|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||

Whitehead Institute for Biomedical Research, and Massachusetts Institute of Technology, Nine Cambridge Center, Cambridge, MA 02142, USA
* Present address: Wellcome Trust/Cancer Research UK Institute, Tennis Court Road, Cambridge CB2 1QR, UK
Author for correspondence (e-mail: sive{at}wi.mit.edu)
Accepted 21 June 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Xag1, Xenopus, Anterior, Ectoderm, Transgenic, Promoter analysis, Ets, ATF/CREB, Cement gland
| INTRODUCTION |
|---|
|
|
|---|
Several lines of evidence lead us to propose that the cement gland is positioned through the combination of several instructions (reviewed by Wardle and Sive, 2002
). A key step in cement gland formation involves overlap of a domain that defines anterodorsal position (AD) with a domain that defines ventrolateral position (VL) (Gammill and Sive, 1997
). As the cement gland forms only in the outer layer of ectoderm and the AD and VL domains span more than one germ layer, they must be superimposed on a domain that defines outer layer ectodermal fate (EO). Cement gland fate is therefore a summation of AD, VL and EO domains (AD + VL + EO=CG; see Fig. 7).
|
Otx2 can activate cement gland fates only in ventrolateral ectoderm and not in the neural plate, thereby defining a ventrolateral (VL) domain permissive for cement gland formation (Gammill and Sive, 1997
). This VL domain expresses high levels of BMP4 in ectoderm and mesendoderm, and may be defined by this protein or some downstream consequence of BMP signaling (Gammill and Sive, 2000
).
As both otx2 and bmp4 are expressed in more than just the ectodermal germ layer, an additional factor(s) must restrict the cement gland determination activity of these genes to the ectoderm, and specifically to the outer ectodermal layer. Selection of outer ectodermal layer fate (O) has occurred by mid-gastrula in a process that may involve suppression of cement gland fate in the inner layer (Bradley et al., 1996
). However, the factors involved in defining ectodermal identity and outer ectodermal layer specificity are unknown (Chalmers et al., 2002
).
Factors that define each of the AD, VL and EO domains must directly or indirectly interact to determine the cement gland primordium, and to activate differentiation genes such as Xcg1, Xag1 and Xa1 (Sive et al., 1989
; Sive and Bradley, 1996
). In order to begin to ask how domain-specific factors work together to direct cement gland differentiation, we have analyzed the Xag1 promoter. Xag1 encodes a protein that is likely to be retained in the endoplasmic reticulum, which may aid protein secretion and is the pioneer gene in the Agr family (D. H. W. and H.L.S., unpublished). It is expressed in both the hatching gland and cement gland. We show that elements in the Xag1 promoter that may bind members of the Ets and ATF/CREB transcription factor families are both necessary and sufficient to direct reporter gene expression specifically to the cement gland, but not hatching gland. In addition our results confirm that both Otx2-dependent and Otx2-independent pathways are involved in activation of Xag1 expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Scoring Transgenic embryos for cement gland-specific expression
Embryos expressing gfp in the cement gland were scored as positive, those embryos that did not show expression in the cement gland were scored as negative. These scored embryos did not show transgene expression outside the cement gland. Some transgenic embryos showed small patches of strong, superficial staining for gfp. This staining is reminiscent of expression seen when plasmid DNA is injected and can be seen with all constructs, including control constructs (this study) and those for other promoters, such as mfy5 (Polli and Amaya, 2002
). Such staining is easily distinguishable from normal transgene expression and, as such, embryos with this type of expression were included in scoring for cement gland expression of gfp.
Scores for each construct were tabulated and, for Figs 3 and 4, assigned to groups according to the following scheme: +++, cement gland expression of gfp in more than 25% of embryos; ++, 18-25%; +, 9-17%; +/, 2-8%; , less than 2%. These ranges were chosen to represent our experience that strong promoters drive expression in 25% or more of embryos (see also Kroll and Amaya, 1996
; Sparrow et al., 2000
; Davis et al., 2001
). We assign a value of less than 2% to represent background expression, possibly owing to the random integration of multimerized constructs recapitulating lost sites or the integration site acting as a gene trap. In support of this, throughout the course of all these experiments (in which 4178 embryos were scored) we have on a small number of occasions (up to 15 embryos) seen expression of gfp in tissues such as the somites, lateral mesoderm, the eye and regions of the brain; these embryos were not included in the scoring.
|
|
Rapid amplification of cDNA 5' ends (5' RACE)
5' RACE was performed using GibcoBRL Life Sciences kit according to manufacturers instructions, with two exceptions: (1) first strand cDNA synthesis primers were annealed to the template mRNA for 20 minutes at 70°C, followed by slow cooling to 55°C before being placed on ice; (2) the reaction time of TdT poly-dC tailing of the first-strand cDNA was limited to 2.5 minutes. All RACE PCRs underwent 30-35 cycles of 1 minute at 94°C, 1 minute at 60°C and 2 minutes at 72°C, with a hot start, as described by the manufacturer.
Primers used:
Anchor primer (I=inosine), 5' GCTACTCGAGTAACGGGIIGGGIIGGGIIG;
oligo dT first strand cDNA primer, 5' TGCGACTCGAGTTTTTTTTTTTT;
Xag1 first strand cDNA synthesis primer, 5' TGAGCACAGGAGGACAAG;
Xag1 first nested PCR primer, 5' CGTTTCTAGAAGCCTGCATTATGTCTGTGG; and
Xag1 second nested PCR primer, 5' GCTTCTAGAATGTCCTGATCCTTTTAGTC
This 5' RACE analysis yielded two classes of transcripts. A single round of PCR amplification resulted in a pool of products, all of which begin at an initiator element 25 bp downstream of a TATA box. Further amplification of this PCR product pool, using primers upstream of the TATA box, yielded a new pool of cDNAs, each of a slightly different length extending 100-150 bp upstream of the TATA box. Both of these classes of transcripts were represented in the cDNA library used for the original identification of a full-length Xag1 transcript.
Xag1 promoter constructs
8kbXag.nGFP: GFP containing a nuclear localization signal and including globin 5' and 3' sequences was excised from CMVnGFP (Kroll and Amaya, 1996
) with HindIII and NotI (blunted) and cloned into the BseRI site (blunted) of Xag1 that lies 36 bp downstream of transcription start site.
275Xag.nGFP: 8kbXag.nGFP was cut with EcoRV upstream of the transcription start site and with BstU1 downstream of nGFP cassette and ligated into the SmaI and HincII sites of pBluescript SK. Further deletion constructs were generated by PCR using GFP.L (5'AAAGGGCAGATTGTGTGGAC) and an upper primer (listed below) containing a NotI site (underlined). PCR products were cloned into NotI/BamHI site of 275bp.nGFP.
161 bp.U: 5'GGTGGCGGCCGCAAGGAAAAGTATG
102 bp.U: 5'GGTGGCGGCCGCAAGACTAAAAGGATCAGG
73 bp.U: 5'CTGGTGCGGCCGCTGACGTTGATCTCTAGC
TATA.U: 5'GCAGTTAGCGGCCGCTTGGGTATA
Linkerscan replacements were made to cover a consecutive series of 14 bp regions upstream of the transcription start site, except linkerscan 8, which replaces a downstream putative GATA-binding site of 4 bp. Linkerscan constructs in 275bpXag.nGFP were made using the QuickChange site directed mutagenesis kit (Stratagene), according to manufacturers directions. The QuickChange protocol uses two primers, the exact reverse and complement of each other. The primer corresponding to the coding strand is given below:
linkerscan 1, 5' GGTTGGGTCAAATCTAGATCACTTCTATCGACATCCTGG;
linkerscan 2, 5' CTAAAAGGATCTAGAACGAAGTTGATTAAGGCTGAC;
linkerscan 3, 5' GACATCCTGGTTAGCGAATTCTTTGGTCTCTCTAGCAGTTA;
linkerscan 4, 5' CTGACGTTGAGAATTCTACTGGCTACCTGCTTTGG;
linkerscan 5, 5' CTCTAGCAGTTAGTCTCGAGAATAGTATAAATACACCAC;
linkerscan 6, 5' CTGCTTTGGCTCTTAGAATTCCACCACCTG;
lnkerscan 7, 5' GGTATAAATACATAGTTAGAATTCGTCATCAGCATTATCTCAG;
lnkerscan 8, 5' GCAGCATTACTCGAGAGGAGC.
275bpLS2.EBSmut: the QuickChange kit was used to mutate the two distal EBS. The primer corresponding to the coding strand is given (mutations underlined). Distal site, 5' CTTGACACATCAAAGGCAGACTTGCAGGCAGG; proximal site, 5' GCCTAAAGAAAAAGGCAAGTATGATATGGG.
102bpXag.nGFP linkerscan constructs 3-8 were generated by PCR using 102bpXag and GFP.L as upper and lower primers, and 275bpXag.nGFP linkerscan constructs (3-8) as templates. NotI/BamHI fragments were then cloned into 102bpXag.nGFP.
102bpXag.nGFP linkerscan constructs 1-2 were made as above except the following upper primers were used (NotI site underlined):
102 bp linkerscan 1, 5'GGTGGCGGCCGCTCTAGATCACTTCTATCG;
102 bp linkerscan 2, 5' GGTGGCGGCCGCAAGACTAAAAGGATCTAG.
Multimerized cassette constructs were generated using the following oligonucleotides, which were annealed, filled in with Klenow, cut with NotI/SacII and cloned into NotI/SacII site of TATA.nGFP (NotI/SacII sites underlined):
5xreg1, 5' CTTGACCGCGGAGACTAAAAGGATCAGACTAAAAGGATCAGACTAAAAGGATCAGACTAAAAGGATCAGACTAAAAGGATCGCGGCCGC;
5xEBS, 5' CTTGACCGCGGAGGACATCCTGGTTAGGACATCCTGGTTAGGACATCCTGGTTAGGACATCCTGGTTAGGACATCCTGGTTGCGGCCGC;
5xCRE, 5' CTTGACCGCGGTTAAGGCTGACGTTTTAAGGCTGACGTTTTAAGGCTGACGTTTTAAGGCTGACGTTTTAAGGCTGACGTTGCGGCCGC;
5xreg5, 5' CTCGACCGCGGATACCTGCTTTGGGATACCTGCTTTGGGATACCTGCTTTGGGATACCTGCTTTGGGATACCTGCTTTGGGGCGGCCGC;
5xEBSmut, 5' CTTGACCGCGGAGGACGCCTTGGTTAGGACGCCTTGGTTAGGACGCCTTGGTTAGGACGCCTTGGTTAGGACGCCTTGGTTGCGGCCGC;
5xCREmut, 5' CTTGACCGCGGTTAAGGCTGTGGCTTTAAGGCTGTGGCTTTAAGGCTGTGGCTTTAAGGCTGTGGCTTTAAGGCTGTGGCTGCGGCCGC;
3EBS/2CRE, 5' CTTGACCGCGGAGGACATCCTGGTTAGGACATCCTGGTTAGGACATCCTGGTTTTAAGGCTGACGTTTTAAGGCTGACGTTGCGGCCGC.
MLP constructs were generated by inserting the HindIII/BamHI fragment (blunted) of MLP-PTCAT (L. Gammill, unpublished), which contains the Adenovirus Major Late Promoter, into the NotI/BseR1 (blunted) site of 5xEBS, 5xCRE or 3EBS/2CRE.nGFP. This removes the Xag1 TATA box, transcription start site and 5'UTR and replaces them with MLP. All constructs were verified by sequencing before use.
Constructs were linearized with NotI (deletion and linkerscan constructs), SacII (multimerized cassette constructs and MLP constructs) or SalI (8kbXag.nGFP), purified using GeneClean (Bio101) and diluted to give 200-250 ng/µl. MLPonly.nGFP was generated by cutting 5xEBS.MLP with PstI and SacII, which excises the 5xEBS cassette. The MLPonly.nGFP band was purified from a gel using GeneClean. All constructs were prepped and tested at least twice in at least three separate transgenic experiments.
In situ hybridization
Embryos were collected at stages indicated in the text and processed for in situ hybridization as described (Sive et al., 2000
). AntiGFP probe was made by linearizing TATA.nGFP construct with BamHI and transcribing with T7 RNA polymerase in the presence of digoxygenin-UTP (Roche) as described (Sive et al., 2000
). In most cases, in situ hybridization was used to detect gfp transcripts, as this is a more sensitive method than detecting fluorescence of the protein.
Electrophoretic gel mobility shift analysis
Embryos were collected and the region of the cement gland primordium, including both ectodermal layers and some underlying endoderm, dissected at stages 15-17. Explants were homogenized (4 µl/explant) in 50 mM Tris, 50 mM KCl, 2 mM DTT, 1 mM EDTA, 20% glycerol, 1x protease inhibitors (Complete Tablet without EDTA; Roche), 1 mM NaF, 10 mM ß-glycerophosphate. Probe was made by annealing top and bottom strand oligos and filling in with Klenow in the presence of 32P-dGTP or dCTP. Binding was carried out in 36 mM Tris pH 8, 18 mM KCl, 1.4 mM DTT, 3.6 mM MgCl2, 0.7 mM EDTA, 1 mM NaF, 10 mM ß-glycerophosphate, 1xprotease inhibitors (as above) and 300 ng/µl poly (dI-dC; Amersham) with 4 µl extract and 10,000 cpm probe with or without 200xcold competitor.
Microinjection and RT-PCR
Embryos were collected and dejellied as described (Sive et al., 2000
). Embryos were injected at the one- to two-cell stage with 50 pg of plasmid DNA as indicated in the text and 150 pg of globin or otx2 mRNA. Alternatively, the transgenesis protocol above was followed with 5xEBS, 5xCRE and TATA only constructs, embryos were sorted at the two-cell stage and injected with 150 pg of globin or otx2 mRNA, or left uninjected. Animal caps were cut at stage 9 from injected embryos and cultured to stage 17-20. RNA and cDNA from pools of 15-25 caps was prepared as described (Kolm and Sive, 1995
). The uninjected embryos were left to develop to tailbud stage, then processed for in situ to check the efficiency of transgenesis. Primers used were XCG (17 cycles), XAG (19 cycles) and ODC (21 cycles) as described elsewhere (Gammill and Sive, 1997
; Sun et al., 1999
). For GFP, 22 cycles were used with the following primers: GFP.L (listed above) and GFP.U (5' ACATCATGGCAGACAAACCA).
Sequence analysis
Potential transcription factor binding sites in the Xag1 promoter were identified using MatInspector V2.2 (Quandt et al., 1995
).
| RESULTS |
|---|
|
|
|---|
|
|
|
Sequences between 275 bp and 102 bp enhance expression
In addition to the linkerscan replacements described, the same replacements were tested in the context of the longer, 275 bp, promoter. Embryos transgenic for these constructs were scored at early tailbud stages and found to express gfp at the same frequency and levels as the wild type 275 bp construct, suggesting that sites in the more distal promoter compensate for the loss of sites in the proximal promoter, including the TATA box. To test whether the distal region alone is sufficient to drive expression of gfp to the cement gland, we made a construct consisting of the region from 275 bp to 102 bp placed in front of the Xag1 TATA box. This construct is poor at driving transcription, with cement gland-specific expression seen in only 3% of embryos (Table 1), indicating that although sites in the distal region enhance expression they are not sufficient to drive cement gland expression. We noticed two further EBS present in the distal promoter region (Fig. 1). To test whether the enhancing activity of the distal promoter can be attributed to these, we mutated the two EBS (GGAA to aGgc) in the 275 bp construct that also has a linkerscan replacement covering the proximal EBS (region 2), so that all three EBS were mutated. Embryos transgenic for this construct show cement gland-specific expression of gfp in 13% of cases (Table 1), a substantial decrease when compared with the construct containing only the proximal EBS replacement (38%; Table 1). These data confirm that a large part of the compensation shown by the distal promoter can be attributed to the two distal Ets-binding sites.
The EBS and CRE are sufficient to drive cement gland-specific expression
As the EBS, CRE and regions 1 and 5 were found to be important for cement gland-specific expression, we next asked whether they are sufficient for expression. Each region was individually multimerized fivefold and subcloned in front of the Xag1 TATA box region (20 to +23 bp). Multimerized EBS or CRE elements (5xEBS and 5xCRE) drive cement gland-specific expression of gfp at early tailbud stages in 18% of cases (Table 2; Fig. 4), ectopic expression was not seen and sectioning confirmed that expression was limited to the outer layer of ectoderm (not shown). Multimerized regions 1 or 5, however, do not drive detectable reporter gene expression (Table 2; Fig. 4). gfp expression with 5xEBS and 5xCRE was also assayed at early neurula stages; however, we were not able to detect expression until late neurula stages (stage 18). This may be because expression driven by the 5xEBS and 5xCRE constructs is very weak at early stages and so we were unable to detect it by in situ hybridization, or that these constructs are not able to drive very early expression. Mutating the core recognition sequences in 5xEBS (GGAT to aGgc; 5xEBSmut) and in 5xCRE (TGACGT to TGtgGc; 5xCREmut) causes almost complete loss of gfp expression, except 1% of cases, confirming the importance of these binding sites for expression.
|
Xag1 promoter binding activities are present in early neurula stage cement gland
To ask whether specific binding activities are present in the neurula stage embryo, electrophoretic gel mobility shift assays were performed with whole cell extracts from cement gland regions (ectoderm plus underlying endoderm) isolated from mid-neurula (stage 15-17). Probe corresponded to regions 1-5 of the Xag1 promoter, including the EBS and CRE. Fig. 5 shows that an activity binding the 102 bp promoter region (lane 2) is competed by cold Xag1 competitor (lane 3), but not a probe for the OCTA binding site, which acts as a nonspecific control (lane 8) (Hinkley and Perry, 1991
). This activity is also competed by a cold competitor for the wild-type EBS (lane 4) but not a mutated EBS (lane 5). In addition, the binding complex is competed by a cold competitor for the wild-type CRE, although competition is less strong than the EBS probe. The mutated CRE site, which abrogates promoter activity in the analysis above, weakly competes for binding under these conditions. A cold probe corresponding to regions 4 and 5 does not compete for complex binding (not shown). These results suggest that the gel shift activity observed may consist of a complex containing both an EBS-binding factor and a CRE-binding factor. At this time, we do not know whether these binding activities are specific for the cement gland.
|
Embryos were injected with plasmid DNA for either 5xEBS, 5xEBSmut, 5xCRE, 5xCREmut, 3EBS/2CRE or TATA-only nGFP constructs (Fig. 6) along with either globin control mRNA or otx2 mRNA. Animal caps were cut at stage 9 and cultured to mid-neurula stages when they were collected and analyzed by RT-PCR for expression of the cement gland markers, Xag1 and Xcg, and for gfp expression. As expected, injection of globin mRNA does not induce cement gland fate or gfp expression. (Fig. 6, lanes 2-7). Injection of otx2 mRNA induces both Xag1 and Xcg1 expression in caps (Fig. 6, lanes 8-13). otx2 mRNA injection also induces gfp expression in caps injected with the 5xCRE or 3EBS/2CRE construct (lanes 9 and 12), but not those injected with the TATA only (lane 7), 5xEBS (lane 8), mutated EBS (lane 10) or mutated CRE (lane 11) constructs. Similar results were obtained with caps isolated from embryos transgenic for EBS and CRE constructs, and injected with otx2 mRNA. These results suggest that two pathways regulate the expression of Xag1. One pathway involves Otx2, mediated by the CRE in the Xag1 promoter, the other pathway is independent of Otx2 and is mediated by the EBS.
|
| DISCUSSION |
|---|
|
|
|---|
Ets- and ATF/CREB-like binding sites cooperate to activate Xag1 expression
Ets-binding sites (EBS; GGAA/T) interact with members of a family of transcriptional regulators that share a conserved Ets domain (reviewed by Sharrocks, 2001
). cAMP-responsive elements (CRE; TGACG) interact with both CREBs and ATFs, which belong to a large family of transcriptional regulators containing a conserved bZip domain (reviewed by Hai and Hartman, 2001
). The proximal EBS and CRE in the Xag1 promoter are both necessary and sufficient for cement gland-specific expression of Xag1, as mutation of either site in the context of the short, 102 bp promoter causes a severe decrease in expression, while multimerized sites are able to drive expression (Figs 3, 4). The longer 275 bp promoter contains three EBS, and while deletion of the proximal EBS in this construct has no effect on promoter activity, mutation of all three sites severely depresses promoter activity, further indicating the importance of this class of binding site. In the context of a heterologous promoter, the EBS and CRE co-operate, and are also likely to do so in the intact promoter. Physical and functional interaction of Ets and ATF/CREB factors has been demonstrated in several other systems (Giese et al., 1995
; Papoutsopoulou and Janknecht, 2000
).
Several Ets factors have been identified in Xenopus (Baltzinger et al., 1999
; Chen et al., 1999
; Münchberg and Steinbeisser, 1999
; Meyer et al., 1997
; Meyer et al., 1995
; Gorgoni et al., 1995
); however, none is expressed in the cement gland primordium or modulates cement gland formation (Goltzené et al., 2000
; Remy et al., 1996
). A CRE-binding activity has been identified in Xenopus embryos (Lutz et al., 1999
), and a dominant-negative CREB construct causes microcephaly, although cement glands are able to form in these embryos. Xenopus Jun, another bZip protein that can interact with the CRE, promotes ventral development when misexpressed (Knochel et al., 2000
); however, it is not clear whether Jun plays any role in cement gland formation.
Multiple sites in the Xag1 promoter are likely to cooperate
Although the EBS and CRE together provide sufficient information to drive cement gland-specific reporter gene expression, other sites in the Xag1 promoter are likely to co-operate to drive robust expression. In particular, the longer, 275 bp, promoter appeared to give stronger reporter expression than the shorter, 102 bp, region. However, the distal region (275 to 102 bp), placed in front of the Xag1 TATA box, cannot substitute for the region downstream of 102 bp (Fig. 3). In addition to the EBS and CRE, three other regions in the short promoter are important for reporter gene expression, including the TATA box and two regions that do not appear to contain binding sites for known transcription factor families. Two transcription factors that may act downstream of Otx2 to regulate Xag1 expression include pitx1 and pitx2c, paired-class homeodomain proteins that are expressed in both the cement gland and stomodeal primordia. Ectopic expression of these genes can activate cement gland formation (Hollemann and Pieler, 1999
; Chang et al., 2001
; Schweikert et al., 2001
). Interestingly, we find no evidence for pitx-binding sites in the Xag1 promoter, indicating that regulation of Xag1 by these factors is indirect. The importance of these other sites in the context of the whole promoter is underscored by the inability of multimerized EBS or CRE alone constructs to drive reporter gene expression from a heterologous promoter (Fig. 4). Together, the data suggests that multiple co-operating factors regulate Xag1 promoter function.
Restricting Xag1 expression to the cement gland
Xag1 expression could be restricted to the cement gland through positively acting factors alone, with expression or activity of these factors limited to the cement gland primordium. In support of this, we have found no evidence for a distinct repressor region in the Xag1 promoter, which when removed leads to ectopic reporter gene expression. However, putative Ets and ATF/CREB factors, which interact with the EBS or CRE and act positively in the cement gland, could be inactivated or converted into repressors outside this region by post-translational modification (Mayr and Montminy, 2001
; Sharrocks, 2001
). Additionally, different Ets and ATF/CREB proteins can act as activators and repressors, by binding to the same DNA element with opposing outcomes (Rebay and Rubin, 1995
; ONeill et al., 1994
). It is therefore possible that these classes of factor both activate Xag1 expression in the cement gland and repress its expression elsewhere.
Integration of Otx2-dependent CRE activity and Otx2-independent EBS activity
Current data suggests that formation of the cement gland requires integration of anterodorsal (AD), ventrolateral (VL) and outer layer ectodermal (EO) domains. Which domains might regulate putative Ets and ATF/CREB factors that interact with the Xag1 promoter? Our data show that the CRE present in the Xag1 promoter is activated by Otx2, indicating that it lies downstream of Otx2 and is a readout of the AD domain (Fig. 7).
By contrast, the inability of Otx2 to activate the EBS suggests that a factor binding to this site acts in an Otx2-independent pathway. Although the EBS is crucial for cement gland-specific gene expression, it is only sufficient to direct this expression in combination with either the Xag1 TATA box region or the CRE. This suggests that a factor binding to the EBS interacts with an Otx2-dependent factor(s) that binds either to the CRE or to the Xag1 TATA box region. We suggest this because the ADMLP cannot substitute for the Xag1 TATA region, suggesting that this region responds to anterior positional information. In both cases, this factor would be a readout of the AD domain but not sufficient to drive cement gland-specific gene expression. Alternatively, it is possible that an anterior-specific factor distinct from Otx2 activates the EBS-binding factor, which would, in fact, represent a readout of the AD domain (Fig. 7).
Although cement gland positioning requires interaction of three domains, two factor-binding sites (the EBS and CRE together or singly in combination with the Xag1 TATA box region) are sufficient for cement gland-specific reporter expression. This suggests that one or both of these sites must integrate the readout of more than one domain. This integration could represent an intermediate step in cement gland positioning, e.g. an extreme anteriodorsal domain, which is not germ layer specific, defined by AD+VL. This predicts that reporter gene activation is observed in the relevant domain from an appropriate construct. The lack of any reporter gene readout in such intermediate domains may reflect the absence of stable promoter binding by either factor alone.
In order to characterize the domains in which Xag1 regulatory factors act, and to further understand how positional information is integrated to direct cement gland-specific gene expression, we are currently identifying candidate factors that interact with the EBS and CRE in the Xag1 promoter. We are additionally asking whether these classes of factor are used by other cement gland differentiation genes.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Acampora, D., Mazan, S., Lallemand, Y., Avantaggiato, V., Maury, M., Simeone, A. and Brulet, P. (1995). Forebrain and midbrain regions are deleted in Otx2/ mutants due to a defective anterior neuroectoderm specification during gastrulation. Development 121, 3279-3290.[Abstract]
Ang, S. L., Jin, O., Rhinn, M., Daigle, N., Stevenson, L. and Rossant, J. (1996). A targeted mouse Otx2 mutation leads to severe defects in gastrulation and formation of axial mesoderm and to deletion of rostral brain. Development 122, 243-252.[Abstract]
Baltzinger, M., Mager-Heckel, A. M. and Remy, P. (1999). Xlerg: expression pattern and overexpression during development plead for a role in endothelial cell differentiation. Dev. Dyn. 216, 420-433.[Medline]
Blitz, I. L. and Cho, K. W. Y. (1995). Anterior neurectoderm is progressively induced during gastrulation: the role of the Xenopus homeobox gene orthodenticle. Development 121, 993-1004.[Abstract]
Bradley, L., Wainstock, D. and Sive, H. (1996). Positive and negative signals modulate formation of the Xenopus cement gland. Development 122, 2739-2750.[Abstract]
Chalmers, A. D., Welchman, D. and Papalopulu, N. (2002). Intrinsic differences between the superficial and deep layers of the Xenopus ectoderm control primary neuronal differentiation. Dev. Cell 2, 171-182.[Medline]
Chang, W., KhosrowShahian, F., Chang, R. and Crawford, M. (2001). XPitx1 plays a role in specifying cement gland and head during early Xenopus development. Genesis 29, 78-90.[Medline]
Chen, Y., Hollemann, T., Grunz, H. and Pieler, T. (1999). Characterization of the Ets-type protein ER81 in Xenopus embryos. Mech. Dev. 80, 67-76.[Medline]
Davis, R. L., Turner, D. L., Evans, L. M. and Kirschner, M. W. (2001). Molecular targets of vertebrate segmentation: two mechanisms control segmental expression of Xenopus hairy2 during somite formation. Dev. Cell 1, 553-565.[Medline]
Fink, J. S., Verhave, M., Kasper, S., Tsukada, T., Mandel, G. and Goodman, R. H. (1988). The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer. Proc. Natl. Acad. Sci. USA 85, 6662-6666.
Gammill, L. S. and Sive, H. (1997). Identification of otx2 target genes and restrictions in ectodermal competence during Xenopus cement gland formation. Development 124, 471-481.[Abstract]
Gammill, L. S. and Sive, H. (2000). Coincidence of otx2 and BMP4 signaling correlates with Xenopus cement gland formation. Mech. Dev. 92, 217-226.[Medline]
Gammill, L. S. and Sive, H. (2001). Otx2 expression in the ectoderm activates anterior neural determination and is required for Xenopus cement gland formation. Dev. Biol. 240, 223-236.[Medline]
Giese, K., Kingsley, C., Kirshner, J. R. and Grosschedl, R. (1995). Assembly and function of a TCR
enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions. Genes Dev. 9, 995-1008.
Goltzené, F., Skalski, M., Wolff, C. M., Meyer, D., Mager-Heckel, A. M., Darribere, T. and Remy, P. (2000). Heterotopic expression of the Xl-Fli transcription factor during Xenopus embryogenesis: modification of cell adhesion and engagement in the apoptotic pathway. Exp. Cell Res. 260, 233-247.[Medline]
Gorgoni, B., Fiorentino, L., Marchioni, M. and Carnevali, F. (1995). Cloning, expression and functional role of XrpFI alpha and beta subunits in Xenopus laevis oocyte. Biochem. Biophys. Res. Commun. 215, 1088-1095.[Medline]
Hai, T. and Hartman, M. G. (2001). The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis. Gene 273, 1-11.[Medline]
Hinkley, C. and Perry, M. (1991). A variant octamer motif in a Xenopus H2B histone gene promoter is not required for transcription in frog oocytes. Mol. Cell. Biol. 11, 641-654.
Hollemann, T. and Pieler, T. (1999). Xpitx-1: a homeobox gene expressed during pituitary and cement gland formation of Xenopus embryos. Mech. Dev. 88, 249-252.[Medline]
Isaacs, H. V., Andreazzoli, M. and Slack, J. M. W. (1999). Anteroposterior patterning by mutual repression of orthodenticle and caudal-type transcription factors. Evol. Dev. 1, 143-152.[Medline]
Kolm, P. J. and Sive, H. (1995). Regulation of the Xenopus labial homeodomain genes HoxA1 and HoxD1: activation by retinoids and peptide growth factors. Dev. Biol. 167, 34-49.[Medline]
Knochel, S., Schuler-Metz, A. and Knochel, W. (2000). c-Jun (AP-1) activates BMP-4 transcription in Xenopus embryos. Mech. Dev. 98, 29-36.[Medline]
Kroll, K. L. and Amaya, E. (1996). Transgenic Xenopus embryos from sperm nuclear transplantations reveal FGF signaling requirements during gastrulation. Development 122, 3173-3183.[Abstract]
Li, R., Pei, H. and Watson, D. K. (2000). Regulation of Ets function by protein-protein interactions. Oncogene 19, 6514-6523.[Medline]
Lutz, B., Schmid, W., Niehrs, C. and Schutz, G. (1999). Essential role of CREB family proteins during Xenopus embryogenesis. Mech. Dev. 88, 55-66.[Medline]
Matsuo, I., Kuratani, S., Kimura, C., Takeda, N. and Aizawa, S. (1995). Mouse Otx2 functions in the formation and patterning of rostral head. Genes Dev. 9, 2646-2658.
Mayr, B. and Montminy, M. (2001). Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat. Rev. Mol. Cell Biol. 2, 599-609.[Medline]
Meyer, D., Durliat, M., Senn, F., Wolff, M., Andre, M., Hourdry, J. and Remy, P. (1997). Ets-1 and Ets-2 proto-oncogenes exhibit differential and restricted patterns during Xenopus laevis oogenesis and embryogenesis. Int. J. Dev. Biol. 41, 607-620.[Medline]
Meyer, D., Stiegler, P., Hindelang, C., Mager, A. M. and Remy, P. (1995). Whole mount in situ hybridization reveals the expression of the Xl-Fli gene in several lineages of migrating cells in Xenopus embryos. Int. J. Dev. Biol. 39, 909-919.[Medline]
Münchberg, S. R. and Steinbeisser, H. (1999). The Xenopus Ets transcription factor XER81 is a target of the FGF signaling pathway. Mech. Dev. 80, 53-65.[Medline]
Offield, M. F., Hirsch, N. and Grainger, R. M. (2000). The development of Xenopus tropicalis transgenic lines and their use in studying lens developmental timing in living embryos. Development 127, 1789-1797.[Abstract]
ONeill, E. M., Rebay, I., Tijan, R. and Rubin, G. M. (1994). The activities of two Ets-related transcription factors required for Drosophila eye development are modulated by the Ras/MAPK pathway. Cell 78, 137-147.[Medline]
Paca-Uccaralertkun, S., Zhao, L-J., Adya, N., Cross, J. V., Cullen, B. R., Boros, I. M. and Giam, C.-Z. (1994). In vitro selection of DNA elements highly responsive to the human T-Cell lymphotropic virus type I transcriptional activator, Tax. Mol. Cell. Biol. 14, 456-462.
Pannese, M., Polo, C., Andreazzoli, M., Vignali, R., Kablar, B., Barsacchi, G. and Boncinelli, E. (1995). The Xenopus homologue of Otx2 is a maternal homeobox gene that demarcates and specifies anterior body regions. Development 121, 707-720.[Abstract]
Papoutsopoulou, S. and Janknecht, R. (2000). Phosphorylation of ETS transcription factor ER81 in a complex with its coactivators CREB-binding protein and p300. Mol. Cell. Biol. 20, 7300-7310.
Polli, M. and Amaya, E. (2002). A study of mesoderm patterning through the analysis of the regulation of Xmyf-5 expression. Development 129, 2917-2827.
Quandt, K., Frech, K., Karas, H., Wingender, E. and Werner, T. (1995). MatInd and MatInspector new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acic Res. 23, 4878-4884.
Rebay, I. and Rubin, G. M. (1995). Yan functions as a general inhibitor of differentiation and is negatively regulated by activation of the Ras1/MAPK pathway. Cell 81, 857-866.[Medline]
Remy, P., Senan, F., Meyer, D., Mager, A. M. and Hindelang, C. (1996). Overexpression of the Xenopus Xl-fli gene during early embryogenesis leads to anomalies in head and heart development and erythroid differentiation. Int. J. Dev. Biol. 40, 577-589.[Medline]
Schweikert, A., Steinbeisser, H. and Blum, M. (2001). Differential expression of Xenopus Pitx1, Pitx2b and Pitx2c during cement gland, stomodeum and pituitary development. Mech. Dev. 107, 191-194.[Medline]
Sharrocks, A. D. (2001). The ets-domain transcription factor family. Nat. Rev. Mol. Cell. Biol. 2, 827-837.[Medline]
Sive, H. L., Grainger, R. M. and Harland, R. M. (2000). Early Development of Xenopus laevis: Course Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Sive, H. L., Hattori, K. and Weintraub, H. (1989). Progressive determination during formation of the anteroposterior axis in Xenopus laevis. Cell 58, 171-180.[Medline]
Sive, H. and Bradley, L. (1996). A sticky problem: the Xenopus cement gland as a paradigm for anteroposterior patterning. Dev. Dyn. 205, 265-280.[Medline]
Sparrow, D. B., Latinkic, B. and Mohun, T. J. (2000). A simplified method of generating transgenic Xenopus. Nucleic Acids Res. 28, e12.
Sun, B. I., Bush, S. M., Collins-Racie, L. A., LaVallie, E. R., DiBlasio-Smith, E. A., Wolfman, N. M., McCoy, J. M. and Sive, H. L. (1999). derrière: a TGF-ß family member required for posterior development in Xenopus. Development 126, 1467-1482.[Abstract]
Turner, A., Snape, A. M., Wylie, C. C. and Heasman, J. (1989). Regional identity is established before gastrulation in the Xenopus embryo. J. Exp. Zool. 251, 245-252.[Medline]
Wardle, F. C. and Sive, H. L. (2002). Whats your position? The Xenopus cement gland as an anterior paradigm. BioEssays (in press).
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||