|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
Section of Molecular and Cellular Biology, University of California, Davis, CA 95616, USA
*Author for correspondence (e-mail: csgasser{at}ucdavis.edu)
Accepted 11 June 2002
| SUMMARY |
|---|
|
|
|---|
Key words: YABBY, Reproductive development, Seed, Polarity, Arabidopsis thaliana
| INTRODUCTION |
|---|
|
|
|---|
Arabidopsis ovule morphogenesis superficially resembles shoot and flower development (Robinson-Beers et al., 1992
; Schneitz et al., 1995
). An axis (the ovule primordium) gives rise to two lateral organs (the integuments) from regions flanking the apex. The inner integument develops as a radially symmetrical structure that surrounds the terminal nucellus. In contrast, the outer integument is asymmetrical from its inception; it initiates only on the abaxial side of the ovule primordium (the side closest to the base of the gynoecium) and subsequently grows extensively from this side. The Arabidopsis INNER NO OUTER (INO) gene has been associated with both polarity determination and outer integument initiation in ovule development (Villanueva et al., 1999
). INO encodes a putative transcription factor and is one of the six members of the YABBY gene family in Arabidopsis. INO mRNA initially accumulates only on the abaxial side of ovule primordia at the site of outer integument initiation, and subsequently in only the outer of the two cell layers of the developing outer integument (Balasubramanian and Schneitz, 2000
; Villanueva et al., 1999
). Strong ino mutants completely lack outer integuments and the absence of integument growth was correlated with decrease in INO mRNA, implicating INO as a potential positive regulator of its own expression. Ovules of superman (sup) mutants have nearly equal growth of the outer integument on both the abaxial and adaxial sides of the ovule primordium (Gaiser et al., 1995
). The ectopic growth of the outer integument was found to be associated with an apparent spread of INO mRNA to the adaxial side of the ovule in sup mutants and thus, SUP was hypothesized to be a negative regulator of INO expression (Villanueva et al., 1999
).
We describe the identification of a region of the INO gene sufficient to reproduce the endogenous pattern of expression in transgenic plants. Reporter gene constructs utilizing this putative INO promoter enable more refined analysis of regulation of INO expression by allowing monitoring of transcription in mutants and transgenic plants. Use of the promoter for ectopic expression of SUP and another member of the YABBY family indicated that INO is involved in a positive autoregulatory circuit that is attenuated by SUP. This regulatory circuit is required for initiation and asymmetric growth of the Arabidopsis outer integument, supporting the strict requirement for spatial confinement of regulatory gene expression in lateral organ growth.
| MATERIALS AND METHODS |
|---|
|
|
|---|
P-INO::GUS::INO3': To isolate the INO5'-flanking region, the oligonucleotide INO5'BAMHISDM (CTCCTATCATTCATCGGATCCACACACTCTCTATGAC) was used to introduce a BamHI site upstream the putative INO start codon by site directed mutagenesis in pSAO1. The 2.3 kb SalI/BamHI fragment was inserted into these same sites in pBluescriptKS (Stratagene, La Jolla, CA) creating pRJM25. The region 3' of the INO stop codon was amplified from pSAO1 using the primers INOCHMK1 (GCTCTAGAGAGAAGAGTCCTTGG) and M13reverse; the resulting 2.0 kb fragment was inserted into the XbaI/EcoRI digested pLITMUS28 (New England Biolabs, Beverly, MA) (pRJM06). The INO5' fragment of pRJM25, the GUS coding sequence fragment from pHK7 and the INO3' fragment of pRJM06 were assembled in pBJ61 forming pRJM65. The regions flanking the coding sequence are identical to those in the previously described pRJM33 (Villanueva et al., 1999
).
P-INO::GUS::NOS3': The SalI/EcoRI fragment of pRJM65 comprising P-INO and GUS coding regions was inserted into pHK7, replacing the promoter and GUS coding sequence of that clone, creating pRJM77.
P-INO::INO:GFP::NOS3': The INO cDNA (pRJM23) (Villanueva et al., 1999
) was modified by PCR to introduce an XhoI site upstream of the start codon and to replace the stop codon with both PstI and NcoI restriction sites using the primers INO5'XHOI (ATACTCGAGATGACAAAGCTCCCCAAC) and INO3'PSTINCOI (AATCCATGGCTGCAGCTCAAATGGAGATTTTCC). This 0.7 kb fragment was inserted into pLITMUS28, creating pRJM107. Using pRJM25, a HindIII and XhoI site were added at the 5' and 3' termini, respectively, of the INO5' region by inserting double stranded oligonucleotides into existing restriction sites, creating pRJM192. The INO5' fragment of pRJM192, the INO coding sequence of pRJM107 and the PstI/KpnI fragment of pRJM86 (containing the GFP1.1.5 coding sequence) (Schumacher et al., 1999
) were assembled in pMON999 as pLMK20. pMON999 contained a modified cauliflower mosaic virus 35S promoter (35S) (Kay et al., 1987
), which was removed in this cloning, and the polyadenlyation signal sequence of nopaline synthase (NOS3') flanking a multiple cloning site.
35S::INO::NOS3': The INO coding sequence of pRJM23 was transferred as a BamHI/XbaI fragment into BglII/XbaI digested pMON999, creating pRJM64.
P-INO::SUP::INO3': The INO coding sequence of pRJM33 was replaced with the 0.6 kb SUP cDNA fragment of pHS-SUPL1 (Sakai et al., 1995
) using restriction enzymes BamHI and XhoI (pRJM88).
P-INO::CRC::INO3': BamHI and XbaI restriction sites were added to the CRC coding sequence (Bowman and Smyth, 1999
) 5' and 3' termini, respectively, by PCR using the primers 2567 (GGATCCGCGGTTTTCAA) and CRCCHMJ2 (CTTCTAGACCAAAGGGACATAGCAAGTG) and the resulting product was cloned into pLITMUS28 as pRJM22. The 0.8 kb coding sequence fragment was used to replace the INO cDNA fragment of pRJM33 (pRJM45).
Plants and plant transformation
Plants were grown as previously described (Kranz and Kirchheim, 1987
; Robinson-Beers et al., 1992
) under continuous light.
ino-1 and ino-4 have been described previously (Villanueva et al., 1999
). To create an ino-1 (Ler)/INO (Col) segregating population for transformation, an ino-1 plant was crossed to a wild-type Col plant and heterozygous F2 seed were collected. The genotype at the INO locus in F3 progeny was determined using a Col/Ler sequence polymorphism that is evaluated by PCR using the primers INOsslpfor (CCTTAACTGCTAAATGTAACCC) and INOsslprev (CAGCTGTGTTTCTTTTTCCATC), which amplifies a fragment deriving from a location 4.8 kb 3' of the ino-1 lesion.
All transgenes were shuttled as NotI fragments into the plant transformation vector pMLBART (Gleave, 1992
). Resulting plasmids were transferred into the Agrobacterium tumefaciens strain ASE (Fraley et al., 1985
) by triparental mating (Figurski and Helinski, 1979
). Plant transformation was performed as described previously (Clough and Bent, 1998
) and transformants were selected for phosphoinothricine (BASTA) resistance.
Histochemical staining
Histochemical staining for ß-glucuronidase activity (Jefferson, 1987
) was performed in 25 mM KPO4 (pH 7.0), 1.25 mM K3Fe(CN)6, 1.25 mM K4Fe(CN)6, 0.25 mM EDTA, 0.25% (v/v) Triton X-100, 20% (v/v) methanol containing either 12.5 µg/ml or 125 µg/ml (as indicated in the text) 5-bromo-4-chloro-3-indolyl ß-D-glucuronide cyclohexylamine salt (X-gluc) (Rose Scientific, Alberta, Canada). Prior to staining, plant material was fixed for 15 minutes in 90% acetone, followed by two washes in the assay solution (without X-gluc). Tissue was stained at 37°C for 15 hours and stored in 70% ethanol at 4°C.
Microscopy
Stained tissue was dissected, mounted in water and visualized using a Zeiss (Oberkochen, Germany) Axioplan microscope with differential interference contrast (DIC) optics. Confocal microscopy was performed on a Leica (Mannheim, Germany) TCS-SP scanning laser confocal microscope with differential interference contrast optics. Dissected tissue was mounted in water and GFP was excited using an argon laser (448 nm) and emission was monitored between 510-550 nm. Scanning electron microscopy was preformed as described previously (Broadhvest et al., 2000
). Images were recorded digitally and processed using Photoshop 6.0 software (Adobe Systems, San Jose, CA).
| RESULTS |
|---|
|
|
|---|
|
To confirm the P-INO::INO:GFP::NOS3' expression data and create a more easily assayed reporter construct, both translational and transcriptional fusions of the coding sequence of E. coli ß-glucuronidase (GUS) to P-INO were assembled. The translational fusion, P-INO::INOgen:GUS::INO3', included regions both upstream and downstream of the genomic INO coding sequence in addition to all endogenous introns. Transcriptional fusions used P-INO to drive production of GUS in conjunction with either the putative endogenous INO polyadenylation signal sequence, (P-INO::GUS::INO3') or the NOS3' sequence (P-INO::GUS::NOS3'). GUS activity for each construct was examined in Ino+ plants (either with at least one endogenous INO allele or homozygous ino-1 complemented by the translational fusion) and was found to be indistinguishable among the three transgenes, closely mimicking endogenous INO expression and the INO:GFP transgene (Fig. 1P-T and data not shown). GUS activity was first observed at stage 2-III, in the few cells that form and subtend the outer integument. During the following developmental stages, GUS staining was restricted to the outer integument, but appeared to extend to the adaxial side of the ovule primordium by stage 2-V. Activity dropped to an undetectable level by stage 4-I. Expansion of GUS activity into the funiculus, inner integument or nucellus was not observed. Thus, staining for GUS activity appeared to initiate slightly later, extend further around the ovule primordium, and persist longer than signals detected in either in situ analysis of INO mRNA or confocal analysis of the P-INO::INO:GFP::NOS3' transgene. Because these differences can be accounted for by a combination of GUS protein stability and diffusion of the primary enzymatic product of GUS (Jefferson, 1987
), the P-INO::GUS::INO3' transgene provided an effective means of monitoring expression from P-INO in the presence or absence of functional INO.
In summation, expression from P-INO was found to be confined to the abaxial side of the ovule primordium, and to the cells giving rise to and subsequently constituting the outer layer of the outer integument. The nuclear localization of the INO:GFP protein and the ability of the P-INO::INO:GFP::NOS3' transgene to complement the ino-1 mutation provides further evidence that the nucleus is the normal site of action of INO, consistent with its previously hypothesized role as a transcription factor (Villanueva et al., 1999
).
Reduced P-INO::GUS expression in ino-1
Effects of known ino alleles are limited to ovule development (Villanueva et al., 1999
) (Fig. 1U-Y). In ino-1 mutant plants, ovule development is similar to wild-type development until stage 2-III, at which time the outer integument fails to initiate. The inner integument is unaffected and envelops the nucellus by stage 3-I. In the absence of an outer integument, the ovules remain largely erect and the micropyle is not positioned near the funiculus.
Based on a lack of detectable INO transcript in in situ hybridizations of the strong ino-1 mutant, we previously hypothesized that either INO was a positive regulator of its own expression or that the ino-1 mutation led to a reduced INO transcript stability (Villanueva et al., 1999
). To distinguish between these two hypotheses, P-INO::GUS::INO3' expression was analyzed in a homozygous ino-1 background. Since this transgene does not contain the ino-1 mutant coding sequence, any alterations in expression should be due to changes in expression level through the promoter. With the concentration of the GUS substrate used for analysis of wild-type plants, GUS activity from the P-INO::GUS::INO3' transgene was undetectable at any stage in ino-1 mutants. However, when the substrate concentration was increased ten-fold, GUS activity was detectable (Fig. 1Z-1DD). Activity was first observed at stage 2-III in only the abaxial side of the ovule primordium, the same location where GUS initially accumulated in wild-type ovules. GUS activity persisted in this location until stage 2-V, but expansion of GUS activity to the adaxial side of the ovule primordium was not observed. Thus, although P-INO::GUS::INO3' expression is initiated at the correct time and location in ino-1 mutants, expression was reduced and less persistent relative to that in wild type. This shows that a positive influence of INO on P-INO is necessary to achieve the endogenous expression profile.
INO is not sufficient to activate ectopic expression of a P-INO::GUS transgene
As shown above, active INO can positively affect expression from the P-INO::GUS::INO3' transgene within the ovule. To determine if INO can promote ectopic expression from the INO promoter, plants containing a transgene for the ectopic expression of INO from the cauliflower mosaic virus 35S promoter (35S::INO::NOS3') were produced. Three classes of phenotypes were apparent in these plants (Fig. 2). In one class, the plants appeared unaffected, except for the ovules, which resembled those of plants with either the strong ino-1 or weak ino-4 alleles (data not shown). In a second class, only the leaves of the plants were affected. Both rosette and cauline leaves were curled and often also narrow or misshapen. The final class also had the leaf morphology defects but this was coupled with alterations in floral organ number and identity. In plants of this class, flowers could have supernumary organs in the outer three whorls, with the third whorl most severely affected, and a reduction or absence of fourth whorl tissue. In addition, the inflorescence had reduced internode length between flowers, resulting in a compact inflorescence structure. In plants with similar phenotypes resulting from a 35S::INO:GUS::INO3' transgene, the morphological changes were always associated with detectable GUS activity, showing that they resulted from ectopic production of INO (data not shown). Plants from the final class of 35S::INO::NOS3' transgenics were crossed to a P-INO::GUS::INO3' transgenic line. In examination of several progeny with the ectopic expression phenotypes and the P-INO::GUS::INO3' transgene (confirmed by PCR), GUS activity was not detectable outside of ovules at any stage of leaf or flower development (data not shown). These results indicate that INO is not sufficient to initiate expression from P-INO in either flower (excluding ovules) or leaf tissue.
|
|
To determine if active INO is necessary for the adaxial expression from P-INO in sup-5, activity of the P-INO::GUS:INO3' transgene was analyzed in the ino-1 sup-5 double mutant. The ino-1 mutation is epistatic to sup-5 in ovule morphogenesis and ovules of these plants resemble ino-1 mutant ovules (the floral phenotype of sup-5 is unaffected by ino-1) (Gaiser et al., 1995
). P-INO::GUS::INO3' activity in the ino-1 sup-5 double mutant duplicated that seen in the ino-1 single mutant (data not shown). Detection required the elevated concentration of X-gluc, and activity was confined to the abaxial side of the ovule primordium at all stages where it was detectable. This demonstrates that active INO is required for the expansion of INO expression across the ovule primordium in sup-5 and that the initial confinement of expression from P-INO to the abaxial side of the ovule primordium is not dependent on SUP activity.
P-INO::SUP can phenocopy effects of ino mutations
SUP appears to function as a negative regulator of integument growth and INO expression on the adaxial side of the ovule primordium. To test the hypothesis that SUP might be sufficient to inhibit these processes, a transcriptional fusion of the SUP coding sequence to the INO promoter (P-INO::SUP::INO3') was assembled and introduced into wild-type plants (Fig. 4A-E). As in wild type, in 15 primary transgenic plants, the outer integument initiated at stage 2-III and formed a small ridge of tissue on the abaxial side of the ovule primordium. In contrast to wild type, in all but one of the transformants, outer integument growth ceased by stage 2-IV, and at stage 4-I the small ridge of tissue did not cover any portion of the inner integument. These ovules superficially resembled stage 4-I ovules of ino-1 plants. In one transformant, the outer integument grew to partially cover the inner integument by stage 4-I and therefore resembled the weaker ino-4 allele (Villanueva et al., 1999
). Growth of this rudimentary outer integument in the P-INO::SUP::INO3' plants was dependent on the production of active INO; homozygous ino-1 plants (nine total) that contained the transgene did not initiate outer integument growth. Accumulation of GUS activity from the P-INO::GUS::INO3' transgene in Ino+ plants containing the P-INO::SUP::INO3' transgene was essentially identical to that observed in ino-1 mutants, being first apparent at stage 2-III at the site of outer integument initiation and persisting within the arrested outer integument only until stage 2-V (Fig. 4F-J). These results demonstrate that production of SUP on the abaxial side of the ovule primordium is sufficient to inhibit INO-dependent outer integument growth and INO expression but does not obstruct integument initiation. Therefore, SUP can function directly in cells where it is transcribed and is not dependent upon factors specific to the adaxial side of ovule primordia.
|
To determine if expression of CRC could overcome inhibition of integument growth by ectopic SUP expression, ino-1 plants containing both the P-INO::CRC::INO3' and P-INO::SUP::INO3' transgenes were isolated. In ovules of five of the 18 progeny examined, growth of the outer integument resembled that of plants containing only the P-INO::CRC::INO3' transgene; the outer integument grew from both the abaxial and adaxial sides of the ovule primordium and phenocopied sup-5 (Fig. 5A). Ovules from the remaining progeny resembled those of ino-4, with the outer integument only partially covering the inner integument, but unlike ino-4, growth from the adaxial side of the primordium did occur (Fig. 5B). The increased integument growth relative to plants lacking the CRC transgene was not due to a genetic reduction of the P-INO::SUP::INO3' transgene because the parental plants were also crossed to wild-type plants and the strong P-INO::SUP::INO3' phenotype was apparent in all progeny. Thus, the inhibitory effects of P-INO::SUP::INO3' on integument growth can be overcome by the P-INO::CRC::INO3' transgene.
|
| DISCUSSION |
|---|
|
|
|---|
SUP suppresses INO expression
SUP was previously hypothesized to function as a negative regulator of INO expression owing to an observed expansion of INO mRNA accumulation to the adaxial side of sup ovules (Villanueva et al., 1999
). Our demonstration that the P-INO::SUP::INO3' transgene was sufficient to reduce integument growth and expression from P-INO confirms this hypothesis. The observation that SUP was effective in reducing expression from P-INO reporter genes indicates that the negative regulation is manifest through the INO promoter region, and therefore must involve regulation of transcription. The recent demonstration that SUP includes a transcription repression domain (Hiratsu et al., 2002
) is consistent with this proposed role for SUP. However, endogenous SUP mRNA accumulation has only been reported in the funiculus in an area adjacent to, but not overlapping with, the chalazal region where SUP appears to suppress INO expression (Sakai et al., 1995
). Thus, SUP appears to exhibit non-cell autonomous activity in its endogenous function within the ovule but our ectopic expression results show that it can also inhibit INO expression and integument growth in the cells in which it is transcribed. The epistasis of ino to sup in ovule development (Gaiser et al., 1995
), and the complete correlation between the effects of SUP on INO expression and integument growth imply that all effects of sup mutations on ovule development are manifest through alterations in INO expression.
SUP inhibits integument growth by affecting INO autoregulation
The transcriptional regulation of INO is influenced by apparently antagonistic actions of INO and SUP. However, this relationship can be altered by changes to the INO coding sequence as evidenced by the ability of CRC to overcome the endogenous function of SUP. A model that explains these results is shown in Fig. 6. INO activates transcription from P-INO (possibly indirectly), and SUP inhibits this activation. Thus, in wild-type ovules, inhibition of INO autoregulation by SUP would block perpetuation of hypothesized incipient INO expression (expression that is undetectable by INO:GFP or in situ analysis) on the adaxial side of the ovule, maintaining the established asymmetric pattern of INO expression and outer integument growth. However, since CRC is less sensitive to the effects of SUP, the hypothesized incipient expression allows for activation of the autoregulatory pathway and subsequent growth of the outer integument. In plants harboring the P-INO::SUP::INO3' transgene, some INO is produced on the abaxial side of the ovule, due to simultaneous induction of expression, initiating integument growth. However, subsequent growth would be inhibited by the action of SUP in blocking perpetuation of INO expression.
|
While our model can explain the effects of regulatory interactions between INO and SUP, the molecular mechanisms underlying these interactions remain unclear. The conceptually simplest mechanism would be for INO to directly interact with and activate transcription from P-INO. SUP would inhibit autoregulation by interfering with the binding of INO to P-INO or activation of transcription by bound INO. CRC would bind or activate more effectively than INO in the presence of SUP. Alternatively, the actions of both INO and SUP on INO expression may be less direct. SUP has been proposed to be a negative regulator of growth (Sakai et al., 2000
; Sakai et al., 1995
). INO may be a promoter of growth and require a growth-competent state for maintenance of its expression. Thus promotion of growth would be a part of the INO autoregulatory loop, and suppression of growth, or growth competency, by SUP would be the mechanism by which SUP inhibits INO expression. CRC would be a stronger promoter of growth than INO and would thus be able to more effectively compete with SUP. Both of these mechanisms still have SUP as a formal negative regulator of INO transcription and are consistent with the proposed model. Because the direct regulation mechanism predicts interactions of INO and CRC with P-INO, and interactions of SUP with either P-INO or INO, it can be directly tested by performing experiments to detect such interactions. The tight linkage between INO expression and growth makes the second mechanism more difficult to test.
We note that our model addresses only the regulation of spatial distribution of INO expression across the width of the chalazal region during integument initiation and growth. The confinement of INO expression to a single layer of the outer integument is maintained in sup mutants, indicating that this confinement is under control of other factors. It is possible that INO autoregulation is also important in abaxial expression within the integument, and that other factors, with activities analogous to SUP, interfere with this autoregulation to maintain the pattern of expression.
INO and polarity determination
We previously proposed that INO was one determinant of abaxial chalazal identity within the ovule primordium, with extensive outer integument growth being a characteristic feature of that region. The precise correlation between asymmetric expression of INO in the ovule primordium and asymmetric growth of the integument in the current study is consistent with this hypothesis. We also now note asymmetric INO expression within the outer integument. From its earliest appearance, INO:GFP is present only in the abaxial cells of the outer integument anlagen and remains confined to the abaxial layer of the outer integument throughout development. This supports the hypothesis that INO is also functioning in determination of abaxial identity of the outer integument and could provide an explanation of the tight linkage between INO activity and outgrowth of this structure. Based on observations of mutations affecting polarity determination in leaves of Antirrhinum, Waites and Hudson (Waites and Hudson, 1995
; Waites et al., 1998
) proposed a model for lateral organ growth in which the juxtaposition of abaxial and adaxial identity is essential for both laminar and proximal-distal outgrowth. If INO is required to specify abaxial identity of the integument, the loss of an adaxial-abaxial boundary due to the absence of INO activity would result in the failure of the outer integument to extend; growth of the outer integument could then be likened to the laminar or proximal-distal extension of other aerial lateral organs. This model predicts that other mutations affecting polarity of the outer integument would lead to a reduction in its growth. Indeed, Arabidopsis plants heterozygous for the gain-of-function phb-1d mutation or homozygous for the kanadi1 kanadi2 double mutation have reduced outer integument growth (McConnell and Barton, 1998
; Eshed et al., 2001
). Thus, similar to other lateral organs, outer integument growth must have a strict requirement for correct specification and juxtaposition of polarity.
Abaxial expression of at least one YABBY gene is a common feature shared by leaves and lateral floral organs of Arabidopsis (Siegfried et al., 1999
), consistent with the possible common evolutionary origin of these structures (Gifford and Foster, 1989
). The abaxial expression of INO in the outer integument may also indicate an evolutionary link between the outer integument and leaves or leaf-derived structures.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Balasubramanian, S. and Schneitz, K. (2000). NOZZLE regulates proximal-distal pattern formation, cell proliferation and early sporogenesis during ovule development in Arabidopsis thaliana. Development 127, 4227-4238.[Abstract]
Clough, S. J. and Bent, A. F. (1998). Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735-743.[Medline]
Bowman, J. L. (2000). The YABBY gene family and abaxial cell fate. Curr. Opin. Plant Biol. 3, 17-22.[Medline]
Bowman, J. L. and Eshed, Y. (2000). Formation and maintenance of the shoot apical meristem. Trends Plant Sci. 5, 110-115.[Medline]
Bowman, J. L., Sakai, H., Jack, T., Weigel, D., Mayer, U. and Meyerowitz, E. M. (1992). SUPERMAN, a regulator of floral homeotic genes in Arabidopsis. Development 114, 599-615.[Abstract]
Bowman, J. L. and Smyth, D. R. (1999). CRABS CLAW, a gene that regulates carpel and nectary development in Arabidopsis, encodes a novel protein with zinc finger and helix-loop-helix domains. Development 126, 2387-2396.[Abstract]
Broadhvest, J., Baker, S. C. and Gasser, C. S. (2000). SHORT INTEGUMENTS 2 promotes growth during Arabidopsis reproductive development. Genetics 155, 895-907.
Eshed, Y., Baum, S. F., Perea, J. V. and Bowman, J. L. (2001). Establishment of polarity in lateral organs of plants. Curr. Biol. 11, 1251-1260.[Medline]
Figurski, D. H. and Helinski, D. R. (1979). Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76, 1648-1652.
Fraley, R. T., Rogers, S. G., Horsch, R. B., Eichholtz, D. A., Flick, J. S., Fink, C. L., Hoffmann, N. L. and Sanders, P. R. (1985). The SEV system: a new disarmed Ti plasmid vector for plant transformation. BioTechnology 3, 629-635.
Gaiser, J. C., Robinson-Beers, K. and Gasser, C. S. (1995). The Arabidopsis SUPERMAN gene mediates asymmetric growth of the outer integument of ovules. Plant Cell 7, 333-345.[Abstract]
Gifford, E. M. and Foster, A. S. (1989). Morphology and Evolution of Vascular Plants. New York, NY: W. H. Freeman.
Gleave, A. P. (1992). A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Mol. Biol. 20, 1203-1207.[Medline]
Harikrishna, K., Jampates-Beale, R., Milligan, S. B. and Gasser, C. S. (1996). An endochitinase gene expressed at high levels in the transmitting tissue of tomatoes. Plant Mol. Biol. 30, 899-911.[Medline]
Haseloff, J., Siemering, K. R., Prasher, D. C. and Hodge, S. (1997). Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proc. Natl. Acad. Sci. USA 94, 2122-2127.
Hiratsu, K., Ohta, M., Matsui, K. and Ohme-Takagi, M. (2002). The SUPERMAN protein is an active repressor whose carboxy-terminal repression domain is required for the development of normal flowers. FEBS Let. 514, 351-354.[Medline]
Hudson, A. (2001). Plant development: Two sides to organ asymmetry. Curr. Biol. 11, R756-R758.[Medline]
Jefferson, R. A. (1987). Assaying chimeric genes in plants: The GUS gene fusion system. Plant Mol. Biol. Rep. 5, 387-405.
Kay, R., Chan, A., Daly, M. and McPherson, J. (1987). Duplication of CaMV 35S promoter sequences creates a strong enhancer for plant genes. Science 236, 1299-1302.
Kerstetter, R. A., Bollman, K., Taylor, R. A., Bomblies, K. and Poethig, R. S. (2001). KANADI regulates organ polarity in Arabidopsis. Nature 411, 706-709.[Medline]
Kranz, A. R. and Kirchheim, B. (1987). Handling of Arabidopsis. In Arabidopsis Information Service, v. 24: Genetic Resources in Arabidopsis, (ed. A. R. Kranz), pp. 4.1.1-4.2.7. Frankfurt, Germany: Arabidopsis Information Service.
Kunkel, T. A. (1985). Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82, 488-492.
McConnell, J. R. and Barton, K. (1998). Leaf polarity and meristem formation in Arabidopsis. Development 125, 2935-2942.[Abstract]
McConnell, J. R., Emery, J., Eshed, Y., Bao, N., Bowman, J. and Barton, M. K. (2001). Role of PHABULOSA and PHAVOLUTA in determining radial patterning in shoots. Nature 411, 709-713.[Medline]
Ng, M. and Yanofsky, M. F. (2000). Three ways to learn the ABCs. Curr. Opin. Plant Biol. 3, 47-52.[Medline]
Robinson-Beers, K., Pruitt, R. E. and Gasser, C. S. (1992). Ovule development in wild-type Arabidopsis and two female-sterile mutants. Plant Cell 4, 1237-1249.
Sakai, H., Krizek, B., Jacobsen, S. and Meyerowitz, E. (2000). Regulation of SUP expression identifies multiple regulators involved in Arabidopsis floral meristem development. Plant Cell 12, 1607-1618.
Sakai, H., Medrano, L. J. and Meyerowitz, E. M. (1995). Role of SUPERMAN in maintaining Arabidopsis floral whorl boundaries. Nature 378, 199-203.[Medline]
Sawa, S., Watanabe, K., Goto, K., Kanaya, E., Morita, E. H. and Okada, K. (1999). FILAMENTOUS FLOWER, a meristem and organ identity gene of Arabidopsis, encodes a protein with a zinc finger and HMG-related domains. Genes Dev. 13, 1079-1088.
Schneitz, K., Hulskamp, M. and Pruitt, R. E. (1995). Wild-type ovule development in Arabidopsis thaliana: a light microscope study of cleared whole-mount tissue. Plant J. 7, 731-749.
Schultz, E. A., Pickett, F. B. and Haughn, G. W. (1991). The FLO10 gene product regulates the expression domain of homeotic genes AP3 and PI in Arabidopsis flowers. Plant Cell 3, 1221-1237.
Schumacher, K., Vafeados, D., McCarthy, M., Sze, H., Wilkins, T. and Chory, J. (1999). The Arabidopsis det3 mutant reveals a central role for the vacuolar H(+)-ATPase in plant growth and development. Genes Dev. 13, 3259-3270.
Siegfried, K. R., Eshed, Y., Baum, S. F., Otsuga, D., Drews, D. N. and Bowman, J. L. (1999). Members of the YABBY gene family specify abaxial cell fate in Arabidopsis. Development 128, 4117-4128.
Villanueva, J. M., Broadhvest, J., Hauser, B. A., Meister, R. J., Schneitz, K. and Gasser, C. S. (1999). INNER NO OUTER regulates abaxial-adaxial patterning in Arabidopsis ovules. Genes Dev. 13, 3160-3169.
Waites, R. and Hudson, A. (1995). phantastica: a gene required for dorsoventrality of leaves in Antirrhinum majus. Development 121, 2143-2154.[Abstract]
Waites, R., Selvadurai, H. R. N., Oliver, I. R. and Hudson, A. (1998). The PHANTASTICA gene encodes a MYB transcription factor involved in growth and dorsoventrality of lateral organs in Antirrhinum. Cell 93, 779-789.[Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||