spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brock, D. A.
Right arrow Articles by Gomer, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brock, D. A.
Right arrow Articles by Gomer, R. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 129, 3657-3668 (2002)
© 2002 The Company of Biologists Limited

The different components of a multisubunit cell number-counting factor have both unique and overlapping functions

Debra A. Brock1, R. Diane Hatton1, Dan-Victor Giurgiutiu2, Brenton Scott2, Robin Ammann1 and Richard H. Gomer1,*

1 Howard Hughes Medical Institute and
2 Department of Biochemistry and Cell Biology, MS-140, Rice University, 6100 South Main Street, Houston, TX 77005-1892, USA

*Author for correspondence (e-mail: richard{at}bioc.rice.edu)

Accepted 15 May 2002


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Dictyostelium aggregation streams break up into groups of 103 to 2x104 cells. The cells sense the number of cells in a stream or group by the level of a secreted counting factor (CF). CF is a complex of at least 5 polypeptides. When the gene encoding countin (one of the CF polypeptides) was disrupted, the cells could not sense each other’s presence, resulting in non-breaking streams that coalesced into abnormally large groups. To understand the function of the components of CF, we have isolated cDNA sequences encoding a second component of CF, CF50. CF50 is 30% identical to lysozyme (but has very little lysozyme activity) and contains distinctive serine-glycine motifs. Transformants with a disrupted cf50 gene, like countin cells, form abnormally large groups. Addition of recombinant CF50 protein to developing cf50 cells rescues their phenotype by decreasing group size. Abnormalities seen in aggregating countin cells (such as high cell-cell adhesion and low motility) are also observed in the cf50 cells. Western blot analysis of conditioned medium sieve column fractions showed that the CF50 protein is present in the same fraction as the 450 kDa CF complex. In the absence of CF50, secreted countin is degraded, suggesting that one function of CF50 may be to protect countin from degradation. However, unlike countin cells, cf50 cells differentiate into an abnormally high percentage of cells expressing SP70 (a marker expressed in a subset of prespore cells), and this difference can be rescued by exposing cells to recombinant CF50. These observations indicate that unlike other known multisubunit factors, CF contains subunits with both overlapping and unique properties.

Key words: Counting factor, Cell population size, Dictyostelium discoideum


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Little is known about the regulation of tissue size, despite it being a significant problem in both agriculture and medicine (Day and Lawrence, 2000Go; Gomer, 2001Go; Haldane, 1928Go; Potter and Xu, 2001Go). In the model system Dictyostelium discoideum, starving cells use relayed pulses of cAMP as a chemoattractant to aggregate in dendritic streams. On agar plates the streams of our laboratory strains break up into groups of a remarkably uniform size of 2x104 cells/group. Other strains similarly form even sized groups of up to 105 cells (Shaffer, 1957Go). Each group then develops into a fruiting body consisting of a 1-2 mm tall stalk supporting a mass of spore cells. The spores can then be dispersed by the wind to start new colonies of cells. The group formation appears to function to limit the size of fruiting bodies, since fruiting bodies with more than these numbers of cells tend to collapse or fall over (Brock and Gomer, 1999Go).

Using shotgun antisense transformation for mutagenesis, we found a Dictyostelium transformant we named smlAas that formed very small groups and fruiting bodies (Spann et al., 1996Go). The smlAas cells formed streams with normal morphology and size which then broke up into a large number of small groups. Disrupting the smlA gene using homologous recombination resulted in cells with a phenotype identical to that of smlAas (Spann et al., 1996Go). SmlA is a cytosolic protein with no strong similarity to any known protein. It appears to regulate some aspect of secretion, as the smlA and smlAas cells secrete a soluble factor which when added to early developing wild-type cells causes them to form small groups (Brock et al., 1996Go).

One way in which cells can theoretically sense the size of a tissue or group of cells is if all the cells in the group secrete a diffusible factor. As the number of cells in the group increases, the concentration of the factor will increase, and thus the cells themselves or a different set of cells can sense the size of the group (Brock et al., 1996Go; Clarke and Gomer, 1995Go; Gomer, 2001Go). We hypothesized that the factor secreted by the smlA cells might be an example of such a factor. Using conventional protein chromatography and the ability of this factor to cause wild-type cells to form small groups as a bioassay, we partially purified the factor and found that it appeared to be a ~450 kDa complex of polypeptides we named counting factor (CF). We found that CF was also secreted by wild-type cells, although to a lesser extent than by smlA cells. This suggested that the smlA cells oversecrete a factor that the wild-type cells use to sense the number of cells in a group, so that when there is a small number of smlA cells in a group, the higher concentration of CF causes these cells to sense that there is a much larger number of cells (Brock and Gomer, 1999Go).

A SDS-polyacrylamide gel of CF showed that there are at least 5 different polypeptides in the complex (Brock and Gomer, 1999Go). We obtained N-terminal amino acid sequence for 3 of the proteins; another 2 were blocked. We isolated the cDNA encoding a 40 kDa component, which we named countin. The derived amino acid sequence of the countin protein has some similarity to amoebapores, a superfamily of proteins that bind to membranes (Zhai and Saier, 2000Go). A prediction of the ‘secreted factor being used to count cells’ model is that if the cells secrete little or no factor, huge groups will form. To test the hypothesis that countin is part of such a factor, we disrupted the countin gene using homologous recombination. The countin cells did not secrete any measurable CF activity according to the bioassay, and the streams of countin cells did not break into groups, resulting in the streams coalescing into huge mounds of cells which then formed huge fruiting bodies (Brock and Gomer, 1999Go). Addition of anti-countin antibodies to developing wild-type cells caused them to form large groups, again indicating that countin is used by wild-type cells for group size regulation. A secreted protein with ~40% identity to countin, countin2, also regulates group size (Okuwa et al., 2001Go).

To try to understand what could cause a stream of cells to break up into groups, we wrote a simple computer simulation of cells moving in a stream while secreting and sensing a diffusible factor (Roisin-Bouffay et al., 2000Go). This simulation indicated that if a secreted factor negatively regulates cell-cell adhesion, and/or increases random motility, the presence of too many cells in a stream results in a high level of the factor and thereby cause the stream to dissipate and subsequently break up. The subsequent lower concentrations of the factor amongst the dispersed cells will cause them to recoalesce, and the simulation indicated that they would coalesce into separate groups rather than in a continuous stream (Roisin-Bouffay et al., 2000Go). During early Dictyostelium development, there are two main cell-cell adhesion molecules: gp24 and gp80 (Loomis, 1988Go; Siu et al., 1987Go; Siu and Kamboj, 1990Go). Overexpression of gp80 caused the formation of unbroken streams and large aggregates, while blocking gp80 binding activity with monoclonal antibodies resulted in broken streams and many small aggregates (Kamboj et al., 1990Go; Siu and Kamboj, 1990Go). Because altering cell-cell adhesion can alter group size in Dictyostelium, we examined whether countin or smlA cells have altered cell-cell adhesion. We found that countin cells have abnormally high cell-cell adhesion, while smlA cells have low adhesion (Roisin-Bouffay et al., 2000Go). Addition of highly purified preparations of CF to wild-type cells decreased cell-cell adhesion within 30 minutes. Decreasing adhesion with exogenous anti-gp24 antibodies also decreased group size. The simulations indicated that if a secreted factor regulates both adhesion and motility, the group size becomes more uniform (Tang et al., 2002Go). We found that CF increases cell motility by increasing actin polymerization and the levels of the actin-crosslinking protein ABP-120, and by decreasing levels of myosin polymerization (Tang et al., 2002Go). Motility and the expression of the adhesion molecules is regulated by the relayed pulses of cAMP, and we found that CF indeed regulates cAMP signal transduction (Tang et al., 2001Go). These results suggested that CF regulates cell-cell adhesion and motility, and this in turn can regulate the size of a group of cells.

All of the above work was done with either countin cells or exogenous anti-countin antibodies to inhibit countin function. However, CF contains several other proteins in addition to countin. To help understand why cell-number counting in Dictyostelium is mediated by a large complex of polypeptides, we have characterized the function of CF50, another protein component of CF.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
cDNA isolation, sequencing and generation of a knockout construct
To isolate fragments of cDNA, PCR was done with primers that matched the genomic sequence from the Dictyostelium sequencing project, using vegetative and developmental cDNA libraries as templates. PCR was also used to obtain fragments of genomic DNA, using Ax4 genomic DNA as a template. The DNA was ligated into pCR 2.1 (Invitrogen, San Diego, CA) and sequenced at Lonestar Labs (Houston, TX). Possible O-glycosylation sites were searched for using the DictyOGlyc 1.1 server http://www.cbs.dtu.dk/services/DictyOGlyc/ (Gupta et al., 1999Go). To generate a gene disruption construct, PCR was done on Ax4 genomic DNA with the primers CGATAATCATCCGCGGGAGGGATGTATCCTTAGC and GGTAAAGTCACCAGGGACTTGTCTAGAGCATGC, yielding a 437 bp fragment of the 5' side of a gene designated ctnB that will be referred to as cf50. This was digested with Sac II and Xba I, and ligated into the same sites in pBluescript SK+ (Stratagene, La Jolla, CA) to generate p50L. PCR was then done with GCCAATGTAAGCTTGGCAGCAGAACAAGCTGG and CATGTGATATACACGAATTACGGGCCCAATGCG on Ax4 genomic DNA to generate a 771 bp fragment of the 3' side of cf50. This was digested with HindIII and ApaI and ligated into the same sites in p50L to generate p50LR. The 1.4 kb XbaI-HindIII blasticidin resistance cassette from pUCBsr{Delta}Bam (Adachi et al., 1994Go; Sutoh, 1993Go) was then ligated into the same sites in p50LR to generate p50KO. This was digested with SacII and ApaI and the insert was purified by gel electrophoresis and a Geneclean II kit (Qbiogene, Inc., Carlsbad, CA). This was used to transform Dictyostelium Ax2 cells following the method of Shaulsky et al. (Shaulsky et al., 1996Go). PCR was used to identify cf50 clones with a disruption of cf50. The specific clone used in this study is HDB17-4 and is referred to as cf50.

Cell culture and group number assays
Cell culture was done according to Brock and Gomer (Brock and Gomer, 1999Go). The disruption of strain ctnA (also known as countin) used in this study was HDB2B/4 and will be referred to as countin. The smlA disruption strain used was HDB7YA and will be referred to as smlA. Slices of agar with adhering fruiting bodies were turned sideways and photographed on Kodak Ektachrome 160T with a light blue filter using a Nikon Microphot with a 4x lens stopped down with a 1 mm pinhole in front of the lens. Synergy assays were done according to Brock et al. (Brock et al., 1996Go). Production of conditioned starvation medium (CM), exposure of cells to conditioned medium, and exposure of cells to 1:500 anti-countin antibodies or 1:500 anti-CF50 antibodies was done according to Brock and Gomer (Brock and Gomer, 1999Go). Group size assays were done following the method of Brock et al. (Brock et al., 1996Go). To make conditioned growth medium, cells were inoculated into growth medium at 1x106 cells/ml. After 20 hours, the medium was clarified by centrifugation at 2100 g for 3 minutes, and the supernatant was further clarified by centrifugation at 12,000 g for 10 minutes. The supernatant was mixed with SDS sample buffer and heated to 100°C for 3 minutes for western blots stained with anti-CF50. For western blots stained with anti-countin antibodies, the supernatant was concentrated by a factor of 10 using an Ultrafree Biomax10 kDa cutoff spin filter (Millipore, Bedford, MA) and then treated as above. The procedure of Wood et al. (Wood et al., 1996Go) was used to determine the percentages of CP2-positive and SP70-positive cells at low cell density. For each cell type, cells were grown in shaking culture, and (where indicated) recombinant CF50 was added to the cells to 0.2 µg/ml at the time indicated. The cells were then collected by centrifugation, washed in starvation buffer and starved in duplicate wells of an 8 well slide at low cell density in monolayer culture in the presence of a 1:10 dilution of Ax4 conditioned medium to supply CMF and thus allow CP2 and SP70 expression at low cell density. After 6 hours, cAMP was added to induce the expression of prestalk and prespore genes. 12 hours later, the cells were fixed and one well was stained for CP2 while the other was stained for SP70. The total number of cells per well and the number of positive cells were then counted. To examine differentiation in aggregates, cells were starved on filter pads (Brock et al., 1996Go) and were dissociated after 18 hours. Approximately 2500 cells in 200 µl of PBM were placed in the well of an 8 well slide. After allowing the cells to settle for 10 minutes, the cells were fixed and stained following Wood et al. (Wood et al., 1996Go).

Northern blots
RNA was isolated using a RNeasy mini kit (Qiagen, Valencia, CA) following the manufacturer’s directions with the exception that 2x107 cells were used. Northern blot analysis was as described previously (Brock et al., 1996Go).

Preparation of recombinant CF50 and lysozyme assay
To make recombinant CF50, a PCR reaction was done using a vegetative cDNA library and the primers GGCAGCCATATGGAATGTGCCATTGATTTCTC and GGATCCTCGAGTTAAATGGATGATCCACTTCC to generate a fragment of the cf50 coding region corresponding to the entire polypeptide of the secreted protein, with a NdeI site on one end and a XhoI site on the other. To make a recombinant fragment of CF50 lacking the C-terminal serine-glycine rich region (which is very similar to a region in a 45 kDa component of CF; D. A. B., R. D. H. and R. H. G., unpublished), a PCR reaction was carried out using the first primer above and GCCGGATCCTCGAGTTAATAAAAATCTAAATCAACAC. After digestion with NdeI and XhoI, these were ligated into the corresponding sites of pET-15b (Novagen). The recombinant proteins were expressed in bacteria. The recombinant CF50 was found in inclusion bodies, so these were solubilized in 8 M urea and the recombinant CF50 was purified using a B-Per 6x His spin purification kit (Pierce, Rockford, IL) following the manufacturer’s directions. To refold denatured recombinant CF50, a final concentration of 100 µg/ml protein was dialyzed in 20 mM Tris-HCl, pH 7.5, 0.1 mM DTT at 4°C for 24 hours with three changes of buffer. The protein was then dialyzed in the same buffer without DTT at 4°C for 48 hours with four changes of buffer, and stored as aliquots at –80°C. The purified protein was quantitated in two ways. First, dilution curves of known amounts of bovine serum albumin and various dilutions of recombinant CF50 were electrophoresed side-by-side on SDS-polyacrylamide gels and stained with Coomassie Blue, and the lanes were scanned. Second, a Bio-Rad protein assay (Bio-Rad, Hercules, CA) was performed. The two methods gave similar results. Both constructs generated proteins that had poly-histidine tags at the N terminus, a thrombin cleavage site, followed by the first amino acid of the secreted form of CF50 (Fig. 1, first vertical arrow). The first construct generated a protein that terminated after the last amino acid of the predicted sequence. The second construct generated a protein that terminated after the last amino acid before the serine/glycine-rich motif (Fig. 1, second vertical arrow). Proteins were assayed for lysozyme activity using the method of Monchois et al. (Monchois et al., 2001Go) using hen’s egg white lysozyme (Sigma) as a standard.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 1. Sequence of the cf50 gene. The sequence starts with genomic DNA; the 5' end of known cDNA sequence starts at nt 28 and continues to 83 nt past the stop codon, and is an exact match to the genomic sequence. The first ATG is at nucleotide 25. The N-terminal amino acid sequence obtained from the purified 50 kDa protein is indicated with a heavy underline. Two potential N-linked glycosylation sites (Alexander, 1997Go) are indicated by shaded boxes. Vertical arrows mark the beginning and end of the sequence expressed in bacteria and then used to immunize rabbits for antibody production. An arrow pointing to the left over nucleotide 260 marks the 3' end of the region that was replaced with a blasticidin resistance cassette to make a gene disruption transformant; the 5' end of the region that was replaced was 681 bp upstream of the first ATG. A double underline indicates a potential AAUAAA poly(A) addition signal. The GenBank accession number is AF405695.

 
Circular dichroism
Circular dichroism measurements were performed using a model 62ADS spectrometer (Aviv, Lakewood, NJ) with a 2 mm x 10 mm dual pathlength quartz cuvette (Starna Cells, Atascadero, CA) at 24°C. Data was collected from 260 to 190 nm at 1 nm intervals, 1 nm bandwidth, and a 1 second integration time. For these measurements, recombinant CF50 was diluted to a final concentration of 20 µg/ml in PBM.

Analytical ultracentrifugation
Sedimentation equilibrium experiments were performed on a Beckman XL-A (Beckman, Palo Alto, CA) analytical ultracentrifuge with a four-position An60Ti rotor and double-sector centerpieces at 25°C. 1.0, 0.5, and 0.25 mg/ml of recombinant CF50 were examined in a six-channel centerpiece unit in which three channels on one side contained the different concentrations of protein and the three channels on the other side contained buffer. Samples were centrifuged at 10,000 rpm, 14,000 rpm, or 18,000 rpm. Analysis of data was accomplished using software provided by Beckman Instruments.

Antibody production, western blots and immunofluorescence
For antibody production, the recombinant truncated CF50 was additionally purified by SDS-polyacrylamide gel electrophoresis (Gomer, 1987Go). Immunization of a rabbit with the recombinant truncated CF50 and affinity purification of the antibodies was done by Bethyl Laboratories (Montgomery, TX). For western blots, 106 cells in 80 µl, or 80 µl of CM, was mixed with 20 µl of 5x Laemmli sample buffer and heated to 100°C for 3 minutes. 15 µl was electrophoresed on a 12% polyacrylamide Tris-HCl gel (Bio-Rad, Hercules, CA). Protein was transferred to Immobilon P and stained as described for the ubiquitin western blots by Lindsey et al. (Lindsey et al., 1998Go) with the exception that filters were not boiled, were blocked overnight at 4°C in PBS/5% BSA/1% Tween-20/1% Nonidet P-40/0.1% SDS, and the primary antibody was used at a 1:3000 dilution. Staining of western blots with anti-countin antibodies and size-exclusion gel chromatography was performed as described in Brock and Gomer (Brock and Gomer, 1999Go). For immunofluorescence, 200 µl of cells at a density of 5x105 cells/ml were placed in the well of a Lab-Tek eight-well slide (Nalge, Naperville, IL). After 30 minutes, the liquid was gently removed from the settled cells and replaced with 2% formaldehyde, 0.2% glutaraldehyde, 0.002% Triton X-100 in PBM. After 7 minutes, this was removed and the cells were washed with two changes of PBM and then incubated for 15 minutes in several changes of 4 mg/ml sodium borohydride. The cells were then stained with 10 µg/ml of affinity-purified anti-CF50 antibody (Gomer, 1987Go). Cells were examined with a Nikon Microphot Fx with a 1.4 NA 60x lens or a Deltavision (Applied Precision, Issaquah, WA) deconvolution microscope with a Zeiss 1.4 NA 100x lens. Sieving gel chromatography was done as described by Brock and Gomer (Brock and Gomer, 1999Go).

Cell-cell adhesion and motility
Adhesion was measured (Roisin-Bouffay et al., 2000Go) using cells developing on filter pads and the cells were then dissociated before doing the assay following (Tang et al., 2002Go). To measure motility, cells were starved in PBM as described above, diluted to 3x105 cells/ml in PBM and 400 µl was placed in the well of a Lab-Tek 155411 8 well chambered coverglass (Nalge, Naperville, IL). After 30 minutes, 250 µl of liquid above the cells was removed from the well. Cells were videotaped for 10 minutes, 5 to 6 hours after being placed in the well, using the method of Yuen et al. (Yuen et al., 1995Go) with the exception that a 20x objective was used.


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
CF50 shows some similarity to a lysozyme precursor
Dictyostelium cells use CF to sense the number of cells in an aggregation stream (Brock et al., 1996Go). We previously found that the factor is a complex of polypeptides, and that disruption of countin, the gene encoding the 40 kDa component of CF, essentially abolishes the activity of the factor. To elucidate why CF contains multiple polypeptides, we examined a second component of the complex. We previously determined the amino-terminal sequence of CF50, the 50 kDa component of the semi-purified factor (Brock and Gomer, 1999Go). A search of the Dictyostelium genomic sequence database revealed an open reading frame encoding a methionine followed by a predicted secretion signal, then an exact match to the sequence of the N terminus of purified CF50 (underline, Fig. 1), followed by an open reading frame, with an AATAAA polyadenylation signal 4 nucleotides after the stop codon (double underline, Fig. 1). Additional AATAAA sequences were observed beginning at 27, 33 and 37 nucleotides (nt) past the stop codon. Using PCR primers matching portions of the genomic sequence, cf50 cDNAs were isolated from a vegetative and a developmental cDNA library. The sequence of both cDNAs matched the sequence of the genomic DNA between nucleotides 87 and 743. A search of Dictyostelium cDNA databases revealed sequences with exact matches to nucleotides 28 to 268, and 390 to 83 nt past the stop codon shown in Fig. 1. These cDNAs showed a poly(A) sequence beginning at 84 nt past the stop codon.

The first 24 amino acids of the predicted CF50 protein appear to be a signal sequence (typically a lysine followed by a hydrophobic region), and are missing from the purified native protein (Fig. 1). This suggests that CF50 is a secreted protein. The predicted molecular mass of the 279 amino acid protein starting from the observed N terminus is 28.2 kDa. There are two potential N-linked glycosylation sites (shaded boxes, Fig. 1) and no significant O-linked glycosylation sites. We previously observed that other proteins secreted by Dictyostelium cells are extensively glycosylated, resulting in polypeptide backbones that are ~70% of the total mass of the protein (Brock and Gomer, 1999Go; Jain and Gomer, 1994Go). The first 200 amino acids of CF50 show a 34% identity and a 51% similarity to the Entamoeba histolytica lysozyme II precursor, and the last 70 amino acids contain 13 copies of (A/N)SGS motifs. There are no concentrations of charged amino acids, only 3 positively charged amino acids, and the predicted pI is 3.5. There are no large regions of hydrophobicity. Recombinant CF50 (which as described below has CF bioactivity) appeared to contain a mixture of {alpha} helix, ß sheet and random coil as determined by circular dichroism (data not shown), and ultracentrifugation indicated a molecular mass of 35 kDa, suggesting that the recombinant protein behaves as a monomer. Lysozyme activity assays indicated that recombinant CF50 has more than 104-fold lower specific enzymatic activity than hen’s egg-white lysozyme (Table 1), suggesting that despite the sequence similarity, CF50 is not a lysozyme.


View this table:
[in this window]
[in a new window]
 
Table 1.
 
Cells lacking CF50 form large fruiting bodies
To help understand the function of CF50, we examined the effect of disrupting its expression. A northern blot showed the presence of a 0.9 kb cf50 mRNA in Ax2 vegetative cells (Fig. 2A). This RNA was absent in cf50 cells, suggesting that these cells lack the cf50 mRNA. Western blots of total cell protein from vegetative or 6-hour starved cells showed a 50 kDa band staining with anti-CF50 in wild-type, smlA and countin cells; this band was absent from cf50 cells (Fig. 2B and data not shown). Compared to parental cells, there appeared to be more CF50 protein in countin and smlA cells. Western blots of conditioned starvation medium indicated that CF50 is secreted by developing wild-type, smlA and countin cells, but not from cf50 cells (Fig. 2C). Compared to the amount of CF50 in wild-type CM, there appeared to be higher levels of CF50 in the CM from both countin and smlA cells. As previously described, there was a higher levels of countin protein in smlA CM than in wild type CM, and no countin in countin CM (Brock and Gomer, 1999Go). We observed variable but low levels of countin protein in cf50 CM, with bands at ~35 and ~30 kDa reacting with the anti-countin antibodies (Fig. 2D and data not shown). Sequencing of tryptic peptides from bands purified from crude preparations of CF indicate that there can exist degradation products of countin at these molecular masses. In support of the idea that countin is degraded in cf50 CM, we observed that cf50 cells occasionally revert to a phenotype very similar to wild type. Each time this happened, we observed that concomitantly the countin protein in the CM was no longer being degraded. Western blots of conditioned growth medium indicated that wild-type, smlA and countin cells but not cf50 cells secrete CF50, with higher levels in growth media conditioned by countin and smlA cells (Fig. 2E). When similar samples were stained for countin, this protein was observed in growth medium from wild-type, smlA, and cf50 cells but not countin cells (Fig. 2F). Compared to media from wild-type cells, growth media conditioned by cf50 cells contained somewhat more countin, while media from smlA cells contained very high levels. The above results suggest that cf50 cells lack the cf50 mRNA and the CF50 protein, that vegetative as well as developing wild-type and smlA cells secrete countin and CF50, and that countin is degraded in cf50 CM.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 2. cf50 cells do not have cf50 mRNA or CF50 protein. (A) A northern blot of RNA from vegetative cells was probed with a fragment of the cf50 cDNA. A 0.9 kB band (arrow) is present in Ax2 wild-type parental cells but not in the cf50 cells. Aliquots of the samples were electrophoresed on separate gels and stained with ethidium bromide to verify equal loading and that the ribosomal bands were not degraded. (B) A western blot of vegetative cells was stained with anti-CF50 antibodies. A 50 kDa band is present in Ax2, countin and smlA cells, but is absent from cf50 cells. (C) A western blot of conditioned starvation media from the above cell lines was stained with anti-CF50 antibodies. A 50 kDa band is present in Ax2, countin and smlA CMs, but is absent from cf50 CM. (D) A similar blot stained with anti-countin antibodies, showing countin present in the wild-type and smlA CMs, absent from the countin CM and present at low levels with what appears to be a lower molecular mass band in the cf50 CM. (E) A blot of conditioned HL5 growth media showing that CF50 is secreted from growing Ax2, countin and smlA cells, but not from cf50 cells. (F) A similar blot of conditioned HL5 growth media stained with anti-countin antibodies. For B-F, SDS-polyacrylamide gels of aliquots of the samples used for the western blots were stained with Coomassie Blue to verify that equal amounts of protein were loaded for each blot.

 
The cf50 cells grew normally on plates with bacteria as well as in shaking culture. When the cells starved, they formed normal aggregation ‘spiders’ which either coalesced without breaking up, or broke up infrequently, both resulting in the formation of very large groups and fruiting bodies (Fig. 3). The large groups and fruiting bodies were observed when the cf50 cells were allowed to develop on filter pads, on water agar, on SM/5 plates with or without bacteria, and a variety of other conditions (data not shown). Although cf50 and countin cells share a similar phenotype of abnormally large aggregates and fruiting bodies, the developing structures of cf50 are much more aberrant. Along with irregularly-shaped, large aggregates, extremely long, very extended slug or finger-like structures can be seen which even appear to fruit horizontally (data not shown). Together, the data suggest that like countin cells, cf50 cells form large groups and fruiting bodies, but that cf50 cells have additional defects such as extended structures.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 3. Developing cf50 cells form unusually large structures. Cells were grown on bacteria on agar plates, and as the cells consumed the bacteria they starved and formed fruiting bodies. Slices of agar with fruiting bodies or aggregates were tilted and photographed. The left panel shows the parental Ax2 cells; the center and right panels show examples of the structures formed by cf50 cells. Bar is 1 mm.

 
Extracellular CF50 affects group size
To determine if the phenotype of the cf50 cells is due to a defect in a signal transduction pathway or is instead due to the lack of a secreted factor, we first performed synergy assays. As we previously observed (Brock et al., 1996Go), when wild-type cells were mixed with 10% smlA cells, they formed 1.7±0.2-fold more groups than wild-type cells alone. When cf50 cells were mixed with 10% smlA cells, they formed 2.9±1.1-fold more groups than cf50 cells alone. This suggested that the cf50 cells were able to change their group size in response to an extracellular signal provided by the smlA cells. To determine if this signal is soluble, cf50 cells were starved in the presence of buffer or various conditioned media. As previously observed, smlA conditioned medium (CM) caused Ax2 cells to form a larger number of smaller groups (Brock et al., 1996Go). smlA CM also caused cf50 cells to form larger number of smaller groups, suggesting that the factor is indeed soluble (Fig. 4). We also measured the CF activity in conditioned starvation medium from cf50 cells. In a low cell density assay, wild-type cells formed 52±10 groups in the presence of PBM, 228±8 groups in the presence of smlA CM, 73±4 groups in the presence of cf50 CM, and 75±1 groups in the presence of countin CM. This suggests that smlA CM causes wild-type cells to form a large number of groups compared to buffer alone, whereas countin or cf50 CM cause a much smaller increase in group number. Together, the data suggest that cf50 cells can respond to a secreted factor, which regulates group size, and that decreased levels of a secreted factor causes the large group size in cf50 cells.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 4. Starvation of cf50 cells in the presence of smlA conditioned starvation medium (CM) causes a decrease in group size. Cells were starved on filters sitting on pads soaked with either buffer or CM from smlA cells. Bar is 1 mm.

 
A simple explanation for the above results is that CF50 is a necessary or at least important component of CF. To test this hypothesis, recombinant CF50 was added to starving cells. A dilution curve of recombinant CF50 showed that for both parental Ax2 and cf50 cells, the optimal concentration of recombinant CF50 for increasing the number of groups was ~200 ng/ml. At this concentration the cf50 cells formed fruiting bodies that were indistinguishable in size and morphology from untreated wild-type cells (Fig. 5 and data not shown). Under these conditions 0.2 µg/ml recombinant CF50 caused a 46±9% (mean ± s.e.m., n=3) increase in group number for Ax2 cells, an 89±18% increase in group number for cf50 cells, and a 24±6% increase for countin cells (Fig. 5). When recombinant CF50 was added to cf50 cells starving in shaking culture, the countin levels in the CM increased and there were less countin degradation products. Together, the data indicate that addition of recombinant CF50 rescues the defects observed in cf50 cells.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5. Addition of recombinant CF50 causes an increase in group number. Cells were starved on filters sitting on pads soaked with the indicated concentration of recombinant CF50. The number of groups the streams broke up into was then counted 18 hours later. Values are means ± s.e.m. from at least 3 separate experiments.

 
In the group number assay shown in Fig. 5, 30 µl of cells at 5x106 cells/ml were spotted onto a filter. For untreated wild-type cells there were ~150 groups (Fig. 5) and thus ~1000 cells/ group. This number is much smaller than the number of cells per group when the cells are on agar, and we attribute this partially to CF and other factors being trapped by the filter. When 1 µl of either Ax2 or cf50 cells at 1x107 cells/ml were spotted onto filters, both cell types formed 1 group per spot, and thus roughly 104 cells/group. Since the small spots have a greater ratio of periphery to surface area, we hypothesize that under these conditions there is less trapping of secreted factors and group sizes approach those seen on agar.

cf50 cells secrete bioactive countin activity
We previously observed that when wild-type cells were starved on filters soaked with anti-countin antibodies, the number of groups decreased and the group size increased (Brock and Gomer, 1999Go). To determine the effect of depleting countin and CF50 simultaneously, we starved Ax2 parental and cf50 cells on filters for 2 hours and then transferred the filters with cells to pads soaked with buffer, preimmune or immune anti-countin antibodies. There was no significant difference in the number of aggregates formed on buffer as opposed to preimmune sera. Anti-countin antibodies decreased the number of groups formed by cf50 cells, and anti-CF50 antibodies decreased the number of groups formed by wild-type cells but not cf50 cells (Table 2). The anti-CF50 antibodies also caused a slight reduction in the number of groups formed by countin cells. The data suggest that there is some residual CF activity secreted by cf50 cells, and that depleting extracellular countin can decrease this activity. The data also indicate that anti-CF50 antibodies are able to deplete CF activity from the extracellular medium, and that countin cells secrete a small amount of CF activity that can be neutralized with anti-CF50 antibodies.


View this table:
[in this window]
[in a new window]
 
Table 2.
 
Like countin, CF50 shows a punctate distribution in cells and is part of a 450 kDa complex when secreted
To elucidate the developmental regulation of cf50 expression, a northern blot of RNA from different developmental stages was probed with a section of the cf50 gene. As shown in Fig. 6A, cf50 mRNA is present in vegetative cells and throughout development, with somewhat higher levels from 2 to 8 hours of development. A western blot of protein from cells at various stages of development showed that CF50 was present in cells at all stages of development, with a slight increase in amount between 5 and 7.5 hours of development (Fig. 6B). Interestingly, in vegetative cells and up to 7.5 hours, there was a 53 kDa band that stained with anti-CF50 (Fig. 6B). Together, the data suggest that CF50 is present throughout development and that like the secreted signal CMF (Jain et al., 1997Go; Yuen et al., 1991Go), its synthesis involves a slightly larger precursor form.



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 6. cf50 mRNA and CF50 protein are present in growing and developing cells. Ax2 wild-type cells were starved on filters, and samples were harvested at the indicated times (in hours) after starvation; V indicates vegetative cells. (A) A northern blot of mRNA extracted from cells; (B) a western blot of whole cells stained with anti-CF50 antibodies.

 
Immunofluorescence with anti-CF50 antibodies showed a punctate distribution in wild-type, countin and smlA cells during both growth and development (Fig. 7 and data not shown). The punctate staining was absent during growth and development in cf50 cells (Fig. 7 and data not shown). There was somewhat brighter staining with anti-CF50 antibodies of the smlA and countin cells compared to wild type, similar to the higher levels of CF50 in these transformants observed on western blots (Fig. 2). The punctate distribution of CF50 is similar to that observed previously when cells were stained with anti-countin antibodies (Brock and Gomer, 1999Go), and suggests that before it is secreted, CF50 is located in vesicles.



View larger version (67K):
[in this window]
[in a new window]
 
Fig. 7. Distribution of CF50 in cells. (A) Cells of the indicated type were starved on filters for 6 hours, harvested, allowed to settle on glass slides, fixed, and stained for CF50 by immunofluorescence and observed by conventional immunofluorescence microscopy. (B) Wild-type cells were further examined by deconvolution fluorescence microscopy. Bar in A is 20 µm and bar in B is 5 µm.

 
We previously identified CF50 as a protein present in the CF preparation. To determine whether all or just some of the secreted CF50 is in the 450 kDa CF complex, CM was size-fractionated by gel chromatography, and the fractions were stained for CF50 by western blotting. As shown in Fig. 8, CF50 protein from Ax4 CM appears in a single peak around 450 kDa, in the same fractions where the countin peak appears (Brock and Gomer, 1999Go). Similar chromatography of CM from smlA cells also shows a peak at ~450 kDa, and in addition a band at 30 kDa that is present in both the 450 kDa fraction as well as a fraction representing material with molecular mass less than 66 kDa. Very long exposures did not reveal any of the 30 kDa protein in the sieve column fractions of Ax4 CM, suggesting that the 30 kDa protein that binds the anti-CF50 antibodies is specific to the smlA CM. These results suggest that in smlA CM some of the CF50 is broken down.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 8. CF50 is present in an ~450 kDa complex in CM. CM was prepared from Ax2 and smlA cells, and concentrated ~10-fold. (A) The material was size-fractionated on a sieving gel column, and the fractions were assayed for CF50 by western blotting. The 50 kDa CF50 band from both wild-type and smlA CM elutes at approximately 450 kDa; a 30 kDa band eluting below 66 kDa is also present in the smlA CM. The elution position of size markers is shown at the bottom. (B) CM from Ax2 and cf50 cells was similarly size fractionated and the fractions were assayed for countin by western blotting. As previously observed, countin in Ax2 CM elutes at ~450 kDa (Brock and Gomer, 1999Go), while the countin in cf50 CM elutes primarily at a lower molecular weight. The position of size markers is the same as in A.

 
Although both countin and CF50 are found in the fraction with CF activity after purification through several columns and a non-denaturing gel, there is a possibility that the two proteins are in different 450 kDa complexes. To test the hypothesis that the two proteins do not co-associate, we determined whether deletion of CF50 would affect the apparent molecular weight of the complex containing countin, because if the two proteins are in different complexes one would expect that deletion of CF50 would not affect the size of the complex containing countin. As shown in Fig. 8B, the countin in wild-type CM elutes at approximately 450 kDa, whereas the countin in cf50 CM elutes at a lower molecular weight. As mentioned before, there appears to be increased degradation of countin in the cf50 CM. The observation that CF50 causes the apparent molecular weight of the complex containing countin to decrease disproves the hypothesis that CF50 and countin are in different complexes, thus suggesting that countin and CF50 are part of the same complex.

Like countin cells, cf50 cells have high cell-cell adhesion and low motility
Computer simulations predicted that a higher cell-cell adhesion and/or a lower random cell motility would keep a stream intact, and thus by preventing stream breakup lead to larger groups (Roisin-Bouffay et al., 2000Go). We previously observed that countin cells have a higher cell-cell adhesion than their parental cells. Compared to wild-type parental, cf50 cells had 5.9±1.5% higher adhesion at 2 hours of development, 3.0±1.3% higher at 4 hours, and 2.2±0.9% higher at 6 hours (means ± s.e.m. from 5 separate experiments). These experiments were done on cells that were forming streams on filter pads. The streams were morphologically similar up to about 8 hours of development, and had not begun to coalesce. Thus whereas during later development the cf50 cells form huge groups and cells in the interior might be starved for oxygen, in these assays the cells were in structures of a similar size. In addition to having abnormally high cell-cell adhesion, countin cells have an abnormally low cell motility during the time wild-type streams are breaking up (Tang et al., 2002Go). cf50 cells also have significantly decreased cell motility at 6 hours after starvation (Fig. 9). These assays were done with cells developing in submerged monolayer culture, so, as above, these differences are not due to factors such as a lack of oxygen. Together, the data indicate that disruption of cf50 has qualitatively the same effect on cell-cell adhesion and cell motility as disruption of countin.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 9. Developing cf50 cells move more slowly than parental Ax2 cells. Cells were starved in submerged culture for 6 hours, and then fields of cells were observed by time-lapse videomicroscopy. For each cell, the approximate center of the cell was tracked for 5 minutes, and the cell speeds were then binned in 1 µm/minute increments. The average speeds were 3.3±0.2 µm/minute for Ax2 and 2.3±0.1 µm/minute for cf50 (means ± s.e.m. for 60 cells each, combining the observations from 20 cells in three separate experiments).

 
Extracellular CF50 affects initial cell-type choice
We previously observed that countin cells show a normal initial differentiation into CP2-positive prestalk and SP70-positive prespore cells (Brock and Gomer, 1999Go). CP2 is a protein which is a marker for an initial population of prestalk cells that gives rise to the first set of cells expressing other markers such as ecmA (Clay et al., 1995Go; Gomer et al., 1986Go), while SP70 is expressed in a subset of prespore cells and later appears on spore coats (Gomer et al., 1986Go). A similar assay showed that an abnormally low percentage of cf50 cells initially differentiate into CP2-positive cells while, compared to parental, a higher percent differentiate into SP70-positive cells (Table 3 and data not shown). These assays were done with cells developing at very low cell density in submerged monolayer culture, so these differences are not due to differences in group size. The initial decision to differentiate into a CP2-positive, SP70-positive or null cell is made at the time cells starve (Gomer and Firtel, 1987Go). Because we observed that wild-type cells secrete CF50 into the growth medium, we determined if the abnormal initial cell-type differentiation of cf50 cells is due to a lack of extracellular CF50 just before the cells starve. Cells growing in shaking culture were treated with recombinant CF50 for various times, starved, and allowed to differentiate at low cell density. Recombinant CF50 had little effect on Ax2 or countin cells when added for 1, 3, or 6 hours before starvation (Table 3 and data not shown). However, a 1-hour exposure of vegetative cf50 cells to recombinant CF50 caused a partial rescue of the abnormal differentiation, while a 6-hour exposure caused the percentages of cf50 cells differentiating into CP2-positive and SP70-positive cells to be similar to the percentages seen with wild-type cells. Adding recombinant CF50 to growing cells for 8 hours, and then washing and starving the cells caused a 2.1±0.7 (mean ± s.e.m., n=4) increase in the number of groups formed by cf50 cell, but no significant change in the number of groups formed by Ax2 cells. To determine if the rescue of the abnormal differentiation of cf50 cells by exogenous CF50 was due to exogenous CF50 affecting something during vegetative growth or whether it was being sequestered by the cells and then affecting something during later development, we examined the effect of starving the CF50-treated cells in the presence of anti-CF50 antibodies. As shown in Table 4, adding anti-CF50 antibodies reversed the effect of the recombinant CF50 on the differentiation of cf50 cells. These data suggest that during vegetative growth cf50 cells can apparently sequester exogenous CF50 and then when starved release the CF50, which then causes them to alter the percentages of cell types that they would differentiate into if starved.


View this table:
[in this window]
[in a new window]
 
Table 3.
 

View this table:
[in this window]
[in a new window]
 
Table 4.
 
To determine if cf50 cells developing in aggregates also have an abnormal initial cell-type differentiation, we starved cells on filter pads and then dissociated them at 18 hours, when there is maximal accumulation of CP2 and SP70. As shown in Table 5, cf50 cells developing under conditions where they form aggregates also have an abnormal cell-type differentiation. This abnormal differentiation was observed for cells developing in spots of either 104 cells in a 1 µl spot or 5 x105 cells in a 50 µl spot. When the cells were grown in the presence of recombinant CF50 and then starved, there was a slight increase in the percentage of CP2-positive cells, albeit much lower than the increase seen when these cells were starved at low cell density. The data thus suggest that cf50 cells developing in aggregates have an abnormal cell-type differentiation.


View this table:
[in this window]
[in a new window]
 
Table 5.
 

    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
One of the ways cells could theoretically sense the number of cells in a group or tissue is by secreting and simultaneously sensing a characteristic diffusible factor (Gomer, 2001Go). We identified such a factor in Dictyostelium, and found that it is a relatively large complex of polypepetides (Brock and Gomer, 1999Go). We have found here that disrupting the expression of cf50 has essentially the same effect as disruption of countin with respect to group size, adhesion and motility, but that unlike the effect of disrupting countin, disrupting cf50 affects the initial cell-type choice.

Native CF50 is a 50 kDa molecule, whereas the polypeptide backbone is only 28 kDa. Since many secreted proteins in Dictyostelium are glycosylated, one possibility is that the 22 kDa of non-polypeptide mass is post-translational glycosylation. Our observation that bacterially synthesized CF50 polypeptide backbone has CF activity when added to wild-type or cf50 cells suggests that the functional domain of CF50 is in this backbone. countin cells did not exhibit a strong response to the recombinant CF50, possibly because they already secrete large amounts of CF50 (Fig. 2C). For a different secreted polypeptide factor, CMF, we found that the presence of post-translational glycosylation appears to protect the protein from proteases (Jain and Gomer, 1994Go; Yuen et al., 1991Go). Thus a possible explanation for the existence of the CF50 glycosylation is that it protects CF50 from degradation. We previously observed that highly purified preparations of CF could cause a 3-fold increase in group number, and that a 1.5-fold increase could occur at concentration as low as 0.3 µg/ml (Brock and Gomer, 1999Go). The recombinant CF50 occasionally will cause a 2-fold increase in group number, but a 1.5-fold increase tends to be the norm and the lowest concentration this occurs is at ~0.1 µg/ml; Fig. 5 and data not shown). Assuming that the CF50 is roughly one-fifth of the CF, the specific activity of CF50 is roughly that of CF, although recombinant CF50 does not seem to increase group number to the extent that CF can.

Both countin and cf50 cells produce conditioned medium that causes a slight increase in group number compared to buffer alone, suggesting that there is some residual CF activity secreted in cells lacking just countin or just CF50. The antibody depletion experiments indicated that cf50 cells, which form large groups, will form even larger groups when countin is depleted from the extracellular environment with anti-countin antibodies, and countin cells similarly form slightly larger groups when CF50 is depleted with antibodies (Table 2). Thus both the CF production assays and antibody depletion experiments suggest that neither CF50 nor countin is the sole effector molecule in the CF complex, but that both molecules can separately affect group size.

During early development, countin cells have a considerably higher cell-cell adhesion than parental cells. We found that cf50 cells have only a slightly higher adhesion than parental cells. This higher adhesion is probably not sufficient to strongly affect group size. However, the cf50 cells have a significantly lower motility than parental cells, and most importantly far fewer highly motile cells than wild type (Fig. 9). Our computer simulations suggest that streams break when strongly motile cells break adhesive bonds and tear away from other cells (Roisin-Bouffay et al., 2000Go; Tang et al., 2002Go). The highly motile cells thus have the greatest influence on stream breaking, and we hypothesize that the greatly reduced numbers of these cells seen in cf50 is the reason cf50 cells form streams that rarely break and thus form large groups.

Vegetative countin cells have high cell-cell adhesion and high levels of the adhesion molecule gp24 compared to wild-type cells, while vegetative smlA cells have lower levels (Roisin-Bouffay et al., 2000Go) (Roisin-Bouffay and Gomer, unpublished). Vegetative cells contain smlA and countin proteins (Brock et al., 1996Go; Brock and Gomer, 1999Go), and we found here that vegetative cells also contain CF50. If we assume that vegetative cells can respond to CF, our observation that countin and CF50 are secreted by vegetative cells suggests that the differences in gp24 levels and cell-cell adhesion in vegetative smlA, wild-type and countin cells could be due to low CF activity being secreted by vegetative countin cells and high levels of CF being secreted by smlA cells. This could then result in different levels of gp24 and different levels of cell-cell adhesion in vegetative wild-type cells compared to smlA or countin cells.

Wild-type cells all appear to have the same amount and distribution of CF50 (Fig. 7), so the altered cell-type differentiation of cf50 cells (Tables 3, 4, and 5) does not appear to be due to CF50 levels or distribution specifying a cell fate. This then suggests that CF50 somehow affects a process that is however heterogeneous in the cells. Although recombinant CF50 can rescue the abnormal initial cell-type differentiation when added to vegetative cf50 cells that are subsequently starved at low cell density, anti-CF50 antibodies added during starvation can block this rescue (Table 4). In addition, when the CF50-treated cells are starved at high cell density, there is very little change in the initial cell-type differentiation (Table 5). Together, the data suggest that the recombinant CF50 added to growing cf50 cells affects initial differentiation at a step after growth. One possibility is that the cf50 cells are able to sequester the added CF50 and then release it during development, and that this released CF50 can rescue the altered initial cell-type differentiation of cf50 cells when they are starved at low density but is degraded when the cells are starved at high cell density. Recombinant CF50 affects group size when added to vegetative cells that are then washed and starved at high cell density. Under these same conditions there is little effect on initial cell-type choice. A possible explanation for this is that during growth CF50 affects the expression of genes involved in adhesion and/or motility, and the altered levels of the associated proteins persist into development and affect stream breakup.

It is unclear why recombinant CF50 affects group size in Ax4 cells, which secrete CF50 as part of the CF complex. One possibility is that there are limiting amounts of CF50 in CM, and the recombinant CF50 allows CF complexes to form and or become active. However, western blots of gel filtration column fractions of whole conditioned medium from wild-type cells indicate that all of the detectable countin and CF50 are both present in a roughly 450 kDa complex, suggesting that there are no incomplete complexes. In addition, the removal of CF50 causes much of the countin present in CM to elute at a lower molecular weight (Fig. 8B). However, we cannot exclude the possibility that some fraction of countin was present in ~450 kDa complexes that lack CF50, and that exogenous CF50 increased the activity of this subset of complexes. Another possibility is that the exogenous CF50 (and thus the CF50 in the CF complex) binds to and activates a cell surface receptor.

There are several examples of signals that are present in complexes. One example is a ternary complex of Twisted gastrulation (TSG)/Short gastrulation (SOG or chordin)/Bone morphogenetic protein (BMP) (Chang et al., 2001Go; Ross et al., 2001Go; Scott et al., 2001Go). TSG and SOG act synergistically to repress signaling by BMP and TSG appears to enhance a proteolytic cleavage of SOG. Insulin-like growth factors, which can regulate the size of developing tissues, are found in ternary complexes with two specific binding proteins (Boisclair et al., 2001Go). Another example is TGFß, which is stored in platelets and secreted as a complex with TGFß masking protein, a 440 kDa complex of polypeptides. TGFß forms a homodimer, and the masking protein contains 4 to 6 subunits (Nakamura et al., 1986Go; Okada et al., 1989Go). For all three of these examples, one protein in the complex can act as a signal, and other proteins regulate its activity. Another signal that is normally in a complex is thrombospondin, a trimeric ~450 kDa secreted extracellular matrix protein with binding sites for a variety of factors and receptors (Bornstein et al., 2000Go; Chen et al., 2000Go). Like CF, thrombospondin inhibits cell adhesion and increases cell motility, allowing cells to move and thus reshape structures (Mansfield et al., 1990Go; Murphy-Ullrich, 2001Go). CF appears to be somewhat different from these examples of multi-subunit factors insofar as having subunits that have similar as well as distinct effects on cells. This then suggests the possibility that for unknown reasons there may be different receptors for different components of the cell-number counting factor.


    ACKNOWLEDGMENTS
 
We thank the international Dictyostelium genome sequencing project and the Japanese cDNA sequencing project for generating the sequences that allowed us to easily determine the sequence of CF50. We thank Darrell Pilling for advice, Richard Atkinson for assistance with the deconvolution microscopy, Heather Seidle and Ron Parry for help with column chromatography, and Jeff Nichols for assistance with the circular dichroism measurements. Spectroscopic facilities utilized were provided by the Keck Center for Computational Biology and the Lucille P. Markey Charitable Trust. R. H. G. is an Investigator of the Howard Hughes Medical Institute.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Adachi, H., Hasebe, T., Yoshinaga, K., Ohta, T. and Sutoh, K. (1994). Isolation of Dictyostelium discoideum cytokinesis mutants by restriction enzyme-mediated integration of the blasticidin S resistance marker. Biochem. Biophys. Res. Commun. 205, 1808-1814 (Errata 208, 1181).[Medline]
Alexander, S. (1997). Developmental regulation and function of glycoproteins in Dictyostelium discoideum. In Dictyostelium – A model system for cell and developmental biology (ed. Y. Maeda, K. Inouye and I. Takeuchi), pp. 349-362. Tokyo, Japan: Universal Academy Press.
Boisclair, Y., Rhoads, R., Ueki, I., Wang, J. and Ooi, G. (2001). The acid-labile subunit (ALS) of the 150 kDa IGF-binding protein complex: an important but forgotten component of the circulating IGF system. J Endocrinol. 170, 63-70.[Abstract]
Bornstein, P., Armstrong, L., Hankenson, K., Kyriakides, T. and Yang, Z. (2000). Thrombospondin 2, a matricellular protein with diverse functions. Matrix Biol. 19, 557-568.[Medline]
Brock, D. A., Buczynski, F., Spann, T. P., Wood, S. A., Cardelli, J. and Gomer, R. H. (1996). A Dictyostelium mutant with defective aggregate size determination. Development 122, 2569-2578.[Abstract]
Brock, D. A. and Gomer, R. H. (1999). A cell-counting factor regulating structure size in Dictyostelium. Genes Dev. 13, 1960-1969.[Abstract/Free Full Text]
Chang, C., Holtzman, D. A., Chau, S., Chickering, T., Woolf, E. A., Holmgren, L. M., Bodorova, J., Gearing, D. P., Holmes, W. E. and Brivanlou, A. H. (2001). Twisted gastrulation can function as a BMP antagonist. Nature 410, 483-487.[Medline]
Chen, H., Herndon, M. and Lawler, J. (2000). The cell biology of thrombospondin-1. Matrix Biol. 19, 597-614.[Medline]
Clarke, M. and Gomer, R. H. (1995). PSF and CMF, autocrine factors that regulate gene expression during growth and early development of Dictyostelium. Experientia 51, 1124-1134.[Medline]
Clay, J. L., Ammann, R. A. and Gomer, R. H. (1995). Initial cell type choice in a simple eukaryote: Cell-autonomous or morphogen-gradient dependent? Dev. Biol. 172, 665-674.[Medline]
Day, S. and Lawrence, P. (2000). Measuring dimensions: the regulation of size and shape. Development 127, 2977-2987.[Abstract]
Gomer, R. H. (1987). A strategy to study development and pattern formation: use of antibodies against products of cloned genes. In Methods in Cell Biology (ed. J. A. Spudich), pp. 471-487. Orlando, FL: Academic Press.
Gomer, R. H. (2001). Not being the wrong size. Nature Rev. 2, 48-54.
Gomer, R. H., Datta, S. and Firtel, R. A. (1986). Cellular and subcellular distribution of a cAMP-regulated prestalk protein and prespore protein in Dictyostelium discoideum: A study on the ontogeny of prestalk and prespore cells. J. Cell Biol. 103, 1999-2015.[Abstract/Free Full Text]
Gomer, R. H. and Firtel, R. A. (1987). Cell-autonomous determination of cell-type choice in Dictyostelium development by cell-cycle phase. Science 237, 758-762.[Abstract/Free Full Text]
Gupta, R., Jung, E., Gooley, A. A., Williams, K. L., Brunak, S. and Hansen, J. (1999). Scanning the available Dictyostelium discoideum proteome for O-linked GlcNAc glycosylation sites using neural networks. Glycobiology 9, 1009-1022.[Abstract/Free Full Text]
Haldane, J. B. S. (1928). On being the right size. In Possible Worlds and Other Papers. pp. 20-28. New York: Harper & Brothers.
Jain, R., Brazill, D. T., Cardelli, J. A., Bush, J. and Gomer, R. H. (1997). Autocrine factors controlling early development. In Dictyostelium – A model system for cell and developmental biology (ed. Y. Maeda, K. Inouye and I. Takeuchi), pp. 219-234. Tokyo, Japan: Universal Academy Press.
Jain, R. and Gomer, R. H. (1994). A developmentally regulated cell surface receptor for a density-sensing factor in Dictyostelium. J. Biol. Chem. 269, 9128-9136.[Abstract/Free Full Text]
Kamboj, R. K., Lam, T. Y. and Siu, C. H. (1990). Regulation of slug size by the cell adhesion molecule gp80 in Dictyostelium discoideum. Cell Regulation 1, 715-729.[Medline]
Lindsey, D. F., Amerik, A., Deery, W. J., Bishop, J. D., Hochstrasser, M. and Gomer, R. H. (1998). A deubiquitinating enzyme that disassembles free polyubiquitin chains is required for development but not growth in Dictyostelium. J. Biol. Chem. 273, 29178-29187.[Abstract/Free Full Text]
Loomis, W. F. (1988). Cell-cell adhesion in Dictyostelium discoideum. Dev. Genetics 9, 549-560.[Medline]
Mansfield, P., Boxer, L. and Suchard, S. (1990). Thrombospondin stimulates motility of human neutrophils. J. Cell Biol. 111, 3077-3086.[Abstract/Free Full Text]
Monchois, V., Abergel, C., Strugis, J., Jeudy, S. and Claverie, J.-M. (2001). Escherichia coli ykfE ORFan gene encodes a potent inhibitor of C-type lysozyme. J. Biol. Chem. 276, 18437-18441.[Abstract/Free Full Text]
Murphy-Ullrich, J. (2001). The de-adhesive activity of matricellular proteins: is intermediate cell adhesion an adaptive state? J. Clin. Invest. 107, 785-790.[Medline]
Nakamura, T., Kitazawa, T. and Ichihara, A. (1986). Partial purification and characterization of masking protein for beta-type transforming growth factor from rat platelets. Biochem. Biophys. Res. Commun. 141, 176-184.[Medline]
Okada, F., Yamaguchi, K., Ichihara, A. and Nakamura, T. (1989). One of two subunits of masking protein in latent TGF-ß is a part of pro-TGF-ß. FEBS Lett. 242, 240-244.[Medline]
Okuwa, T., Katayama, T., Takano, A., Kodaira, K. and Yasukawa, H. (2001). Two cell-counting factors regulate the aggregate size of the cellular slime mold Dictyostelium discoideum. Dev. Growth Differ. 43, 735-744.[Medline]
Potter, C. and Xu, T. (2001). Mechanisms of size control. Curr. Opin. Genet. Dev. 11, 279-286.[Medline]
Roisin-Bouffay, C., Jang, W. and Gomer, R. H. (2000). A precise group size in Dictyostelium is generated by a cell-counting factor modulating cell-cell adhesion. Mol. Cell 6, 953-959.[Medline]
Ross, J., Shimmi, O., Vilmos, P., Petryk, A., Kim, H., Gaudenz, K., Hermanson, S., Ekker, S., O’Connor, M. and Marsh, J. (2001). Twisted gastrulation is a conserved extracellular BMP antagonist. Nature 410, 479-483.[Medline]
Scott, I. C., Blitz, I. L., Pappano, W. N., Maas, S. A., Cho, K. W. Y. and Greenspan, D. S. (2001). Homologues of twisted gastrulation are extracellular cofactors in antagonism of BMP signalling. Nature 410, 475-478.[Medline]
Shaffer, B. M. (1957). Variability of behavior of aggregating cellular slime moulds. Quart. J. Micr. Sci. 98, 393-405.
Shaulsky, G. and Loomis, W. F. (1996). Initial cell type divergence in Dictyostelium is independent of DIF-1. Dev. Biol. 174, 214-220.[Medline]
Siu, C.-H., Cho, A. and Choi, H. C. (1987). The contact site a glycoprotein mediates cell-cell adhesion by homophilic binding in Dictyostelium discoideum. J. Cell Biol. 105, 2523-2533.[Abstract/Free Full Text]
Siu, C. H. and Kamboj, R. K. (1990). Cell-cell adhesion and morphogenesis in Dictyostelium discoideum. Dev. Genetics 11, 377-387.[Medline]
Spann, T. P., Brock, D. A., Lindsey, D. F., Wood, S. A. and Gomer, R. H. (1996). Mutagenesis and gene identification in Dictyostelium by shotgun antisense. Proc. Natl. Acad. Sci. USA 93, 5003-5007.[Abstract/Free Full Text]
Sutoh, K. (1993). A transformation vector for Dictyostelium discoideum with a new selectable marker Bsr. Plasmid 30, 150-154.[Medline]
Tang, L., Ammann, R., Gao, T. and Gomer, R. H. (2001). A cell number-counting factor regulates group size in Dictyostelium by differentially modulating cAMP-induced cAMP and cGMP pulse sizes. J. Biol. Chem. 276, 27663-27669.[Abstract/Free Full Text]
Tang, L., Gao, T., McCollum, C., Jang, W., Vickers, M. G., Ammann, R. and Gomer, R. H. (2002). A cell number-counting factor regulates the cytoskeleton and cell motility in Dictyostelium. Proc. Natl. Acad. Sci., USA 99, 1371-1376.[Abstract/Free Full Text]
Wood, S. A., Ammann, R. R., Brock, D. A., Li, L., Spann, T. P. and Gomer, R. H. (1996). RtoA links initial cell type choice to the cell cycle in Dictyostelium. Development 122, 3677-3685.[Abstract]
Yuen, I. S., Jain, R., Bishop, J. D., Lindsey, D. F., Deery, W. J., Van Haastert, P. J. M. and Gomer, R. H. (1995). A density-sensing factor regulates signal transduction in Dictyostelium. J. Cell Biol. 129, 1251-1262.[Abstract/Free Full Text]
Yuen, I. S., Taphouse, C., Halfant, K. A. and Gomer, R. H. (1991). Regulation and processing of a secreted protein that mediates sensing of cell density in Dictyostelium. Development 113, 1375-1385.[Abstract]
Zhai, Y. and Saier, M. H. (2000). The amoebapore superfamily. Biochim. Biophys. Acta 1469, 87-99.[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Eukaryot CellHome page
Y. Tang and R. H. Gomer
A Protein with Similarity to PTEN Regulates Aggregation Territory Size by Decreasing Cyclic AMP Pulse Size during Dictyostelium discoideum Development
Eukaryot. Cell, October 1, 2008; 7(10): 1758 - 1770.
[Abstract] [Full Text] [PDF]


Home page
J R Soc InterfaceHome page
W. Jang and R. H Gomer
Combining experiments and modelling to understand size regulation in Dictyostelium discoideum
J R Soc Interface, August 6, 2008; 5(Suppl_1): S49 - S58.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. Bakthavatsalam, D. A. Brock, N. N. Nikravan, K. D. Houston, R. D. Hatton, and R. H. Gomer
The secreted Dictyostelium protein CfaD is a chalone
J. Cell Sci., August 1, 2008; 121(15): 2473 - 2480.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
T. Gao, C. Roisin-Bouffay, R. D. Hatton, L. Tang, D. A. Brock, T. DeShazo, L. Olson, W.-P. Hong, W. Jang, E. Canseco, et al.
A Cell Number-Counting Factor Regulates Levels of a Novel Protein, SslA, as Part of a Group Size Regulation Mechanism in Dictyostelium
Eukaryot. Cell, September 1, 2007; 6(9): 1538 - 1551.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
D. A. Brock, W. N. van Egmond, Y. Shamoo, R. D. Hatton, and R. H. Gomer
A 60-Kilodalton Protein Component of the Counting Factor Complex Regulates Group Size in Dictyostelium discoideum.
Eukaryot. Cell, September 1, 2006; 5(9): 1532 - 1538.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Jang and R. H. Gomer
A Protein in Crude Cytosol Regulates Glucose-6-phosphatase Activity in Crude Microsomes to Regulate Group Size in Dictyostelium
J. Biol. Chem., June 16, 2006; 281(24): 16377 - 16383.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
D. A. Brock and R. H. Gomer
A secreted factor represses cell proliferation in Dictyostelium
Development, October 15, 2005; 132(20): 4553 - 4562.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
W. Jang and R. H. Gomer
Exposure of Cells to a Cell Number-Counting Factor Decreases the Activity of Glucose-6-Phosphatase To Decrease Intracellular Glucose Levels in Dictyostelium discoideum
Eukaryot. Cell, January 1, 2005; 4(1): 72 - 81.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
T. Gao, D. Knecht, L. Tang, R. D. Hatton, and R. H. Gomer
A Cell Number Counting Factor Regulates Akt/Protein Kinase B To Regulate Dictyostelium discoideum Group Size
Eukaryot. Cell, October 1, 2004; 3(5): 1176 - 1184.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
R. R. Powell and L. A. Temesvari
Involvement of a Rab8-like protein of Dictyostelium discoideum, Sas1, in the formation of membrane extensions, secretion and adhesion during development
Microbiology, August 1, 2004; 150(8): 2513 - 2525.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Ehrenman, G. Yang, W.-P. Hong, T. Gao, W. Jang, D. A. Brock, R. D. Hatton, J. D. Shoemaker, and R. H. Gomer
Disruption of Aldehyde Reductase Increases Group Size in Dictyostelium
J. Biol. Chem., January 9, 2004; 279(2): 837 - 847.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. A. Brock, K. Ehrenman, R. Ammann, Y. Tang, and R. H. Gomer
Two Components of a Secreted Cell Number-counting Factor Bind to Cells and Have Opposing Effects on cAMP Signal Transduction in Dictyostelium
J. Biol. Chem., December 26, 2003; 278(52): 52262 - 52272.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
D. A. Brock, R. D. Hatton, D.-V. Giurgiutiu, B. Scott, W. Jang, R. Ammann, and R. H. Gomer
CF45-1, a Secreted Protein Which Participates in Dictyostelium Group Size Regulation
Eukaryot. Cell, August 1, 2003; 2(4): 788 - 797.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Jang, B. Chiem, and R. H. Gomer
A Secreted Cell Number Counting Factor Represses Intracellular Glucose Levels to Regulate Group Size in Dictyostelium
J. Biol. Chem., October 11, 2002; 277(42): 39202 - 39208.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Gao, K. Ehrenman, L. Tang, M. Leippe, D. A. Brock, and R. H. Gomer
Cells Respond to and Bind Countin, a Component of a Multisubunit Cell Number Counting Factor
J. Biol. Chem., August 30, 2002; 277(36): 32596 - 32605.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brock, D. A.
Right arrow Articles by Gomer, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brock, D. A.
Right arrow Articles by Gomer, R. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?