|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
Department of Molecular Biology, Princeton University, Princeton, NJ 08544, USA and Department of Organismal Biology and Anatomy, University of Chicago, Chicago, IL 60637, USA
*Author for correspondence (e-mail: aoates{at}midway.uchicago.edu)
Accepted 25 March 2002
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Zebrafish, Somitogenesis, Segmentation, Cyclic genes, Oscillator, Delta/Notch signaling, her7, her1, dlc, Boundary formation, Genetic redundancy
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Holley et al., 2000; Hrabe de Angelis et al., 1997; Kusumi et al., 1998), in transmembrane receptors of the Notch family (Conlon et al., 1995; Krebs et al., 2000) or in components of the signal transduction pathway from the Notch receptor (Donoviel et al., 1999; Evrard et al., 1998; Oka et al., 1995; Shen et al., 1997; Wong et al., 1997; Zhang and Gridley, 1998) result in aberrant somitogenesis. These defects are visible as irregularly shaped somites with bilaterally asymmetrical boundaries and a loss of rostrocaudal polarity within each somite. An important feature of these mutant phenotypes is that as increasingly posterior somites are made, the severity of the defects increases.
In Drosophila and vertebrates, Delta/Notch signaling is modulated by the glycosyltransferase activity encoded by the Lunatic fringe (Lfng) gene and results in expression of members of the Her bHLH transcription factor family. In mouse and chick, mRNA from these genes displays dynamic patterns resembling a wave of expression in the PSM that appears to initiate in the posterior and move anteriorly, coming to rest at a position which predicts the site of a future somitic furrow (Aulehla and Johnson, 1999; Bessho et al., 2001; Forsberg et al., 1998; Jouve et al., 2000; Leimeister et al., 2000; McGrew et al., 1998; Palmeirim et al., 1997). The wave-like expression patterns are thought to arise because the level of Her or Lunatic fringe mRNA oscillates in individual cells of the PSM with a period equal to the interval between the formation of successive somites, and these oscillations are temporally coordinated between neighboring cells into a spatially dynamic wave-like expression domain (Palmeirim et al., 1997). The correlation of the spatial and temporal aspects of these dynamic expression domains in the PSM with the process of somitogenesis suggests that they, or underlying cellular oscillations, may have a causal role in segmentation, although direct evidence for this is lacking. A conserved role for these dynamic processes in vertebrate somitogenesis is supported by the existence of cyclic genes in teleosts. In the PSM of the zebrafish embryo, mRNAs from the hairy1 (her1) and the deltaC (dlc) genes are expressed in patterns nearly identical to those seen for the cyclic Lfng and Her genes in mouse and chick (Holley et al., 2000; Jiang et al., 2000; Sawada et al., 2000).
The Delta/Notch signaling system appears to be required for maintenance of cyclic gene expression domain coherence in mouse and zebrafish. In mouse, loss of Delta-like 1, Csl, or Notch1 function leads to a severe downregulation of Lfng expression and a loss of cyclic Lfng patterns (Barrantes et al., 1999), and loss of Delta-like 1 or Notch1 has similar effects on the cyclic Her genes Hes1 and Hey2 (Jouve et al., 2000; Leimeister et al., 2000). In the zebrafish, loss of deltaD (dld) function in the after eight (aei) mutant also leads to disruption of cyclic gene expression, although, in contrast to the mouse, expression of her1 and dlc is not severely downregulated (Durbin et al., 2000; Holley et al., 2000; Jiang et al., 2000; van Eeden et al., 1998). Instead, at stages with comparable somite number to the mice described above, her1 and dlc expression is found in the anterior PSM in a wide stripe with diffuse boundaries and a speckled or ‘salt and pepper’ composition. Although dld is expressed in a dynamic striped pattern in the PSM throughout all stages of somitogenesis (Dornseifer et al., 1997), the loss of dld function results in defective somites only posterior to somite 7 or 8 (Holley et al., 2000). Importantly, in these animals, the cyclic expression pattern of dlc and her1 is initially normal, but as development proceeds, the boundaries of the dynamic expression domains become more diffuse and PSM cells begin to express the cyclic genes out of synchrony with their immediate neighbors, leading to a gradual loss of coherence in the cyclic expression pattern (Jiang et al., 2000). Similar results are seen in the beamter, deadly seven and white tail mutants, which display very similar somitogenic phenotypes (van Eeden et al., 1996), and are also thought to result from lesions in Delta/Notch signaling pathway components or modifiers (Appel et al., 1999; Riley, 1999; Gray et al., 2001; Jiang et al., 2000; Jiang et al., 1996; Lawson et al., 2001). Thus, the posterior onset of somitogenic defects in Delta/Notch mutants is paralleled by a posterior loss of cyclic gene expression domain coherence.
What is the role of cyclic genes themselves in the generation of oscillations and/or their coordination? A cyclic gene whose function is required for the integrity of the segmentation oscillator has been defined as a component of the oscillator (i.e. in the absence of a component, coherent wave-like expression patterns of other cyclic genes are lost) (Palmeirim et al., 1997). If loss of function in a cyclic gene resulted in an immediate disruption of oscillation of all cyclic gene expression, it would indicate that the gene was a central component of the oscillatory mechanism. At present, this would be measured by determining that the dynamic domains of gene expression were immediately perturbed, or did not initiate. Note that genes without cyclic mRNA levels could still be central components of the oscillator by virtue of periodic modulation of protein activity, for example. If loss of function of a cyclic gene leads to a gradual loss of cyclic domain coherence, we might assign to this component the role of coordinating the oscillations (Jiang et al., 2000). By contrast, if loss of function of a cyclic gene did not result in a change in the cyclic expression of other genes, even after multiple cycles, the gene would instead be an output of the oscillator (Palmeirim et al., 1997). Such mutations could nevertheless give rise to somitogenic phenotypes. Mice that lack the function of the Hes1 gene display neither perturbation of cyclic Lfng expression nor defects in segmentation (Ishibashi et al., 1995; Jensen et al., 2000; Jouve et al., 2000). These data suggest that if Hes1 has a role in segmentation, it may be compensated for by other cyclic Her genes, such as Hey2 or Hes7. Alternatively, Hes1 in particular, and Her genes in general may have no function in segmentation and their cyclic expression patterns may be by-products of their functional linkage to Notch signaling in other tissues such as the CNS.
We wished to test whether members of the Her family play wholly or partially redundant roles in segmentation, whether some Her family members might be central or coordinating components of oscillatory mechanisms and whether the Delta/Notch signaling system interacts with Her gene function. To this end, we show that expression of the zebrafish Her gene, her7, cycles in the zebrafish PSM, and determine the spatial relationship of her7 expression to the other cyclic genes. To test the role of cyclic Her genes in segmentation, we analyzed the segmental phenotypes that resulted from the reduction of function of her7 alone or in combination with another zebrafish cyclic Her gene, her1, and with mutations in Delta/Notch pathway genes. We present evidence that her7 and her1 are partially redundant components of a Delta/Notch-linked oscillator, and that, in the absence of both her1 and her7 function, there are no dynamic domains of cyclic gene expression at any stage of development, giving rise to an animal that displays a profound disorganization of somitogenesis along the entire length of its axis. Our data suggest that redundancy between the Her genes and genes of the Delta/Notch pathway underlies the robust formation of anterior somites in vertebrates.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Mutant strains after eight (aeitr233), beamter (beatm98), deadly seven (destp37) and white tail (witta52b, also known as mindbomb) have been described previously (van Eeden et al., 1996).
Plasmid construction
A partial her7 cDNA was amplified using PCR from a 15-19 hpf embryonic cDNA library (B. Appel, Vanderbilt University) with the primer pair her7-1 (catatcctcattgatatcaac) and her7-2R (agagattacacaaggcccatca), designed using Accession Number AF240772 (M. Gajewski, C. Leve and D. Tautz, Universitaet zu Koeln) and subcloned to create pGEM TEasy-her7cds. To test the efficacy of morpholino action, the 5' UTR of her7 was amplified from embryonic cDNA with the primers her7-3 (ccggatccctcgatgaaagacctccacct) and her7-5R (ccggatcctgcacgtgtactccaatagtt) and subcloned into the BamHI site of pCS2+ upstream of the coding sequence of eGFP (Clontech, Palo Alto, CA), which had been amplified with the primers eGFPATGB (ccggatcccaccatggtgagcaagggcgag) and eGFPX (ccgctcgagctacttgtacagctcgtccatgccga), and subcloned into BamHI/XhoI sites to create pCS2+her7 5'UTR-eGFP. All constructs were verified by sequencing both strands by the SynSeq facility at Princeton University.
In situ hybridization and generation of riboprobes
In situ hybridization was essentially as described (Oates et al., 2000), and two color reactions were performed as previously described (Prince et al., 1998). Some of the riboprobes were generated from PCR-amplified cDNA templates subcloned into pGEM-TEasy (Promega, Madison, WI) after restriction and transcription with appropriate enzymes. The primers are as follows: for mespa (Sawada et al., 2000), mespa-1 (cagccatggacgcctccacgt) and mespa-2R (tggtcagcactgtccatggaa); for mespb (Sawada et al., 2000), mespb-1 (cgacatgcaaacctcaagcaaga) and mespb-2R (tccgtcatctccagtaagtctga); and for dlc (Smithers et al., 2000), delC-3 (gtctgctatcgttcagtagcaga) and delC-4r (gtgctccagattgaagaattct). The remaining riboprobes were synthesized from plasmids as described: myod (Weinberg et al., 1996); paraxial protocadherin (Yamamoto et al., 1998); deltaD (Dornseifer et al., 1997); hairy1 (Muller et al., 1996); notch1a, notch5 (Westin and Lardelli, 1997), lunatic fringe (Prince et al., 2001), twist (Morin-Kensicki and Eisen, 1997). The twitchin plasmid was a gift from Y-L. Yan and J. H. Postlethwaite (University of Oregon).
mRNA synthesis and injection
Synthesis and injection of mRNA was essentially as described (Oates et al., 2000). Briefly, capped mRNA was generated from linearized plasmid DNA using the mMessage mMachine kit (Ambion, TX), frozen in small aliquots and diluted to experimental concentrations immediately before injection with 0.2 M KCl. In order to control the injection volume, a fixed proportion (one-third of a volume) of 0.2 mg/ml Fast Green (Sigma, St. Louis, MO) was used to dilute the RNA preparations so that the injected bolus of approximately 0.2-0.5 nl could be visualized. Depending on the experiment, the mRNA was introduced to one cell of a two- to eight-cell stage embryo by pressure injection under a Zeiss Axioskop compound microscope (Carl Zeiss, NY). Location and translation of test gfp mRNA was followed during development on a Leica MZFLIII fluorescent dissection microscope (Leica, NY).
Morpholino design and injection
To ensure that the effect of antisense oligonucleotides would not be confounded by sequence polymorphism, the 5' UTR of her7 was amplified using primers her7-3 and her7-5R (above) from cDNA isolated from three zebrafish strains held in our laboratory (*AB, TLF, and GH) and sequenced. Antisense morpholino oligonucleotides complementary to the 5' regions of the her7 and her1 cDNAs were designed and synthesized by GeneTools LLC (Philomath, OR): her7m1, cagtctgtgccaggattttcattgc; her7m2, gaggatatgattccagaaaatgtcc; her1m1, ttcgacttgccatttttggagtaac; and unrelated control oligo, gcaaaacagctatcattagtcgtcc. Morpholinos were resuspended from lyophilized powder, then diluted to 10 ng/µl in 1x Daniaeu’s solution and stored at –20°C. Immediately before microinjection into the yolk streaming of two- to 16-cell embryos, the morpholino solutions were diluted to the appropriate concentrations into 0.2 mg/ml Fast Green.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
)] contains several members that display cyclic expression patterns in the PSM of vertebrates. While three Her genes with cyclic expression in the PSM are known in both the mouse and chick embryo (Bessho et al., 2001; Jouve et al., 2000; Leimeister et al., 2000; Palmeirim et al., 1997), only one zebrafish Her gene hairy1 (her1) is known to cycle (Holley et al., 2000; Sawada et al., 2000). To test whether zebrafish also possess more than one cyclic Her gene, we re-examined the expression of known Her genes. The her7 cDNA was amplified by PCR from embryonic cDNA and sequenced, confirming the amino acid sequence previously reported (Leve et al., 2001). Below, we show that the her7 gene of zebrafish exhibits cyclic expression in the PSM.
her7 expression reveals structure within cyclic expression domains
We examined the expression pattern of the her7 gene by whole-mount in situ hybridization during the period of embryonic development when somites are patterned and formed. Between 50% and 85% epiboly, her7 is expressed in a ring in the hypoblast (not shown). At 85% epiboly, the expression domain of her7 undergoes a transition, with bilaterally symmetrical stripes apparently separating from the dorsolateral margin and moving rostrally (Fig. 1A). This dynamic expression pattern is maintained throughout the segmentation period (Fig. 1B-F) and is highly similar to the cyclic patterns of her1 and dlc (Holley et al., 2000; Jiang et al., 2000; Sawada et al., 2000). In particular, because her7 is not expressed in any tissue outside the PSM, its expression most resembles that of her1 (Muller et al., 1996). To confirm that her7 expression is genuinely cyclic and to determine precisely the anterior-most extent of the her7 expression domain within the PSM, we compared her7 expression with that of myod (Weinberg et al., 1996), which is expressed in two stripes marking the presumptive caudal half-somite in the anterior of the PSM (Fig. 1G). In carefully staged embryos, cyclic her7 expression domains move rostrally relative to the static myod stripes, and arrest immediately caudal to the posterior-most myod stripe, suggesting that at this point they mark the presumptive rostral somite half. This arrest position is one segment more caudal than that seen with her1 (Holley et al., 2000; Sawada et al., 2000).
|
; Holley et al., 2000; Jiang et al., 2000; Topczewska et al., 2001). The anterior boundary of the dld stripe was rostral to that of the her7 domain (Fig. 1J). In the tailbud, the anterior boundaries of the expression domains appeared to overlap. Thus, the cyclic mRNA expression domains of the three zebrafish cyclic genes are broadly in phase, but display different anterior and posterior boundaries, as illustrated in Fig. 1K. Consequently, a cell in the PSM would experience a succession of gene expression states as illustrated in Fig. 1L.
Antisense morpholino-induced loss of function of her7 causes defects in posterior trunk and tail segments
To examine the effect on segmentation of a loss of her7 function, we used two antisense morpholino-containing oligonucleotides (her7m1 and her7m2) targeted to independent regions of the 5' end of the her7 mRNA (Fig. 2A). In the absence of a specific antibody that recognizes the Her7 protein, we tested the efficacy of the antisense approach by inhibiting the translation of a gfp mRNA carrying the 5' UTR from her7. Injection of gfp mRNA alone resulted in brightly fluorescent embryos (Fig. 2B,C), and co-injection of her7m2 did not affect this expression (Fig. 2D,E). Co-injection of the target her7 5'UTR-gfp mRNA and an unrelated control morpholino left fluorescence unaffected (Fig. 2F,G), whereas co-injection of the target mRNA and her7m2 into embryos completely abolished fluorescence, but did not adversely affect gfp mRNA levels (Fig. 2H,I), consistent with a specific block in GFP translation.
|
In experiments described below, the effects of her7m2 were indistinguishable from those of her7m1, although the effective dose differed and the injection of morpholino of unrelated sequence did not produce any of the observed segmental defects. These data suggest that the morpholino treatment is capable of significantly and specifically reducing Her7 protein levels; however, without direct measurement of endogenous Her7 protein, we cannot be sure that it is entirely eliminated. We therefore refer in what follows to a decrease or reduction in Her7 function resulting from targeted morpholino treatment.
Injection of embryos with either her7m1 or her7m2 antisense morpholino resulted in a distinctive segmental disruption in the 26 hpf embryo (Fig. 3A-D, Table 1). These segmental defects were found only in the posterior trunk and tail, and close examination revealed an anterior limit at approximately myotome eight, with the mode at somite 10 (Fig. 3E). The most rostral defect was often a loss of bilateral symmetry in positioning of several myotome boundaries, which was followed caudally by disruption of boundary morphology (Fig. 3B). The defects increased in severity and number with increasing dose of injected antisense morpholino (Fig. 3B-D; Table 1). The dose had no significant effect on the distribution of anterior-most defects, and the anterior trunk segments were not significantly affected at any dose tested. Comparison of the anterior limit of defects and segment morphology of embryos with reduced her7 function with the phenotype of the segmentation mutants bea, aei, des revealed a similar distribution and appearance (see Fig. 6).
|
|
|
Loss of her7 function causes a gradual degradation of cyclic expression domain integrity
We wanted to know whether the segmental defects due to a reduction of her7 function arose because of a problem with the cyclic expression domains in the PSM, or whether they were attributable to a developmentally later event, perhaps a perturbation of segment polarity in the anterior PSM.
We examined the expression of dlc, her1 and her7 in her7m1- and her7m2-injected embryos, and observed a distinctive, dose-dependant loss of cyclic expression domain integrity. At lower doses, the normally sharp anterior boundary of the domains became diffuse, and cells expressing dlc, her1 and her7 were evident in the interstripe regions; this type of defect was termed ‘fuzzy stripes’ (Fig. 4B,H,N). At higher doses, the anterior boundaries became uneven and/or displayed breaks, and the interstripe regions were so densely populated with dlc-, her1- and her7-expressing cells that successive domains were often partially joined together; this was termed ‘disrupted stripes’ (Fig. 4C,I,O). At the highest doses, the cyclic expression domain structure was effectively destroyed, and a single diffuse region of expression in the anterior half of the PSM was observed; this effect was termed ‘salt and pepper’ (Fig. 4D,J,P). This class of expression pattern is strikingly similar to that seen for the cyclic genes in the aei, bea, des and wit segmentation mutants at comparable developmental stages (see Fig. 6K-Y) (Durbin et al., 2000; Holley et al., 2000; Jiang et al., 2000; van Eeden et al., 1998). These three phenotypic classes represent easily scored stages in what is likely to be a continuum of increasing cyclic expression domain perturbation, as indicated by the occurrence of increasing proportions of the more severe classes across the concentration series (Fig. 4E,K,Q).
|
To determine the correspondence between loss of cyclic expression domain coherence and the onset of the somitogenic phenotype as determined by myotome boundary structure at 1 dpf, we measured the expression of dlc, her1 and her7 at various developmental stages up to and including those at which somitic development was perturbed. We observed a gradual loss of cyclic expression domain integrity over time that resembled the gradual loss seen in the dose response series (Fig. 4F,L,R). The first defects, consisting mostly of the fuzzy stripe class, were observed at bud stage, which occurs at 10 hpf, and by the three-somite stage (11 hpf) less than 50% of the embryos were normal in appearance. From seven- to 10-somite stages (12-14 hpf), there were essentially no normal-looking embryos, and the majority of defects shifted in severity from the fuzzy to the disrupted class. By the 13-somite stage (15.5 hpf), the majority of the embryos displayed defects in the salt and pepper class. Thus, the cyclic expression domain structure degrades with time, and the disruption of segmental pattern in the expression domains correlates well with the timing of somitogenic perturbation. Furthermore, the gradual degradation of domain coherence suggests that her7 alone does not encode a central component of the oscillator, but instead is likely to encode a component of a coordinating or coupling mechanism, as has been proposed for the Delta/Notch system (Jiang et al., 2000). We next investigated the relationship between her7 and Delta/Notch signaling.
Expression of her7 is disrupted in Delta/Notch segmentation mutants
Embryos carrying mutations in the beamter (bea), after eight (aei), deadly seven (des) or whitetail (wit) are thought to possess defective Delta/Notch signaling (Appel et al., 1999; Riley, 1999; Gray et al., 2001; Jiang et al., 2000; Jiang et al., 1996; Lawson et al., 2001). These mutants display segmentation defects similar to those seen in mice with Delta/Notch signaling system mutations: there is a progressive worsening of the orientation and spacing of epithelial furrows in posterior tissue concomitant with a loss of segment polarity. The bea, aei and des mutations produce a relatively distinct transition from well formed to abnormal somites, which occurs in bea after approximately the fourth somite stage, and in aei and des at the seventh somite stage (van Eeden et al., 1996). There is a more gradual degradation of somite integrity in the wit mutant. We examined her7 expression in these mutants and found a gradual degradation in the integrity of the cyclic expression domain boundaries that presaged the appearance of the defective morphological boundaries (Fig. 5B-D). In embryos staged after the overt segmentation phenotype was visible, there was a strong reduction in her7 levels accompanied by a complete loss of cyclic expression domain initiation or propagation (Fig. 5F-I). Thus, Delta/Notch signaling is required for the maintenance of coherent cyclic her7 gene expression domains in the PSM.
|
; van Eeden et al., 1996; van Eeden et al., 1998), suggesting that they act in a similar genetic pathway. To test whether the her7 gene was involved with similar segmentation mechanisms to those disrupted by the bea, aei, des and wit mutations, we assessed whether a loss of her7 function induced by antisense morpholino injection was capable of enhancing or suppressing these mutant phenotypes (Fig. 6). No change in the severity of boundary defects was detected at 26 hpf in any combination of mutant and her7m1 or her7m2, indicating that in this respect, a reduction of her7 function behaves like aei, des and bea. However, reduction of her7 function in aei or des mutants enhanced the onset of the boundary phenotype, shifting the anterior limit of boundary defects from segment 7 to segment 5 (Fig. 6A,B,D,E,H,I). The bea mutant phenotype was more strongly enhanced by a decrease in her7 function, shifting the anterior limit of boundary defects from segment 4 to the extreme anterior end of the paraxial mesoderm (Fig. 6C,F,J). The boundary phenotype of uninjected wit mutants at 26 hpf is severe, possibly reflecting additional degeneration subsequent to initial somitogenic defects, and could not be meaningfully scored for alterations after injection with her7 morpholino (data not shown). We compared the cyclic expression domain defects of the bea, aei, des and wit mutants at the 10-somite stage in the presence or absence of morpholino-induced her7 deficiency to determine if the observed rostral shift in the anterior limit of defects was accompanied by a novel cyclic expression domain defect in the PSM, such as loss of expression, or persistent expression in the mature paraxial mesoderm. A slight increase in expression levels in the posterior PSM and tail bud was observed in dlc, her1 or her7 expression in every mutant background after injection of either her7m1 or her7m2 (Fig. 6K-Y). However, no significant difference in dlc, her1 or her7 expression patterns was observed in the anterior PSM, suggesting that the change in anterior limit of boundary defects was not due to a qualitatively different type of defect in cyclic gene expression, but rather an acceleration of the degradative process. Combined, the data above indicate that a reduction in her7 function is not equivalent to a loss in either aei, des or bea, despite the similarities in phenotype, and suggests that her7 functions in a linked, but separable mechanism in segmentation.
A combined reduction in her1 and her7 function affects segmentation along the AP axis and prevents cyclic expression domain coherence
Although her7 deficiency is sufficient to produce posterior segmental defects in wild-type zebrafish, the finding that anterior segments were affected in embryos sensitized by loss of Delta/Notch function indicates that her7 has functions in the anterior segments that are normally compensated by other molecules. To test the possibility that her1 shares some of the functions of her7, we first used antisense morpholinos to create a her1 reduction of function phenotype in zebrafish embryos (Fig. 7). Animals injected with her1m1 (Fig. 7A) at the highest concentration that did not induce nonspecific abnormalities (5 ng/µl) displayed a weakly penetrant myotome boundary phenotype at 26 hpf, involving isolated boundary defects and local regions of register defects in the anterior as well as posterior trunk (Fig. 7B,C, Table 1). This effect was preceded in mid-segmentation stages by correspondingly weak alterations in myod expression (9/24 embryos (37%), Fig. 7D,E), indicating that the defects were the result of events occurring during somitogenesis. Expression of dlc, her1 and her7 in the PSM of her1m1 morpholino-injected animals exhibited mild cyclic expression domain defects conforming to the fuzzy boundaries class [9/12 (75%), 7/13 (53%), 13/19 (81%), respectively; Fig. 7F-K]. While expression of her1 appeared elevated after her1m1 injection (Fig. 7H,I), this is likely to be due in part to the effect of specific morpholino on target mRNA stability (see Fig. 2). By contrast, her7 levels were reduced in the PSM of her1m1-injected embryos, although their cyclic domain structure was relatively intact (Fig. 7J,K), suggesting that her1 may play a role in her7 expression. These results indicate that like her7, her1 is a component of the oscillator, although one with a weak linkage.
|
). We therefore examined the expression of her1 and mespa, a marker of the presumptive S0 somite (Durbin et al., 2000; Sawada et al., 2000), in embryos at bud stage (10 hpf) before the formation of the first somite. As shown in Fig. 7L,M, both mespa and her1 are expressed at the equator of the embryo, the site of the future first somitic furrow (Kimmel et al., 1995), and the cyclic her1 expression domains extend rostrally to the mespa stripe (Fig. 7N). These data indicate that her1 mRNA cycles in the presumptive cells of the first four somites as well as more posterior tissue, and are consistent with the anterior segmental defects reported above. We next determined the effect of co-injecting her1m1 and her7m2. At the three- to four-somite stage, affected embryos possessed no epithelial furrows in the paraxial mesoderm but were otherwise normal (31/31 embryos; Fig. 8A,B). At the 10-somite stage, shallow disorganized furrows could be seen only in the anterior trunk, approximately to the level of the fifth or sixth somite (69/70 embryos; Fig. 8C,D). By the 12-somite stage, the furrows could be detected at the seventh or eighth somite level (36/36 embryos; data not shown). The furrows in her1m1/her7m2 morpholino-injected embryos differed from normal somite boundary furrows in important ways: (1) they did not show a regular segmental spacing; (2) their orientation was not normal to the AP axis of the embryo; (3) they often did not extend all the way through the paraxial mesoderm; and (4) their formation was delayed relative to normal somite boundary formation. Nevertheless, these furrows possessed nuclei aligned along their borders, similar to those in normal animals, consistent with an epithelial character (Fig. 8E,F). Thus, epithelial furrow formation was delayed by some 2 hours relative to control embryos, and had lost spatial organization.
|
) was not segmentally patterned, but was nevertheless robust, indicating that this derivative of the somite was also present (15/15 embryos, Fig. 9E,F).
|
Finally, we wanted to determine the integrity of cyclic gene expression domains in these embryos. At the 10-somite stage, embryos with reduced her1 and her7 function display a fully penetrant salt and pepper class cyclic domain defect (her1 25/25, her7 23/23, dlc 28/28 embryos, Fig. 9O,P,U, respectively). A similar phenotype was observed for dld expression in the PSM (27/27 embryos; Fig. 9V). In affected embryos, expression of the cyclic genes in the PSM is stronger and more widespread than in her7m2-injected aei, des, bea or wit mutant embryos (compare Fig. 9O,P,U to Fig. 6K-Y), suggesting a more severe loss of repression. To determine the time course of cyclic gene expression domain degradation, we analyzed the expression of dlc, her1 and her7 in injected embryos at 80% epiboly, 90% epiboly, bud and three-somite stages. There was no evidence of organized cyclic domain expression for any of these genes over this period (80% epiboly 0/13, 90% 0/16, bud 0/28, three somite 0/27 embryos, Fig. 9Q-T, respectively; data not shown for her1 and her7), indicating that segmental defects at the anterior end of the paraxial mesoderm correlated with a failure from the beginning of the somitogeneic stage to initiate dynamic gene expression domains. Thus, her7 and her1 together define a central component of the cellular oscillator.
To test whether the severe segmental defects seen with a reduction in function of her1 and her7 could be enhanced by the additional removal of Delta/Notch signaling, we assessed the 26 hpf phenotype after injection of both morpholinos into bea mutant embryos. The boundary defects in these mutant animals were indistinguishable from those seen after her7m2 and her1m1 co-injection into wild type (Fig. 9W,X), and the anterior limit of segmental defects was not significantly different (Fig. 9Y), indicating that loss of Delta/Notch function does not enhance the segmental disruption further.
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
her7 mRNA is expressed in the hypoblast, tailbud and paraxial mesoderm throughout the segmentation period in rostrally moving gene expression domains characteristic of a cyclic gene. Comparison of her7 expression with other cyclic genes dlc and her1 demonstrates that the dynamic expression domains possess a complex internal structure. Although the expression domains are broadly in phase with each other, the Her genes are asymmetrically nested within the delta expression stripe. These findings raise the possibility that cross regulation between cyclic genes may be responsible for some aspects of the cyclic phenomenon. A reduction of Delta/Notch signaling gradually destroys the her7 cyclic expression domains, with a close temporal correlation between the loss of domain integrity and the onset of posterior somite defects, in agreement with previous findings on the effect of Delta/Notch mutations on cyclic genes.
her7 is required for the correct segmentation of posterior trunk and tail, giving a reduction of function phenotype remarkably similar to the Delta/Notch mutants aei (deltaD), des and bea. However, in these genetic backgrounds, her7 is also required for the correct segmentation of more anterior somites, indicating a redundant role for her7 with Delta/Notch signaling in the anterior trunk. Underlying the disruption of overt segmentation in these animals are profound defects in the coherence and maintenance of the cyclic expression domains of dlc, her1 and her7 itself, indicating that her7 is a component of the oscillator. Furthermore, without her7, the level of her1 and dlc expression is elevated in the PSM, suggesting that her7 normally functions to repress their expression. A reduction in her1 function, in contrast, produces mild, isolated segmental disturbances without A/P restriction.
Combining a reduction in her7 and her1 function produces a striking loss of segmental organization along the entire anteroposterior length of the paraxial mesoderm, including the anterior trunk, which cannot be enhanced by a further loss of Delta/Notch signaling. This indicates that her7 also has redundant functions with her1 in the anterior trunk. Cyclic gene expression does not exhibit coordination into dynamic domains at any stage in animals with this extreme phenotype, indicating that the Her genes constitute a critical component of the segmentation clock. As these embryos form epithelial furrows in, and develop twitching muscles and sclerotome from the paraxial mesoderm, these results demonstrate that the function of cyclic expression domains is limited to the positioning of the segmental boundaries and is not required for the morphological processes of epithelial boundary formation or the differentiation of somitic derivatives. Furthermore, our findings show a clear role for genetic redundancy in the robust development of the somites of the anterior trunk.
Her genes are required for distinct aspects of segmentation
As both her7 and her1 are expressed and appear to cycle with equivalent periodicity throughout segmentation stages, it was surprising that they generated such distinct reduction-of-function phenotypes. In both cases, defects in expression domain coherence were observed, indicating that each Her gene can be considered a component of the segmentation oscillator. The restriction of segmental defects to the posterior trunk and tail in her7-deficient embryos and concomitant degradation of expression domain coherence indicates that the function of her7 involves coordinating the oscillations of neighboring cells. The similarity of this phenotype in morphology and effects on gene expression patterns to that of the aei and des mutations strongly suggests that her7 functions in concert with these genes in the posterior body. By contrast, the lack of AP restriction and spatially isolated nature of the segmentation defects seen after reduction of her1 suggest that her1 function may be required in some stochastic manner along the AP axis. The observation that higher doses of her1 morpholino led to nonspecific defects and embryo death, along with the complete penetrance of the combined her7/her1 reduction-of-function phenotype argue against a simple failure to reduce levels of Her1 translation in a spatially homogeneous manner. We speculate that her1 may perform an ‘error-correcting’ role in segmentation that is required only when external perturbation or locally aberrant cell mixing produce potential cyclic gene expression domain defects.
Her7 is redundant with Delta/Notch signaling in the anterior trunk
A reduction in function of her7 in the genetic background of a loss of function in Delta/Notch signaling created a synergistic phenotype in which more anterior defects were observed than in either individual lesion. In the case of her7 reduction in an aei or des mutant background, the rostral shift was modest but highly reproducible, while in the bea mutant background, simultaneous reduction of her7 function led to a larger rostral shift that included defects at the anterior-most end of the paraxial mesoderm. Thus, in the absence of bea function, her7 is sufficient to mediate segmentation in the anterior trunk, and vice versa, indicating that both her7 and bea possess functions in segmental patterning of the entire axis that are usually masked by each other. These observations imply that Delta/Notch signaling defined by these mutants and Her7 are involved in partially overlapping mechanisms leading to correct segmentation. What might be the molecular basis for this redundancy? There are two known Notch receptors (notch1a and notch6), and two Delta ligands (dlc and dld) expressed throughout the zebrafish PSM (Bierkamp and Campos-Ortega, 1993; Dornseifer et al., 1997; Smithers et al., 2000; Westin and Lardelli, 1997). The relative specificity of these Delta proteins for the Notch receptors is unknown, but the possibility exists that several distinct Notch signaling pathways are active in the PSM. If her7 were to mediate input from more than one signaling pathway in segmentation, the requirement for signals beyond the aei/des/bea pathway would only become evident when her7 function was additionally compromised. The correct patterning of anterior segments in the absence of Her7 indicates that these signals in turn are not restricted to Her7 as a choice for mediating their output. The similar expression pattern and putative biochemical properties of her1 suggest it as a plausible alternative.
her7 is redundant with her1 in the anterior trunk
Combining a reduction in her7 and her1 function produces a dramatic segmental phenotype that affects the anterior-most paraxial mesoderm and causes boundary defects more severe than any Delta/Notch mutant in zebrafish, and, to our knowledge, at an earlier stage in the process of segmentation than mutants in other species. The zebrafish fused somites mutant possesses segmental disruption extending from the anterior-most paraxial mesoderm, but this phenotype is characterized by a relatively late block in segment polarity downstream of cyclic gene expression domain formation and hence oscillator function (Holley et al., 2000; Sawada et al., 2000; van Eeden et al., 1998). The anterior somitic defects seen in zebrafish embryos with a morpholino-induced foxc1a reduction of function, and in Foxc1/Foxc2 compound homozygote mice, are likewise caused by a failure to generate rostrocaudal segment polarity in the anterior PSM, and are accompanied by an intact oscillator (Kume et al., 2001; Topczewska et al., 2001). The double presenilin homozygote (Psen1/Psen2) mutant mouse embryo shows no somite formation or apparent segment polarity, but the severely pleiotropic phenotype and the lack of data on cyclic genes in these animals confound an accurate assessment of their segmental state at present (Donoviel et al., 1999). Thus, previously described mutants or mutant combinations with anterior somite defects exhibit a failure in the maturation of presumptive somites downstream of apparently intact oscillator function.
By contrast, the phenotype of a reduction in her7 and her1 function combines an apparently disrupted oscillator with aberrant segmentation along the AP axis in an otherwise normal embryo. Those aspects of segmentation that are affected in her1/her7 reduction of function embryos reveal the biological roles of the dynamic domains of cyclic gene expression. Most obviously, rostrocaudal segment polarization is profoundly disrupted, indicating that the organization of cyclic gene expression into coherent, dynamic domains is required for the establishment of segment polarity. However, as the production of cells with both rostral and caudal segment identity occurs, the dynamic domains of cyclic gene expression are not required for the production of either identity in particular. Similarly, the presence of differentiated muscle and sclerotome indicates that production of somite derivatives is not hindered in the absence of coordinated oscillations. Finally, the observation that epithelial furrow formation is present, if delayed, demonstrates that the process of furrow morphogenesis itself is not a direct output of the dynamic expression domains of cyclic genes. The appearance of clusters of lfng-expressing cells in the anterior paraxial mesoderm in the affected embryos may reflect a sorting out of cells that have taken rostral or caudal fates in the anterior PSM, and the delayed epithelialization may follow this delayed segregation (Durbin et al., 2000). Alternatively, the final position of the furrows may be constrained by physical properties of the epithelia, or may be essentially random. Thus, we hypothesize that the role of the coordination of oscillations into dynamic expression domains is restricted to the placement of the segmental boundaries, presumably through the spatial control of rostral/caudal segment polarity. This conclusion, drawn from the most extreme phenotype is well supported from analysis of the milder phenotypes seen at low doses of her7 or her7 and her1 morpholinos in which the most common defects are the failure of boundaries on either side of the midline to remain bilaterally symmetrical. The correlation of these register defects with a predominance of the fuzzy boundaries defect in cyclic gene expression indicates that the distance between successive boundaries is the first parameter to change as oscillator function is compromised. These conclusions do not imply that there are no other central components to the segmentation oscillator and the redundancy that we have demonstrated is in accordance with previous speculations on a network of HER proteins involved in segmentation (Leimeister et al., 2000).
Redundancy protects the anterior segments from genetic perturbation
The segments of the vertebrate anterior trunk appear to be formed in a more robust manner than those of the posterior trunk and tail, as mutations and treatments leading to somitic patterning defects usually do not affect the anterior body (Conlon et al., 1995; Donoviel et al., 1999; Evrard et al., 1998; Holley et al., 2000; Hrabe de Angelis et al., 1997; Krebs et al., 2000; Saga et al., 1997; Takada et al., 1994; van Eeden et al., 1996; Wong et al., 1997; Yoon and Wold, 2000; Zhang and Gridley, 1998). These data have been plausibly interpreted to mean the existence of distinct mechanisms for segmentation along the AP axis, perhaps reflecting an ancient division of the body plan that was secondarily modified (Holley et al., 2000). When intercrossed to produce double homozygotes, the segmentation mutants bea, aei and des display a simple epistasis; bea;des or bea;aei resemble bea, and aei;des cannot be distinguished from either aei or des (Jiang et al., 2000; van Eeden et al., 1996; van Eeden et al., 1998). These results suggest that aei, des and bea act in the same pathway or are elements of the same mechanism. The simple epistatic interaction of the zebrafish aei, des and bea mutants is consistent with a strategy for segmentation that is, in some respect, modular along the AP axis. Our results showing posterior segmental defects after a reduction of her7 function appear to support this notion, and are consistent with a role for her7 as a target gene of a Delta/Notch pathway involving DeltaD and the protein products of the des and bea loci. However, the synergistic interaction of her7 function with Delta/Notch signaling and with her1 described above, suggests that genetic redundancy plays an important role in the apparent separation of anterior and posterior segmentation.
In support of this idea, we note that several mutations of Delta/Notch signaling genes in mouse show synergistic effects when trans-homozygous, in contrast to the zebrafish bea/aei/des series. Notch4 mouse mutants do not exhibit somitogenic defects, but Notch1/Notch4 double mutant embryos show synergistic effects on several tissues, including
