|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
Laboratoire de Développement et Différenciation Cardiaques, Institut de Recherches Cliniques de Montréal, 110 Avenue des Pins Ouest, Montréal, Québec H2W 1R7, and Département de Pharmacologie, Université de Montréal, Canada
*Author for correspondence (e-mail: nemerm{at}ircm.qc.ca)
Accepted 4 June 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Endocardium, GATA5, Heart Development, Transcription Factors, NF-AT
| INTRODUCTION |
|---|
|
|
|---|
Commitment and differentiation of the myocardial and endocardial lineages are among the earliest events of cardiogenesis as the primitive heart tube is formed of an outer myocardial and an inner endocardial layer which will give rise to the valves and septa. In recent years, significant progress has been made towards elucidating the molecular pathways underlying patterning of the myocardium and differentiation of cardiomyocytes. Indeed, several cardiomyocyte transcription factors have been identified and shown to be required for various stages of cardiomyocyte development and heart morphogenesis. This includes the zinc finger protein GATA4 (Grépin et al., 1997
; Crispino et al., 2001
), the homeodomain containing protein Nkx2-5 (Lyons et al., 1995
; Tanaka et al., 1999
), the T-box factor Tbx5 (Bruneau et al., 2001
), the MADS protein Mef2C (Lin et al., 1997
), and the basic helix-loop-helix proteins Hand1 and Hand2 (Srivastava et al., 1995
; Firulli et al., 1998
; Srivastava et al., 1997
). In contrast, the molecular events and transcription factors underlying endocardial differentiation remain largely undefined. In fact, the embryonic origin of endocardial cells is still being debated. Evidence for distinct origin of endocardial and vascular endothelial cells was only recently provided from analysis of the zebrafish mutants faust and cloche which lack endocardial but not vascular endothelial cells (Reiter et al., 1999
; Liao et al., 1997
). In mice, the Tie2 (Tek- Mouse Genome Informatics) receptor tyrosine kinase was found to be essential for endocardial development but dispensable for vascular endothelia (Puri et al., 1999
) and expression of NF-ATc marks endocardial but not vascular endothelial cells (de la Pompa et al., 1998
) indicating that the two endothelial subtypes are biochemically distinct. At present, NF-ATc is the only transcription factor shown to be essential for endocardial development (de la Pompa et al., 1998
; Ranger et al., 1998
).
Retroviral labeling studies in chick and quail embryos (Schultheiss et al., 1997
; Mikawa et al., 1992
) as well as cell lineage tracing in zebrafish embryos (Lee et al., 1994
) suggest that endocardial and myocardial precursors are present in the heart-forming regions, but, whether they share a common progenitor remains uncertain (Lough and Sugi, 2000
). The establishment of the QCE-6 cell line, which originates from MCA-treated tissue explants of HH stage-4 Japanese quail embryos, and which can be differentiated into both endocardial and myocardial cells (Schultheiss et al., 1997
), supports the existence of a common bipotent cardiogenic precursor. However, the cloche mutation in zebrafish results in a heart that is deficient only in endocardial but not myocardial cells (Stainier et al., 1995
); whether this reflects specific dependence on cloche for endocardial differentiation of a bipotent precursor or the existence of distinct myocardial and endocardial precursors cannot be resolved at this stage. Finally, in birds, the characterization of the JB3 antibody, which recognizes a fibrillin-like protein, suggests that there are at least two endocardial subpopulations, a JB3+ one originating within the precardiac mesoderm field, which gives rise to endocardial cells of the cushion and valves, and a JB3 population originating from the nearby heart field mesoderm, which gives rise to the remaining endocardial cells of the heart (Wunsch et al., 1994
). Thus, at present, the spatial and temporal appearance of endocardial progenitors as well as the signaling pathways underlying the various stages of endocardial differentiation remain major unanswered questions. The identification of stage-specific molecular markers and the development of in vitro models of endocardial differentiation will help greatly to identify key regulators of endocardial development and heart morphogenesis.
We report the characterization and use of such an in vitro model consisting of a mesodermal cell line derived from the hearts of polyomavirus large T-antigen (PVLT) transgenic mice which can be differentiated into endothelial cells upon retinoic acid (RA) treatment (al Moustafa and Chalifour, 1993
). Differentiation with RA leads to down-regulation of early cardiac mesoderm markers, including GATA4, Twist and Tbx20, and activation of an endocardial endothelial phenotype characterized by the sequential appearance of various molecular markers. In this system, downregulation of GATA5 expression or inhibition of NF-ATc activation blocks endocardial differentiation at a pre-endocardial stage. Moreover, GATA5 and NF-ATc, which are presently the only known transcription factors required for endocardial differentiation, synergistically activate endocardial transcription, suggesting that they cooperate in endocardial differentiation. The results pave the way for the identification of upstream regulators and downstream targets of GATA5 that may be relevant to endocardial development and heart morphogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids and transfections
The ANF 0.7 kbp and the ET-1 1.4 kbp promoters fused to luciferase as well as the GATA5 full length expression vector were described previously (Nemer et al., 1999
). The NF-ATc expression vector was a kind gift from Dr G. Crabtree (Stanford University, USA) and was described previously (Beals et al., 1997
). TC13 cells were transfected using the calcium phosphate precipitation method. Briefly, 30 000 cells per well were plated on a 12 wells plate. 1 µg of reporter gene was used per well and total DNA was kept constant at 3 µg. For synergy assays, 25 ng of each expression vector (GATA5 and NF-ATc) were used. Luciferase activity was measured 36 hours after transfection by an LKB luminometer. The results are the mean of 3 independent experiments, each done in duplicate.
Gel shift assays
Nuclear extracts of undifferentiated and differentiated TC13 cells were obtained as described previously. Each binding mixture contained 3-5 µg of nuclear extracts. The probe used for GATA binding corresponded to the 90 BNP promoter GATA site (5' CAGGAATGTGTCTGATAAATCAGA GATAACCCA 3'). For NFAT, the probe used was the 927 BNP (CTATCC-TTTTGTTTTCCATCCTG) that was shown to interact with NFAT3 (Molkentin et al., 1998
). In the mutant NFAT probe, the binding site was altered as follows: TTTGAATTGGA. The octamer probe and conditions for octamer and GATA binding were described previously (Grépin et al., 1994
). NFAT binding was carried out according to Timmerman et al. (Timmerman et al., 1997
).
RNA extraction and PCR analysis
Total cellular RNA was extracted according to the thiocyanate-phenol-chloroforme method. cDNAs were generated from 5 µg of total RNA using an oligonucleotide dT12-18 in the presence of AMV-RT (Promega). Semi-quantitative PCR was conducted using specific oligonucleotides for each gene and a dose-response assay was carried out to determine the optimal amount of cDNA to be used for PCR amplification using the following: 3 minutes at 94°C, 30 seconds at 94°C, 30 seconds annealing temperature for each oligonucleotide pair, and 1 minute/kb at 72°C, repeated for 29 cycles. Amplification of tubulin was used as an internal control. PCR products were resolved on 1.2% agarose gels. The analysis was carried out in duplicate with RNA isolated from at least two different experiments.
Western blots
Nuclear extracts (20 µg) of TC13 cells were boiled in Laemmli buffer and resolved on SDS-PAGE. Proteins were transferred on Hybond-PVDF membranes and immunoblotted using the Renaissance Chemiluminescence system (NEN Life Sciences, Boston). Rabbit GATA4 and GATA5 antibodies were used at a dilution of 1/500, and revealed with an anti-rabbit horseradish peroxydase antibody (Sigma) at a dilution of 1/10,000.
Immunocytochemistry
TC13 cells were plated on 35 mm Petri dishes and fixed with 100% methanol. The GATA5 antibody was produced in rabbits by injecting a GATA5 truncated protein (corresponding to the C-terminal domain) fused to GST. The purified GATA5 antibody was used at a dilution of 1/50 and revealed by an anti-avidin D FITC or rhodamine or peroxydase conjugate. The anti-Von-Willebrand and anti-GATA4 antibodies were purchased from Santa Cruz Biotechnology and used at a 1/200 dilution. The Cx37 and Cx40 antibodies were purchased from Alpha Diagnostic, and used at a dilution of 1/200. An avidin-D fluorescein-coupled antibody was used to visualize the staining.
Staged mouse embryos at E9.5, 10.5 and 12.5 were dissected, fixed in 4% paraformaldehyde and paraffin embedded. GATA5 staining was carried out as described above. Counterstaining was done with 1% Eosin.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
GATA5 is a member of the zinc finger family of GATA proteins, which play critical roles in cell differentiation and organogenesis (reviewed by Charron and Nemer, 1999
). The Gata5 gene is expressed during early embryogenesis in the primitive endoderm and in the precardiac mesoderm; within the heart, GATA5 is largely restricted to the endocardial cells where it is present until mid gestation when it is switched off in the heart but persists in other organs like lung, gut epithelium and the urogenital ridge. This pattern of expression as well as the primary GATA5 sequence are conserved across species (Morrisey et al., 1997
; Laverriere et al., 1994
; Kelley et al., 1993
; MacNeill et al., 2000
; Reiter et al., 1999
).
A critical role for GATA5 in endoderm and heart development was demonstrated by the finding that the zebrafish faust mutant, characterized by defects in endocardial and myocardial differentiation and migration, maps to Gata5 (Reiter et al., 1999
). The sequence of the Gata5 gene in faust mutant reveals a splicing defect resulting in a 31 bp insertion that introduces a frame shift disrupting the entire C-terminal domain of the protein or a deletion within the second zinc finger (Reiter et al., 1999
). These mutations would result in the production of a transcriptionally inactive protein unable to bind DNA or activate transcription; moreover, the most frequently isolated cDNA encodes the C-terminal frame shift mutant which, based on structure:function studies (Nemer et al., 1999
) may act as a dominant-negative GATA protein. faust mutants lack endocardial cells and have reduced number of myocytes; since GATA5 expression is predominantly in endocardial cells, the defect in myocytes may be the result of defective endocardial-myocardial signaling including decreased levels of paracrine factors like neuregulins, ET-1 and PDGF that act on myocyte growth (Zhao et al., 1998
; Harada et al., 1997
; Schattemann et al., 1996
; Shimizu et al., 1999
). Additionally, since GATA5 is present in a few myocytes, a cell autonomous role in the myocardium cannot be excluded. Experiments in Xenopus embryos also revealed a critical role for GATA5 in endoderm differentiation (Weber et al., 2000
) but did not address its role in the heart.
In contrast to the situation in zebrafish and in Xenopus, the role of GATA5 in mammalian development remains uncertain largely because of the phenotype of mice in which the Gata5 gene was mutated. These mice were viable and fertile but females displayed genitourinary abnormalities, raising the possibility that other GATA factors may compensate for GATA5 in endoderm and heart development (Molkentin et al., 2000
). While this possibility cannot be excluded, it is worth noting that the strategy used targeted the first coding exon, resulting in deletion of the first 157 aa; a truncated protein containing both zinc fingers and the C-terminal activation domain could still be produced and would be transcriptionally active (Nemer et al., 1999
). In fact, characterization of the Gata5 locus and cDNA analysis has already revealed the presence of two alternate non-coding first exons (MacNeill et al., 1997
) resulting in two distinct GATA5 transcripts, one of which lacking the entire exon 2 (which was targeted in the mouse model). Such N-terminal truncated protein which is found in embryonic but not adult heart (MacNeill et al., 1997
) retains DNA binding and transcriptional activation properties (Nemer et al., 1999
). Given that alternate splicing and alternate translation initiation have also been reported for GATA1 (Ito et al., 1993
; Calligaris et al., 1995
; Ito et al., 1993
), the possible presence of truncated GATA5 protein in the GATA5 null mice cannot be ruled out. Consequently, the role of GATA5 in mammalian development and more specifically its conserved role in the heart cannot be unequivocally determined based on the mouse model.
The work presented here, using a novel in vitro cell system, indicates that GATA5 is essential for differentiation of committed cardiogenic precursors into endothelial endocardial cells, suggesting that GATA5 function in heart development is indeed conserved across species. The results also provide further evidence for an autonomous role of GATA5 in cardiac cells as suggested by analysis of the zebrafish faust mutant (Reiter et al., 1999
). Based on the time course expression of the different endothelial markers, it is also suggested that GATA5 is not essential for initiation of endocardial endothelial differentiation but rather it appears to be required for progression of the differentiation program. This is consistent with the in vivo expression pattern of GATA5 and the findings in the faust mutant. Interestingly, the role of GATA5 in terminal endocardial differentiation is reminiscent of the role of GATA4 in myocyte differentiation (Grépin et al., 1997
) of GATA1 in terminal erythroid differentiation (Shivdasani et al., 1997
), and GATA3 in T-cell differentiation (Ting et al., 1996
).
The molecular basis underlying the role of GATA5 in endocardial differentiation is not defined yet but the in vitro system described here will allow identification of GATA5 target genes as well as GATA5 collaborators. It is noteworthy that many endocardial genes may well be direct GATA5 targets as they contain conserved GATA binding sites in their promoter. These include Msx1 (Chen and Solursh, 1995
), P-selectin (Pan and McEver, 1993
), TnX (Matsumoto et al., 1994
), and ET-1, which was shown to be a preferential GATA5 target (Nemer et al., 1999
). It is also possible that GATA5 may be the nuclear target of inductive signals required for endocardial differentiation, such as TGFß (Ramsdell and Markwald, 1997
). In this regard, it is noteworthy that, in myocardial cells, GATA4 is targeted by cardiogenic factors of the TGFß family (Schultheiss et al., 1997
; Monzen et al., 1999
).
In addition to the myocardium, GATA4 is also prominently expressed in endocardial cells in vivo and in TC13 cells throughout differentiation (Figs 1![]()
![]()
-5). Recent genetic evidence suggests an important role for GATA4 in valve development and heart morphogenesis as revealed from a knock-in mutation affecting GATA4 interaction with its cofactor FOG2 (Crispino et al., 2001
). Whether this reflects a requirement for GATA4 in the endocardium or in the myocardium (or both) remains uncertain given that the role of GATA4 in the endocardium is undefined. Interestingly, other GATA factors, including GATA5, which is coexpressed with GATA4 in the endocardium, did not compensate for GATA4 absence. Our finding that GATA4 expression precedes GATA5 in endocardial differentiation may explain why GATA5 could not compensate for GATA4 in the mutant mice and suggest that GATA4 may be essential for survival and/or proliferation of endocardial progenitors. The characterization of an in vitro model of endocardial differentiation will greatly help elucidate the molecular pathways and genes involved in commitment and differentiation of the endocardial lineage, including upstream GATA4 and GATA5 regulators and downstream targets. This in turn might provide much needed insight into valvuloseptal morphogenesis, defects of which account for the majority of congenital heart defects.
|
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
al Moustafa, A. E. and Chalifour, L. E. (1993). Immortal cell lines isolated from heart differentiate to an endothelial cell lineage in the presence of retinoic acid. Cell Growth Diff. 4, 841-847.[Abstract]
Basson, C. T., Bachinsky, D. R., Lin, R. C., Levi, T., Elkins, J. A., Soults, J., Grayzel, D., Kroumpouzou, E., Traill, T. A., Leblanc-Straceski, J., Renault, B., Kucherlapati, R., Seidman, J. G. and Seidman, C. E. (1997). Mutations in human TBX5 [corrected] cause limb and cardiac malformation in Holt-Oram syndrome. Nat. Genet. 15, 30-35.[Medline]
Beals, C. R., Clipstone, N. A., Ho, S. N. and Crabtree, G. R. (1997). Nuclear localization of NF-ATc by a calcineurin-dependent, cyclosporin- sensitive intramolecular interaction. Genes Dev. 11, 824-834.
Biben, C., Weber, R., Kesteven, S., Stanley, E., McDonald, L., Elliott, D. A., Barnett, L., Koentgen, F., Robb, L., Feneley, M. and Harvey, R. P. (2000). Cardiac septal and valvular dysmorphogenesis in mice heterozygous for mutations in the homeobox gene Nkx2-5. Circ. Res. 87, 888-895.
Bruneau, B. G., Nemer, G., Schmitt, J. P., Charron, F., Robitaille, L., Caron, S., Conner, D. A., Gessler, M., Nemer, M., Seidman, C. E. and Seidman, J. G. (2001). A murine model of Holt-Oram syndrome defines roles of the T-box transcription factor Tbx5 in cardiogenesis and disease. Cell 106, 709-721.[Medline]
Burch, G. H., Bedolli, M. A., McDonough, S., Rosenthal, S. M. and Bristow, J. (1995). Embryonic expression of tenascin-X suggests a role in limb, muscle, and heart development. Dev. Dyn. 203, 491-504.[Medline]
Calligaris, R., Bottardi, S., Cogoi, S., Apezteguia, I. and Santoro, C. (1995). Alternative translation initiation site usage results in two functionally distinct forms of the GATA1 transcription factor. Proc. Natl. Acad. Sci. USA 92, 11598-11602.
Carmeliet, P., Ferreira, V., Breier, G., Pollefeyt, S., Kieckens, L., Gertsenstein, M., Fahrig, M., Vandenhoeck, A., Harpal, K., Eberhardt, C., Declercq, C., Pawling, J., Moons, L., Collen, D., Risau, W. and Nagy, A. (1996). Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 380, 435-439.[Medline]
Chan-Thomas, P. S., Thompson, R. P., Robert, B., Yacoub, M. H. and Barton, P. J. (1993). Expression of homeobox genes Msx-1 (Hox-7) and Msx-2 (Hox-8) during cardiac development in the chick. Dev. Dynam. 197, 203-216.[Medline]
Charron, F. and Nemer, M. (1999). GATA transcription factors and cardiac development. Sem. Cell Dev. Biol. 10, 85-91.[Medline]
Chen, Y. and Solursh, M. (1995). Mirror-image duplication of the primary axis and heart in Xenopus embryos by the overexpression of Msx-1 gene. J. Exp. Zool. 273, 170-174.[Medline]
Crispino, J. D., Lodish, M. B., Thurberg, B. L., Litovsky, S. H., Collins, T., Molkentin, J. D. and Orkin, S. H. (2001). Proper coronary vascular development and heart morphogenesis depend on interaction of GATA4 with FOG cofactors. Genes Dev. 15, 839-844.
de la Pompa, J. L., Timmerman, L. A., Takimoto, H., Yoshida, H., Elia, A. J., Samper, E., Potter, J., Wakeham, A., Marengere, L., Langille, B. L., Crabtree, G. R. and Mak, T. W. (1998). Role of the NF-ATc transcription factor in morphogenesis of cardiac valves and septum. Nature 392, 182-186.[Medline]
Delorme, B., Dahl, E., Jarry-Guichard, T., Briand, J. P., Willecke, K., Gros, D. and Theveniau-Ruissy, M. (1997). Expression pattern of connexin gene products at the early developmental stages of the mouse cardiovascular system. Circ. Res. 81, 423-437.
Dorfman, D. M., Wilson, D. B., Bruns, G. A. and Orkin, S. H. (1992). Human transcription factor GATA2. Evidence for regulation of preproendothelin-1 gene expression in endothelial cells. J. Biol. Chem. 267, 1279-1285.
Eisenberg, L. M. and Markwald, R. R. (1995). Molecular regulation of atrioventricular valvuloseptal morphogenesis. Circ. Res. 77, 1-6.
Ferrara, N., Carver-Moore, K., Chen, H., Dowd, M., Lu, L., OShea, K. S., Powell-Braxton, L., Hillan, K. J. and Moore, M. W. (1996). Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature 380, 439-442.[Medline]
Firulli, A. B., McFadden, D. G., Lin, Q., Srivastava, D. and Olson, E. N. (1998). Heart and extra-embryonic mesodermal defects in mouse embryos lacking the bHLH transcription factor Hand1. Nat. Genet. 18, 266-270.[Medline]
Grépin, C., Dagnino, L., Robitaille, L., Haberstroh, L., Antakly, T. and Nemer, M. (1994). A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription. Mol. Cell. Biol. 14, 3115-3129.
Grépin, C., Nemer, G. and Nemer, M. (1997). Enhanced cardiogenesis in embryonic stem cells overexpressing the GATA4 transcription factor. Development 124, 2387-2395.[Abstract]
Harada, M., Itoh, H., Nakagawa, O., Ogawa, Y., Miyamoto, Y., Kuwahara, K., Ogawa, E., Igaki, T., Yamashita, J., Masuda, I., Yoshimasa, T., Tanaka, I., Saito, Y. and Nakao, K. (1997). Significance of ventricular myocytes and nonmyocytes interaction during cardiocyte hypertrophy: evidence for endothelin-1 as a paracrine hypertrophic factor from cardiac nonmyocytes. Circulation 96, 3737-3744.
Iio, A., Koide, M., Hidaka, K. and Morisaki, T. (2001). Expression pattern of novel chick T-box gene, Tbx20. Dev. Genes Evol. 211, 559-562.[Medline]
Ito, E., Toki, T., Ishihara, H., Ohtani, H., Gu, L., Yokoyama, M., Engel, J. D. and Yamamoto, M. (1993). Erythroid transcription factor GATA1 is abundantly transcribed in mouse testis. Nature 362, 466-468.[Medline]
Kasahara, H., Lee, B., Schott, J. J., Benson, D. W., Seidman, J. G., Seidman, C. E. and Izumo, S. (2000). Loss of function and inhibitory effects of human CSX/NKX2.5 homeoprotein mutations associated with congenital heart disease. J. Clin. Invest. 106, 299-308.[Medline]
Kelley, C., Blumberg, H., Zon, L. I. and Evans, T. (1993). GATA4 is a novel transcription factor expressed in endocardium of the developing heart. Development 118, 817-827.[Abstract]
Kraus, F., Haenig, B. and Kispert, A. (2001). Cloning and expression analysis of the mouse T-box gene tbx20. Mech. Dev. 100, 87-91.[Medline]
Kurihara, Y., Kurihara, H., Oda, H., Maemura, K., Nagai, R., Ishikawa, T. and Yazaki, Y. (1995). Aortic arch malformations and ventricular septal defect in mice deficient in endothelin-1. J. Clin. Invest. 96, 293-300.
Laverriere, A. C., MacNeill, C., Mueller, C., Poelmann, R. E., Burch, J. B. and Evans, T. (1994). GATA4/5/6, a subfamily of three transcription factors transcribed in developing heart and gut. J. Biol. Chem. 269, 23177-23184.
Lee, M. E., Temizer, D. H., Clifford, J. A. and Quertermous, T. (1991). Cloning of the GATAbinding protein that regulates endothelin-1 gene expression in endothelial cells. J. Biol. Chem. 266, 16188-16192.
Lee, R. K., Stainier, D. Y., Weinstein, B. M. and Fishman, M. C. (1994). Cardiovascular development in the zebrafish. II. Endocardial progenitors are sequestered within the heart field. Development 120, 3361-3366.[Abstract]
Liao, W., Bisgrove, B. W., Sawyer, H., Hug, B., Bell, B., Peters, K., Grunwald, D. J. and Stainier, D. Y. (1997). The zebrafish gene cloche acts upstream of a flk-1 homologue to regulate endothelial cell differentiation. Development 124, 381-389.[Abstract]
Lin, Q., Schwarz, J., Bucana, C. and Olson, E. N. (1997). Control of mouse cardiac morphogenesis and myogenesis by transcription factor mef2c. Science 276, 1404-1407.
Lough, J. and Sugi, Y. (2000). Endoderm and heart development. Dev. Dyn. 217, 327-342.[Medline]
Lyons, I., Parsons, L. M., Hartley, L., Li, R., Andrews, J. E., Robb, L. and Harvey, R. P. (1995). Myogenic and morphogenetic defects in the heart tubes of murine embryos lacking the homeo box gene Nkx2-5. Genes Dev. 9, 1654-1666.
MacNeill, C., Ayres, B., Laverriere, A. C. and Burch, J. B. (1997). Transcripts for functionally distinct isoforms of chicken GATA5 are differentially expressed from alternative first exons. J. Biol. Chem. 272, 8396-8401.
MacNeill, C., French, R., Evans, T., Wessels, A. and Burch, J. B. (2000). Modular regulation of cGATA5 gene expression in the developing heart and gut. Dev. Biol. 217, 62-76.[Medline]
Matsumoto, K., Saga, Y., Ikemura, T., Sakakura, T. and Chiquet-Ehrismann, R. (1994). The distribution of tenascin-X is distinct and often reciprocal to that of tenascin-C. J. Cell Biol. 125, 483-493.
Mikawa, T., Cohen-Gould, L. and Fischman, D. A. (1992). Clonal analysis of cardiac morphogenesis in the chicken embryo using a replication-defective retrovirus. III: Polyclonal origin of adjacent ventricular myocytes. Dev. Dynam. 195, 133-141.[Medline]
Molkentin, J. D., Lu, J. R., Antos, C. L., Markham, B., Richardson, J., Robbins, J., Grant, S. R. and Olson, E. N. (1998). A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell 93, 215-228.[Medline]
Molkentin, J. D., Tymitz, K. M., Richardson, J. A. and Olson, E. N. (2000). Abnormalities of the genitourinary tract in female mice lacking GATA5. Mol. Cell Biol. 20, 5256-5260.
Monzen, K., Shiojima, I., Hiroi, Y., Kudoh, S., Oka, T., Takimoto, E., Hayashi, D., Hosoda, T., Habara-Ohkubo, A., Nakaoka, T., Fujita, T., Yazaki, Y. and Komuro, I. (1999). Bone morphogenetic proteins induce cardiomyocyte differentiation through the mitogen-activated protein kinase TAK1 and cardiac transcription factors Csx/Nkx-2.5 and GATA4. Mol. Cell. Biol. 19, 7096-7105.
Morrisey, E. E., Ip, H. S., Tang, Z. H., Lu, M. M. and Parmacek, M. S. (1997). GATA5 a transcriptional activator expressed in a novel temporally and spatially-restricted pattern during embryonic development. Dev. Biol. 183, 21-36.[Medline]
Nemer, G., Qureshi, S. A., Malo, D. and Nemer, M. (1999). Functional analysis and chromosomal mapping of GATA5, a gene encoding a zinc finger DNA-binding protein. Mamm. Genome 10, 993-999.[Medline]
Pan, J. and McEver, R. P. (1993). Characterization of the promoter for the human P-selectin gene. J. Biol. Chem. 268, 22600-22608.
Pehlivan, T., Pober, B. R., Brueckner, M., Garrett, S., Slaugh, R., van Rheeden, R., Wilson, D. B., Watson, M. S. and Hing, A. V. (1999). GATA4 haploinsufficiency in patients with interstitial deletion of chromosome region 8p23.1 and congenital heart disease. Am. J. Med. Genet. 83, 201-206.[Medline]
Peng, J., Zhang, L., Drysdale, L. and Fong, G. H. (2000). The transcription factor EPAS-1/hypoxia-inducible factor 2alpha plays an important role in vascular remodeling. Proc. Natl. Acad. Sci. USA 97, 8386-8391.
Puri, M. C., Partanen, J., Rossant, J. and Bernstein, A. (1999). Interaction of the TEK and TIE receptor tyrosine kinases during cardiovascular development. Development 126, 4569-4580.[Abstract]
Ramsdell, A. F. and Markwald, R. R. (1997). Induction of endocardial cushion tissue in the avian heart is regulated, in part, by TGFbeta-3-mediated autocrine signaling. Dev. Biol. 188, 64-74.[Medline]
Ranger, A. M., Grusby, M. J., Hodge, M. R., de la Brousse, F. C., Gravallese, E. M., Hoey, T., Mickanin, C., Baldwin, H. S. and Glimcher, L. H. (1998). The transcription factor NF-ATc is essential for cardiac valve formation. Nature 392, 186-190.[Medline]
Reiter, J. F., Alexander, J., Rodaway, A., Yelon, D., Patient, R., Holder, N. and Stainier, D. Y. (1999). Gata5 is required for the development of the heart and endoderm in zebrafish. Genes Dev. 13, 2983-2995.
Robb, L., Mifsud, L., Hartley, L., Biben, C., Copeland, N. G., Gilbert, D. J., Jenkins, N. A. and Harvey, R. P. (1998). epicardin: A novel basic helix-loop-helix transcription factor gene expressed in epicardium, branchial arch myoblasts, and mesenchyme of developing lung, gut, kidney, and gonads. Dev. Dyn. 213, 105-113.[Medline]
Schattemann, G. C., Loushin, C., Li, T. and Hart, C. E. (1996). PDGF-A is required for normal murine cardiovascular development. Dev. Biol. 176, 133-142.[Medline]
Schott, J. J., Benson, D. W., Basson, C. T., Pease, W., Silberbach, G. M., Moak, J. P., Maron, B. J., Seidman, C. E. and Seidman, J. G. (1998). Congenital heart disease caused by mutations in the transcription factor NKX2-5. Science 281, 108-111.
Schultheiss, T. M., Burch, J. B. and Lassar, A. B. (1997). A role for bone morphogenetic proteins in the induction of cardiac myogenesis. Genes Dev. 11, 451-462.
Shimizu, T., Kinugawa, K., Yao, A., Sugishita, Y., Sugishita, K., Harada, K., Matsui, H., Kohmoto, O., Serizawa, T. and Takahashi, T. (1999). Platelet-derived growth factor induces cellular growth in cultured chick ventricular myocytes. Cardiovasc. Res. 41, 641-653.
Shivdasani, R. A., Fujiwara, Y., McDevitt, M. A. and Orkin, S. H. (1997). A lineage-selective knockout establishes the critical role of transcription factor GATA1 in megakaryocyte growth and platelet development. EMBO J. 16, 3965-3973.[Medline]
Srivastava, D., Cserjesi, P. and Olson, E. N. (1995). A subclass of bHLH proteins required for cardiac morphogenesis. Science 270, 1995-1999.
Srivastava, D., Thomas, T., Lin, Q., Kirby, M. L., Brown, D. and Olson, E. N. (1997). Regulation of cardiac mesodermal and neural crest development by the bhlh transcription factor, dhand. Nat. Genet. 16, 154-160.[Medline]
Stainier, D. Y., Weinstein, B. M., Detrich, H. W., III, Zon, L. I. and Fishman, M. C. (1995). Cloche, an early acting zebrafish gene, is required by both the endothelial and hematopoietic lineages. Development 121, 3141-3150.[Abstract]
Tanaka, M., Chen, Z., Bartunkova, S., Yamasaki, N. and Izumo, S. (1999). The cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple genes essential for heart development. Development 126, 1269-1280.[Abstract]
Tian, H., McKnight, S. L. and Russell, D. W. (1997). Endothelial PAS domain protein 1 (EPAS1), a transcription factor selectively expressed in endothelial cells. Genes Dev. 11, 72-82.
Timmerman, L. A., Healy, J. I., Ho, S. N., Chen, L., Goodnow, C. C. and Crabtree, G. R. (1997). Redundant expression but selective utilization of nuclear factor of activated T cells family members. J. Immunol. 159, 2735-2740.[Abstract]
Ting, C. N., Olson, M. C., Barton, K. P. and Leiden, J. M. (1996). Transcription factor GATA3 is required for development of the T-cell lineage. Nature 384, 474-478.[Medline]
Weber, H., Symes, C. E., Walmsley, M. E., Rodaway, A. R. and Patient, R. K. (2000). A role for GATA5 in Xenopus endoderm specification. Development 127, 4345-4360.[Abstract]
Wunsch, A. M., Little, C. D. and Markwald, R. R. (1994). Cardiac endothelial heterogeneity defines valvular development as demonstrated by the diverse expression of JB3, an antigen of the endocardial cushion tissue. Dev. Biol. 165, 585-601.[Medline]
Zhao, Y. Y., Sawyer, D. R., Baliga, R. R., Opel, D. J., Han, X., Marchionni, M. A. and Kelly, R. A. (1998). Neuregulins promote survival and growth of cardiac myocytes. Persistence of ErbB2 and ErbB4 expression in neonatal and adult ventricular myocytes. J. Biol. Chem. 273, 10261-10269.
This article has been cited by other articles:
![]() |
R. Georges, G. Nemer, M. Morin, C. Lefebvre, and M. Nemer Distinct Expression and Function of Alternatively Spliced Tbx5 Isoforms in Cell Growth and Differentiation Mol. Cell. Biol., June 15, 2008; 28(12): 4052 - 4067. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Mellstrom, M. Savignac, R. Gomez-Villafuertes, and J. R. Naranjo Ca2+-Operated Transcriptional Networks: Molecular Mechanisms and In Vivo Models Physiol Rev, April 1, 2008; 88(2): 421 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Khandekar, W. Brandt, Y. Zhou, S. Dagenais, T. W. Glover, N. Suzuki, R. Shimizu, M. Yamamoto, K.-C. Lim, and J. D. Engel A Gata2 intronic enhancer confers its pan-endothelia-specific regulation Development, May 1, 2007; 134(9): 1703 - 1712. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Morin, G. Pozzulo, L. Robitaille, J. Cross, and M. Nemer MEF2-dependent Recruitment of the HAND1 Transcription Factor Results in Synergistic Activation of Target Promoters J. Biol. Chem., September 16, 2005; 280(37): 32272 - 32278. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Oka, Y.-S. D |