine-rich (Q-rich) protein (F28H19.10). Because Q-rich sequences are found in many transcriptional regulators including LUG, F28H19.10 ORF was a likely candidate for SEU. Sequence analysis of the F28H19.10 ORF in seu-1 and seu-2 genomic DNA identified mutations in both alleles. In the seu-1 allele, a C to T transition results in the change of a glutamine codon to a stop codon at amino acid 501 (Fig. 5B). In the seu-2 allele, a single base pair deletion in codon 343 leads to a frame shift (adding 54 novel amino acid residues) and a subsequent stop codon (Fig. 5B). The nature of the mutational changes found in seu-1 and seu-2 strongly supports that F28H19.10 encodes the SEU gene.
Using the F28H19.10 ORF sequence as a query in a TBlastN search, six SEU Arabidopsis EST clones were identified. Based on sequence analysis of these EST clones and 5' RACE, full length SEU cDNA is represented by two transcripts of 3555 bp and 3406 bp respectively. The shorter transcript initiates 149 bp downstream from the longer transcript. Northern analyses showed that the transcript levels in seu-1 and seu-2 mutants are reduced to 59% and 78% wild-type level respectively (Fig. 6A). This reduced mRNA level likely reflects a reduced mRNA stability in the two seu mutants, both of which are predicted to produce truncated SEU protein. Consistent with diverse developmental roles played by SEU, SEU mRNA is expressed in all tissues examined including flowers and leaves (Fig. 6B) as well as seedlings (data not shown).
|
helix (Fig. 7B). In addition, four hydrophobic residues spaced 7 residues apart within this region (Fig. 7B) suggest that this region may form a hydrophobic zipper.
|
| DISCUSSION |
|---|
|
|
|---|
The effects of seu mutations are most striking when combined with lug. More complete homeotic transformation in floral organs and a greater extent of floral organ loss are observed in the seu lug double mutants and are shown to be mediated by enhanced AG mis-expression. In particular, precocious AG expression was observed at stages as early as stage 1 and even pre-stage 1 in seu-1 lug-8 double mutant flowers. This stage 1/pre-stage 1 expression of AG was never observed in seu-1, lug-1, and ap2-2 single mutants, which cause precocious AG expression starting at stage 2 floral meristems (Drews et al., 1991; Liu and Meyerowitz, 1995; Liu et al., 2000). The stage 1/pre-stage 1 AG expression may underlie the dramatic reduction of floral organ number in the seu lug double mutants. Increased AG activity is known to repress floral organ initiation, particularly in whorls 2-3, and AG was postulated to prevent organ primordial initiation by inhibiting cell proliferation (Bowman et al., 1991). In addition, dominant genetic interactions between seu-1 and ap2-2 and among seu-1, ap2-1 and lug-1 were also observed. Dominant genetic interactions have been reported previously between lug and strong ap2-9 (Liu and Meyerowitz, 1995) and may indicate direct physical interactions or a common activity threshold among the interacting proteins.
SEU regulates other developmental processes independently of AG
Both LUG and AP2 have functions that are independent of AG. AP2 specifies sepal and petal identity, while LUG regulates floral organ and leaf shape and gynoecium and ovule development (Bowman et al., 1991; Liu and Meyerowitz, 1995; Roe et al., 1997; Schneitz et al., 1997; Chen et al., 2000; Liu et al., 2000). With the exception of defects in floral organ identity and organ number, many of the seu defects are not suppressed by removing AG activity. For example, seu ag double mutants still display reduced plant height and form narrow sepals and petals. In addition, in seu lug double mutants, a small mound of tissue develops in whorl 4 (Fig. 2B-D). This reduced whorl 4 phenotype appears AG-independent as the ag seu lug triple mutants have a much reduced number of whorl 4 organs in the indeterminate flower. Finally, the seu lug ag triple mutants develop canoe-shaped sepals and blade- or club-shaped petals (Fig. 4C,E,F), suggesting a synergistic interaction between seu and lug in regulating organ shape. Hence, in addition to repressing AG, SEU, together with LUG, may regulate additional target genes that determine plant height, organ shape and whorl 4 primordium formation.
What underlies these AG-independent defects of seu? Examination of petal cells in seu single and seu lug ag triple mutants by scanning electron microscopy indicated that the petal cell size is similar to that of wild type (R.G. F. and Z. L., unpublished data). Hence, the narrow organ shape, reduced plant height, and reduced whorl 4 organ primordia are consistent with a general reduction of cell number, and, perhaps, reflect a role of SEU in promoting cell proliferation. LUG was similarly proposed to have such a role in cell proliferation control (Liu et al., 2000).
SEUSS encodes a putative transcriptional co-repressor
seu mutants are similar to lug mutants in their phenotype, their synergistic and dominant interaction with ap2, their ability to negatively regulate AG, and their role in regulating organ shape and gyneocium development. These similarities suggest that SEU may function similarly to LUG. We showed that SEU does not encode a protein with significant sequence similarity to LUG. Rather, SEU encodes a Q-rich protein with a conserved domain that is similar to the dimerization domain of Ldb family of transcriptional co-regulators. Our finding that both the seu-1 and seu-2 mutation results in the truncation of the SEU protein in this conserved domain suggests that this domain is important for SEU function.
Ldb protein family members regulate transcription via direct physical interactions with DNA-binding transcription factors such as the LIM-homeodomain proteins (Agulnick et al., 1996; Bach et al., 1997; Jurata and Gill, 1997). In the M. musculus Ldb1 protein, the domain conserved between Ldb1 and SEU was predicted to form an amphipathic
helix and mediate homo-dimerization (Jurata and Gill, 1997). In addition, Ldb proteins contain a second domain, the LIM Interaction Domain (LID) (Fig. 7A), which mediates the interaction between Ldb proteins and the LIM-homeodomain proteins. However, there is no sequence similarity in the LID domain between SEU and members of the Ldb family.
SEUSS-LIKE genes are found in Arabidopsis, rice, soybean, corn, pine and other plant species and define a novel family of plant regulatory proteins. With the exception of SEU, the function of other family members is not known. Our genetic and molecular analysis of seu is beginning to shed light on the function of this novel family of plant regulators. Furthermore, using a reverse genetic approach, we will be able to test whether the two Arabidopsis SEUSS-LIKE genes play redundant roles with SEU.
A proposed model
Based on our genetic and molecular analyses, we propose that SEU is a co-regulator of LUG. The domain structure of LUG is similar to that of a class of functionally related transcriptional co-repressors including Tup1 of yeast, Groucho of Drosophila and TLE (Transducin-like Enhancer of split) in mammals (Hartley et al., 1988; Williams and Trumbly, 1990; Parkhurst, 1998; Conner and Liu, 2000). In yeast, the Tup1 co-repressor is brought to target promoters by sequence-specific DNA-binding proteins and regulates a wide array of independent sets of genes such as a-cell specific genes, glucose-repressed genes, flocculation genes, and DNA-damage-induced genes (Roth, 1995; Teunissen et al., 1995). The N-terminal portion of Tup1 forms a repression complex with Ssn6, a tetratricopeptide repeat protein (Keleher et al., 1992), which is needed to facilitate the interaction between Tup1 and the corresponding DNA-binding transcription factors (Tzamarias and Struhl, 1994).
If LUG acts via a mechanism similar to Tup1, could SEU be the Arabidopsis equivalent of Ssn6? Although SEU does not share sequence similarity with Ssn6, both SEU and Ssn6 possess Q-rich domains, lack a DNA-binding motif, and contain a putative protein-protein interaction domain. Both seu and ssn6 mutants are pleiotropic in phenotype. The distinct molecular identity but similar genetic function between SEU and LUG also support that SEU and LUG may work together by forming a co-repressor complex. Preliminary experiments indicate that SEU interacts with LUG in the yeast two-hybrid system (A. Surendrarao, R. G. F. and Z. L., unpublished data). Hence, our current working model predicts that by interacting with DNA-binding transcription factors that bind to AG cis-elements, the putative SEU/LUG co-repression complexes are recruited to repress AG expression in the outer two whorls of a flower. Candidate DNA-binding factors include, but are not limited to, AP2. This model could explain the synergistic and dominant genetic interactions among ap2, seu and lug. The molecular isolation of LUG (Conner and Liu, 2000), AP2 (Jofuku et al., 1994), and SEU (reported here) will allow us to further test these hypotheses. Other molecular and biochemical analyses will increase our understanding of the transcriptional repression mechanism in higher plants.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| REFERENCES |
|---|
|
|
|---|
Agulnick, A. D., Taira, M., Breen, J. J., Tanaka, T., Dawid, I. B. and Westphal, H. (1996). Interactions of the LIM-domain-binding factor Ldb1 with LIM homeodomain proteins. Nature 384, 270-272.[Medline]
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K. (1991). Current Protocols in Molecular Biology. New York: Wiley and Sons.
Bach, I., Carriere, C., Ostendorff, H. P., Andersen, B. and Rosenfeld, M. G. (1997). A family of LIM domain-associated cofactors confer transcriptional synergism between LIM and Otx homeodomain proteins. Genes Dev. 11, 1370-1380.
Bomblies, K., Dagenais, N. and Weigel, D. (1999). Redundant enhancers mediate transcriptional repression of AGAMOUS by APETALA2. Dev. Biol. 216, 260-264.[Medline]
Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M. (1989). Genes directing flower development in Arabidopsis. Plant Cell 1, 37-52.
Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M. (1991). Genetic interactions among floral homeotic genes of Arabidopsis. Development 112, 1-20.[Abstract]
Busch, M. A., Bomblies, K. and Weigel, D. (1999). Activation of a floral homeotic gene in Arabidopsis. Science 285, 585-587.
Chen, C., Wang, S. and Huang, H. (2000). LEUNIG has multiple functions in gynoecium development in Arabidopsis. Genesis 26, 42-54.[Medline]
Coen, E. S. and Meyerowitz, E. M. (1991). The war of the whorls: genetic interactions controlling flower development. Nature 353, 31-37.[Medline]
Conner, J. and Liu, Z. (2000). LEUNIG, a putative transcriptional corepressor that regulates AGAMOUS expression during flower development. Proc. Natl. Acad. Sci. USA 97, 12902-12907.
Deyholos, M. K. and Sieburth, L. E. (2000). Separable whorl-specific expression and negative regulation by enhancer elements within the AGAMOUS second intron. Plant Cell 12, 1799-1810.
Drews, G. N., Bowman, J. L. and Meyerowitz, E. M. (1991). Negative regulation of the Arabidopsis homeotic gene AGAMOUS by the APETALA2 product. Cell 65, 991-1002.[Medline]
Eshed, Y., Baum, S. F. and Bowman, J. L. (1999). Distinct mechanisms promote polarity establishment in carpels of Arabidopsis. Cell 99, 199-209.[Medline]
Goto, K. and Meyerowitz, E. M. (1994). Function and regulation of the Arabidopsis floral homeotic gene PISTILLATA. Genes Dev. 8, 1548-1560.
Hartley, D. A., Preiss, A. and Artavanis-Tsakonas, S. (1988). A deduced gene product from the Drosophila neurogenic locus, enhancer of split, shows homology to mammalian G-protein beta subunit. Cell 55, 785-795.[Medline]
Huang, H., Mizukami, Y., Hu, Y. and Ma, H. (1993). Isolation and characterization of the binding sequences for the product of the Arabidopsis floral homeotic gene AGAMOUS. Nucleic Acids Res. 21, 4769-4776.
Jack, T., Brockman, L. L. and Meyerowitz, E. M. (1992). The homeotic gene APETALA3 of Arabidopsis thaliana encodes a MADS box and is expressed in petals and stamens. Cell 68, 683-697.[Medline]
Jofuku, K. D., den Boer, B. G., Van Montagu, M. and Okamuro, J. K. (1994). Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell 6, 1211-1225.[Abstract]
Jurata, L. W. and Gill, G. N. (1997). Functional analysis of the nuclear LIM domain interactor NLI. Mol. Cell. Biol. 17, 5688-5698.[Abstract]
Keleher, C. A., Redd, M. J., Schultz, J., Carlson, M. and Johnson, A. D. (1992). Ssn6-Tup1 is a general repressor of transcription in yeast. Cell 68, 709-719.[Medline]
Konieczny, A. and Ausubel, F. M. (1993). A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J. 4, 403-410.[Medline]
Lenhard, M., Bohnert, A., Jurgens, G. and Laux, T. (2001). Termination of stem cell maintenance in Arabidopsis floral meristems by interactions between WUSCHEL and AGAMOUS. Cell 105, 805-814.[Medline]
Levin, J. Z., Fletcher, J. C., Chen, X. and Meyerowitz, E. M. (1998). A genetic screen for modifiers of UFO meristem activity identifies three novel FUSED FLORAL ORGANS genes required for early flower development in Arabidopsis. Genetics 149, 579-595.
Lohmann, J. U., Hong, R. L., Hobe, M., Busch, M. A., Parcy, F., Simon, R. and Weigel, D. (2001). A molecular link between stem cell regulation and floral patterning in Arabidopsis. Cell 105, 793-803.[Medline]
Liu, Z., Franks, R. G. and Klink, V. P. (2000). Regulation of gynoecium marginal tissue formation by LEUNIG and AINTEGUMENTA. Plant Cell 12, 1879-1892.
Liu, Z. and Meyerowitz, E. M. (1995). LEUNIG regulates AGAMOUS expression in Arabidopsis flowers. Development 121, 975-991.[Abstract]
Mandel, M. A., Gustafson-Brown, C., Savidge, B. and Yanofsky, M. F. (1992). Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature 360, 273-277.[Medline]
Mizukami, Y. and Ma, H. (1997). Determination of Arabidopsis floral meristem identity by AGAMOUS. Plant Cell 9, 393-408.[Abstract]
Neff, M. M., Neff, J. D., Chory, J. and Pepper, A. E. (1998). dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: experimental applications in Arabidopsis thaliana genetics. Plant J. 14, 387-392.[Medline]
Nole-Wilson, S. and Krizek, B. A. (2000). DNA binding properties of the Arabidopsis floral development protein AINTEGUMENTA. Nucleic Acids Res. 28, 4076-4082.
Parkhurst, S. M. (1998). Groucho: making its Marx as a transcriptional co-repressor. Trends Genet. 14, 130-132.[Medline]
Riechmann, J. L. and Meyerowitz, E. M. (1998). The AP2/EREBP family of plant transcription factors. Biol. Chem. 379, 633-646.[Medline]
Robbins, J., Dilworth, S. M., Laskey, R. A. and Dingwall, C. (1991). Two interdependent basic domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence. Cell 64, 615-623.[Medline]
Roe, J. L., Nemhauser, J. L. and Zambryski, P. C. (1997). TOUSLED participates in apical tissue formation during gynoecium development in Arabidopsis. Plant Cell 9, 335-353.[Abstract]
Roth, S. Y. (1995). Chromatin-mediated transcriptional repression in yeast. Curr. Opin. Genet. Dev. 5, 168-173.[Medline]
Schneitz, K., Hulskamp, M., Kopczak, S. D. and Pruitt, R. E. (1997). Dissection of sexual organ ontogenesis: a genetic analysis of ovule development in Arabidopsis thaliana. Development 124, 1367-1376.[Abstract]
Sieburth, L. E. and Meyerowitz, E. M. (1997). Molecular dissection of the AGAMOUS control region shows that cis elements for spatial regulation are located intragenically. Plant Cell 9, 355-365.[Abstract]
Smyth, D. R., Bowman, J. L. and Meyerowitz, E. M. (1990). Early flower development in Arabidopsis. Plant Cell 2, 755-767.
Teunissen, A. W., van den Berg, J. A. and Steensma, H. Y. (1995). Transcriptional regulation of flocculation genes in Saccharomyces cerevisiae. Yeast 11, 435-446.[Medline]
Tzamarias, D. and Struhl, K. (1994). Functional dissection of the yeast Cyc8-Tup1 transcriptional co-repressor complex. Nature 369, 758-761.[Medline]
Weigel, D., Alvarez, J., Smyth, D. R., Yanofsky, M. F. and Meyerowitz, E. M. (1992). LEAFY controls floral meristem identity in Arabidopsis. Cell 69, 843-859.[Medline]
Weigel, D. and Meyerowitz, E. M. (1993). Activation of floral homeotic genes in Arabidopsis. Science 216, 1723-1726.
Weigel, D. and Meyerowitz, E. M. (1994). The ABCs of floral homeotic genes. Cell 78, 203-209.[Medline]
Williams, F. E. and Trumbly, R. J. (1990). Characterization of TUP1, a mediator of glucose repression in Saccharomyces cerevisiae. Mol. Cell Biol. 10, 6500-6511.
Yanofsky, M. F., Ma, H., Bowman, J. L., Drews, G. N., Feldmann, K. A. and Meyerowitz, E. M. (1990). The protein encoded by the Arabidopsis homeotic gene AGAMOUS resembles transcription factors. Nature 346, 35-39.[Medline]
This article has been cited by other articles:
![]() |
A. T. Maier, S. Stehling-Sun, H. Wollmann, M. Demar, R. L. Hong, S. Haubeiss, D. Weigel, and J. U. Lohmann Dual roles of the bZIP transcription factor PERIANTHIA in the control of floral architecture and homeotic gene expression Development, May 15, 2009; 136(10): 1613 - 1620. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shibuya, S. Fukushima, and H. Takatsuji RNA-directed DNA methylation induces transcriptional activation in plants PNAS, February 3, 2009; 106(5): 1660 - 1665. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sitaraman, M. Bui, and Z. Liu LEUNIG_HOMOLOG and LEUNIG Perform Partially Redundant Functions during Arabidopsis Embryo and Floral Development Plant Physiology, June 1, 2008; 147(2): 672 - 681. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, Y. Liu, K. Bruffett, J. Lee, G. Hause, J. C. Walker, and S. Zhang Haplo-Insufficiency of MPK3 in MPK6 Mutant Background Uncovers a Novel Function of These Two MAPKs in Arabidopsis Ovule Development PLANT CELL, March 1, 2008; 20(3): 602 - 613. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Azhakanandam, S. Nole-Wilson, F. Bao, and R. G. Franks SEUSS and AINTEGUMENTA Mediate Patterning and Ovule Initiation during Gynoecium Medial Domain Development Plant Physiology, March 1, 2008; 146(3): 1165 - 1181. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Liu, J. Zhou, K. Bracha-Drori, S. Yalovsky, T. Ito, and H. Yu Specification of Arabidopsis floral meristem identity by repression of flowering time genes Development, May 15, 2007; 134(10): 1901 - 1910. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Balanza, M. Navarrete, M. Trigueros, and C. Ferrandiz Patterning the female side of Arabidopsis: the importance of hormones J. Exp. Bot., October 1, 2006; 57(13): 3457 - 3469. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. V. Sridhar, A. Surendrarao, and Z. Liu APETALA1 and SEPALLATA3 interact with SEUSS to mediate transcription repression during flower development Development, August 15, 2006; 133(16): 3159 - 3166. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Enkhmandakh, A. V. Makeyev, and D. Bayarsaihan The role of the proline-rich domain of Ssdp1 in the modular architecture of the vertebrate head organizer PNAS, August 1, 2006; 103(31): 11631 - 11636. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nole-Wilson and B. A. Krizek AINTEGUMENTA Contributes to Organ Polarity and Regulates Growth of Lateral Organs in Combination with YABBY Genes Plant Physiology, July 1, 2006; 141(3): 977 - 987. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Gregis, A. Sessa, L. Colombo, and M. M. Kater AGL24, SHORT VEGETATIVE PHASE, and APETALA1 Redundantly Control AGAMOUS during Early Stages of Flower Development in Arabidopsis PLANT CELL, June 1, 2006; 18(6): 1373 - 1382. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Ding, N.-Y. Liu, Z.-S. Tang, J. Liu, and W.-C. Yang Arabidopsis GLUTAMINE-RICH PROTEIN23 Is Essential for Early Embryogenesis and Encodes a Novel Nuclear PPR Motif Protein That Interacts with RNA Polymerase II Subunit III PLANT CELL, April 1, 2006; 18(4): 815 - 830. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Xing, M. G. Rosso, and S. Zachgo ROXY1, a member of the plant glutaredoxin family, is required for petal development in Arabidopsis thaliana Development, April 1, 2005; 132(7): 1555 - 1565. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Smyth Morphogenesis of Flowers--Our Evolving View PLANT CELL, February 1, 2005; 17(2): 330 - 341. [Full Text] [PDF] |
||||
![]() |
J. Pfluger and P. Zambryski The role of SEUSS in auxin response and floral organ patterning Development, October 1, 2004; 131(19): 4697 - 4707. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. V. Sridhar, A. Surendrarao, D. Gonzalez, R. S. Conlan, and Z. Liu Transcriptional repression of target genes by LEUNIG and SEUSS, two interacting regulatory proteins for Arabidopsis flower development PNAS, August 3, 2004; 101(31): 11494 - 11499. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Navarro, N. Efremova, J. F. Golz, R. Rubiera, M. Kuckenberg, R. Castillo, O. Tietz, H. Saedler, and Z. Schwarz-Sommer Molecular and genetic interactions between STYLOSA and GRAMINIFOLIA in the control of Antirrhinum vegetative and reproductive development Development, August 1, 2004; 131(15): 3649 - 3659. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Cnops, S. Jover-Gil, J. L. Peters, P. Neyt, S. De Block, P. Robles, M. R. Ponce, T. Gerats, J. L. Micol, and M. Van Lijsebettens The rotunda2 mutants identify a role for the LEUNIG gene in vegetative leaf morphogenesis J. Exp. Bot., July 1, 2004; 55(402): 1529 - 1539. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Benedito, P. B. Visser, J. M. van Tuyl, G. C. Angenent, S. C. de Vries, and F. A. Krens Ectopic expression of LLAG1, an AGAMOUS homologue from lily (Lilium longiflorum Thunb.) causes floral homeotic modifications in Arabidopsis J. Exp. Bot., June 1, 2004; 55(401): 1391 - 1399. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Bao, R. G. Franks, J. Z. Levin, and Z. Liu Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems PLANT CELL, June 1, 2004; 16(6): 1478 - 1489. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jack Molecular and Genetic Mechanisms of Floral Control PLANT CELL, June 1, 2004; 16(suppl_1): S1 - S17. [Full Text] [PDF] |
||||
![]() |
D. J. Skinner, T. A. Hill, and C. S. Gasser Regulation of Ovule Development PLANT CELL, June 1, 2004; 16(suppl_1): S32 - S45. [Full Text] [PDF] |
||||
![]() |
W. Ni, D. Xie, L. Hobbie, B. Feng, D. Zhao, J. Akkara, and H. Ma Regulation of Flower Development in Arabidopsis by SCF Complexes Plant Physiology, April 1, 2004; 134(4): 1574 - 1585. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Mayama, E. Ohtsubo, and S. Tsuchimoto Isolation and Expression Analysis of Petunia CURLY LEAF-Like Genes Plant Cell Physiol., August 15, 2003; 44(8): 811 - 819. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Durfee, J. L. Roe, R. A. Sessions, C. Inouye, K. Serikawa, K. A. Feldmann, D. Weigel, and P. C. Zambryski The F-box-containing protein UFO and AGAMOUS participate in antagonistic pathways governing early petal development in Arabidopsis PNAS, July 8, 2003; 100(14): 8571 - 8576. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. van Meyel, J. B. Thomas, and A. D. Agulnick Ssdp proteins bind to LIM-interacting co-factors and regulate the activity of LIM-homeodomain protein complexes in vivo Development, May 1, 2003; 130(9): 1915 - 1925. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||