spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frank, D. U.
Right arrow Articles by Moon, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frank, D. U.
Right arrow Articles by Moon, A. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 129, 4591-4603 (2002)
© 2002 The Company of Biologists Limited


DEVELOPMENT AND DISEASE

An Fgf8 mouse mutant phenocopies human 22q11 deletion syndrome

Deborah U. Frank1, Lori K. Fotheringham1, Judson A. Brewer2, Louis J. Muglia2, Martin Tristani-Firouzi1, Mario R. Capecchi3 and Anne M. Moon1,4,*

1 Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, UT 84112, USA
2 Departments of Pediatrics, Molecular Biology and Pharmacology, Washington University School of Medicine, St Louis, MO, USA
3 Howard Hughes Medical Institute and Department of Human Genetics, University of Utah School of Medicine, Salt Lake City, UT 84112, USA
4 Program in Human Molecular Biology and Genetics, University of Utah School of Medicine, Salt Lake City, UT 84112, USA

*Author for correspondence (e-mail: anne.moon{at}genetics.utah.edu)

Accepted 1 July 2002


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Deletion of chromosome 22q11, the most common microdeletion detected in humans, is associated with a life-threatening array of birth defects. Although 90% of affected individuals share the same three megabase deletion, their phenotype is highly variable and includes craniofacial and cardiovascular anomalies, hypoplasia or aplasia of the thymus with associated deficiency of T cells, hypocalcemia with hypoplasia or aplasia of the parathyroids, and a variety of central nervous system abnormalities. Because ablation of neural crest in chicks produces many features of the deletion 22q11 syndrome, it has been proposed that haploinsufficiency in this region impacts neural crest function during cardiac and pharyngeal arch development. Few factors required for migration, survival, proliferation and subsequent differentiation of pharyngeal arch neural crest and mesoderm-derived mesenchyme into their respective cardiovascular, musculoskeletal, and glandular derivatives have been identified. However, the importance of epithelial-mesenchymal interactions and pharyngeal endoderm function is becoming increasingly clear.

Fibroblast growth factor 8 is a signaling molecule expressed in the ectoderm and endoderm of the developing pharyngeal arches and known to play an important role in survival and patterning of first arch tissues. We demonstrate a dosage-sensitive requirement for FGF8 during development of pharyngeal arch, pharyngeal pouch and neural crest-derived tissues. We show that FGF8 deficient embryos have lethal malformations of the cardiac outflow tract, great vessels and heart due, at least in part, to failure to form the fourth pharyngeal arch arteries, altered expression of Fgf10 in the pharyngeal mesenchyme, and abnormal apoptosis in pharyngeal and cardiac neural crest.

The Fgf8 mutants described herein display the complete array of cardiovascular, glandular and craniofacial phenotypes seen in human deletion 22q11 syndromes. This represents the first single gene disruption outside the typically deleted region of human chromosome 22 to fully recapitulate the deletion 22q11 phenotype. FGF8 may operate directly in molecular pathways affected by deletions in 22q11 or function in parallel pathways required for normal development of pharyngeal arch and neural crest-derived tissues. In either case, Fgf8 may function as a modifier of the 22q11 deletion and contribute to the phenotypic variability of this syndrome.

Key words: 22q11 deletion syndromes, Pharyngeal arches, FGF8, Pharyngeal arch artery, Congenital heart disease, Truncus arteriosus, Interrupted aortic arch, Outflow tract, Endoderm, Immunodeficiency


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Pharyngeal arches are transient bulges of tissue in the neck of vertebrate embryos consisting of mesenchyme separated by membranous clefts in which the surface ectoderm directly apposes evaginations of the pharyngeal endoderm (the pharyngeal pouches). Pharyngeal arch mesenchyme is derived from neural crest cells and paraxial mesoderm. Neural crest-derived mesenchyme gives rise to the skeletal structures and to pericytes and smooth muscle cells of the arch arteries (Birgbauer et al., 1995Go; Etchevers et al., 1999Go). Some neural crest mesenchyme populates the arches only transiently, en route to final destinations in the outflow tract and heart (Epstein et al., 2000Go; Jiang et al., 2000Go). The mesoderm-derived mesenchyme contributes muscular and endothelial precursors to each arch. A vessel forms within each arch and circulates blood from the heart to the bilateral dorsal aortae. This pharyngeal arch arterial system is a transient, initially symmetrical array of vessels; the most rostral vessels in the first and second arches largely regress while the caudal pharyngeal arch arteries (PAAs) are extensively remodeled into adult vascular structures, including the subclavian arteries and the arch of the aorta. Aberrant formation and/or remodeling of the pharyngeal arch arterial system results in congenital vascular malformations ranging in severity from clinically insignificant to lethal.

A growing body of evidence indicates that signals from pharyngeal endoderm pattern the arch neural crest and mesoderm (Couly et al., 2002Go; LeDouarin, 1982Go; Piotrowski and Nusslein-Volhard, 2000Go; Thomas et al., 1998Go; Veitch et al., 1999Go; Wendling et al., 2000Go). This tissue expresses signaling molecules such as bone morphogenetic proteins, fibroblast growth factors (FGFs), Sonic hedgehog, and transcription factors including Hox A3, Pax1, Pax9 and Tbx1 (Dietrich and Gruss, 1995Go; Garg et al., 2001Go; Manley and Capecchi, 1998Go; Peters et al., 1998Go). Pharyngeal pouch endoderm gives rise to the thyroid, parathyroid and thymus glands. Interactions between neural crest and endoderm are important for early thymic and parathyroid development (Bockman and Kirby, 1984Go; Le Douarin and Jotereau, 1975Go; LeLievre and LeDouarin, 1975Go) and later proliferation of the thymic epithelium has been shown to be dependent on FGF signaling (Revest et al., 2001Go).

Haploinsufficiency of chromosome 22q11(del22q11) is the genetic abnormality shared by the majority of individuals diagnosed with DiGeorge sequence (DiGeorge, 1965Go), Velocardiofacial syndrome (Shprintzen et al., 1978Go) and Conotruncal anomaly face syndrome (Burn et al., 1993Go) (for reviews, see Emanuel et al., 2001Go; Lindsay, 2001Go; Scambler, 2000Go). The craniofacial, cardiovascular and glandular phenotypes that characterize these individuals indicate that all pharyngeal arch-derived structures may be affected. Affected individuals often present in the neonatal period with life-threatening cardiac malformations. Conotruncal defects such as persistent truncus arteriosus and Tetralogy of Fallot are common, as are aortic arch defects including interrupted aortic arch, right aortic arch and vascular ring (Emanuel et al., 2001Go).

Molecular defects resulting from deletion of genes in del22q11 are hypothesized to adversely affect neural crest function during cardiac and pharyngeal arch development (Emanuel et al., 2001Go; Robinson, 1975Go; Van Mierop and Kutsche, 1986Go). Mechanical ablation of premigratory ‘cardiac’ neural crest from the posterior hindbrain of chick embryos produces many features of del22q11, including interrupted aortic arch type B and truncus arteriosus (Bockman et al., 1989Go; Kirby and Waldo, 1990Go). The results of Wnt1 and Pax3 neural crest lineage analyses provide evidence for the existence of a cardiac neural crest population in mammals as well (Epstein et al., 2000Go; Jiang et al., 2000Go). Furthermore, mice homozygous for mutations in the neural crest-expressed Pax3 gene [the splotch (Sp2h) mouse] show decreased numbers of migrating cardiac neural crest cells (Conway et al., 1997aGo; Epstein et al., 2000Go) and a severe phenotype that includes cardiovascular features of del22q11 (Conway et al., 1997bGo; Franz, 1989Go; Goulding et al., 1993Go).

An enormous effort has been directed towards understanding how haploinsufficiency for the three megabase typically deleted region (TDR, the deletion found in 90% of affected individuals) of chromosome 22 results in the clinically heterogeneous del22q11syndromes. Investigators have attempted to model these syndromes in mice by deleting the region of murine chromosome 16 corresponding to the TDR (Kimber et al., 1999Go; Lindsay et al., 1999Go; Puech et al., 2000Go). Others inactivated murine orthologs of genes within the TDR (Guris et al., 2001Go; Jerome and Papaioannou, 2001Go; Lindsay et al., 2001Go; Merscher et al., 2001Go; Saint-Jore et al., 1998Go). In all cases, heterozygotes were either phenotypically normal or had partial phenotypes with cardiovascular defects that were infrequent and mild, relative to those seen in humans. Twenty five percent of heterozygous mice bearing an engineered deletion on chromosome 16 called Df1 had vascular malformations, predominantly affecting the right subclavian artery (Lindsay et al., 1999Go). Crko1 heterozygotes (homologous to the CRKL locus in the human TDR) were normal, but homozygotes had vascular, thymic, parathyroid and craniofacial malformations (Guris et al., 2001Go). Tbx1, another gene within the TDR, encodes a transcription factor in the T-box family expressed in the endoderm and mesoderm of the pharyngeal arches (Garg et al., 2001Go). Tbx1-null homozygotes display the most severe features of del22q11; 100% of Tbx1-null homozygotes had truncus arteriosus and lacked thymus and parathyroid glands (Jerome and Papaioannou, 2001Go).

Data from murine models and from humans suggest that multiple loci on chromosome 22 or elsewhere may function in the pathogenesis or act as modifiers of the del22q11 phenotype (Yamagishi et al., 1999Go; Emanuel et al., 2001Go; Lindsay, 2001Go; Scambler, 2000Go). Sequence and microdeletion analysis of nondeleted syndromic individuals has not revealed causal mutations in Tbx1 or other genes on 22q11 (Chieffo et al., 1997Go; Wadey et al., 1999Go; Emanuel et al., 2001Go). Humans bearing identical deletions have highly variable phenotypes, both with regard to affected structures and presence and severity of cardiovascular disease. Indistinguishable phenotypes have been observed in association with deletions and translocations on chromosome 10p (Gottlieb et al., 1998Go; Herve et al., 1984Go) and as the result of teratogenic exposure. Dysfunction of genes that operate in common developmental or genetic pathways may independently generate or modify the ‘del22q11 phenotype’.

FGF8 is a secreted signaling molecule expressed in the developing brain, face and limbs, and in the endoderm and ectoderm of the pharyngeal pouches and grooves (Crossley and Martin, 1995Go; MacArthur et al., 1995Go). During embryogenesis, epithelially produced FGF8 provides survival, mitogenic, antidifferentiation and patterning signals to adjacent mesenchyme (Moon and Capecchi, 2000Go; Lewandoski et al., 2000Go; Trumpp et al., 1999Go). Ectodermal FGF8 signaling has been demonstrated to regulate mesenchymal gene expression in the first pharyngeal arch (Tucker et al., 1999aGo; Tucker et al., 1999bGo); conditional ablation of FGF8 in first arch ectoderm results in craniofacial defects caused by death of first arch neural crest mesenchyme and perturbed expression of patterning genes (Trumpp et al., 1999Go). Severe hypomorphism for FGF8 results in gastrulation and left-right asymmetry defects (Meyers et al., 1998Go; Meyers and Martin, 1999Go). We employ a hypomorphic allele of Fgf8 to demonstrate that FGF8 performs unique and required roles in development of murine pharyngeal arch and pouch-derived structures including the pharyngeal arch arteries (PAAs), cardiac outflow tract, heart, thymus and parathyroids. The constellation of anomalies displayed by these Fgf8 hypomorphic mutants is a remarkably complete phenocopy of human del22q11 syndrome. These animals provide an excellent model system in which to examine molecular and cellular pathways that result in this common and frequently lethal human syndrome.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mutant mouse strains
Creation of the hypomorphic and null alleles of Fgf8 has previously been described (Moon and Capecchi, 2000Go). The official names for the Fgf8 null allele (Fgf8) is Fgf8tm1Mrc and the for the Fgf8 hypomorphic allele (Fgf8H) is Fgf8tm2Mrc. The alleles were created in an SV129 background and were backcrossed 6 or more generations intoC57Bl6. The Wnt1Cre mice (Jiang et al., 2000Go) were kindly provided by A. McMahon.

Reverse-transcription, PCR amplification
Total RNA was isolated from E10.0 embryos with Trizol reagent (Gibco BRL) according to manufacturer’s instructions. One microgram of total RNA was reverse-transcribed with a first-strand cDNA synthesis kit (Omniscript, Qiagen) and 2 µl of the product was amplified with primers 5'-AAGCTCATTGTGGAGACCGAT-3' and 5'-AGCTCCCGCTGGATTCCTC-3' for X=28 and X+1=29 cycles to detect Fgf8 cDNA, or with primers 5'CCAGTATGACTCCACTCACGGCA 3' and 5'ATACTTGGCAGGTTTCGCCAGGCG 3' for X=13 and X+1=14 cycles to detect the GAPDH control cDNA. To assure that the results were quantitative, the cycle number for each primer set was optimized for amplification within the linear range.

Corrosion casting of vasculature
Pregnant females were anesthetized with a lethal dose of Avertin by intraperitoneal injection and the embryos removed. Thoracotomy was performed and the pericardium opened. Blue Mercox resin and catalyst (Ladd Research Industries #21246 and Benzoyl Peroxide CAS [94-36-0]) were injected into the left ventricle using a pulled glass needle. After allowing the resin to cure for 24 hours, the preparations were placed in Batson’s #17 Maceration solution (Polysciences, Warrington, PA; catalog number, 07359) for 48-72 hours until tissues were completely dissolved. The casts were rinsed repeatedly in distilled water and stored in water.

Histology, immunohistochemistry and TUNEL analysis of sections
Embryos were fixed in 4% paraformaldehyde (E9-E11.5) or Bouins fixative (E18.5). Paraffin embedded E9.5 to E11.5 embryos were sectioned at 5 µm and stained with a monoclonal antibody against Pecam-1 (1:50, Pharmingen), to label endothelial cells within the vasculature. A biotinylinated goat anti-rat secondary antibody (1:75, Pharmingen) was used and sections were developed in 3, 3'-diaminobenzidine with nickel chloride chromagen (Vector Laboratories) and counterstained with Eosin. E18.5 embryos were sectioned at 10 µm and stained with Hematoxylin and Eosin.

For cryosections, embryos were fixed in 4% paraformaldehyde and then protected in a sequential series of 10, 20 and 30% sucrose/PBS solutions, oriented in OCT (Tissue Tek) filled molds and rapidly frozen, then sectioned at 10 µm transversely with respect to neural tube and in parallel with the third pharyngeal arch. Sections were washed with PBS, blocked in 2% bovine serum albumin with 0.5% Triton-X100 and incubated overnight with primary antibodies: mouse monoclonal anti-AP2{alpha} (1:25, 3B5, Developmental Studies Hybridoma Bank), rabbit polyclonal anti-class III ß-tubulin (1:500,Covance, {alpha}-Tuj1) or rabbit polyclonal antiphosphohistone H3 (1:100, Upstate Biotechnology, {alpha}-PHH3). Sections were washed, blocked and incubated with FITC conjugated anti-mouse IgG antibody (1:500, Molecular Probes), Cy-5 conjugated anti-rabbit IgG antibody (1:500, Jackson Laboratories), and TMR Red in situ cell death detection reagents (Roche). Sections were preserved in Vectashield anti-fading reagent (Vector Laboratories) and observed with confocal analysis at 20x magnification.

Whole-mount in situ hybridization
In situ hybridization on intact embryos was carried out as previously described (Moon et al., 2000Go). The plasmids used to generate riboprobes were generously provided by N. Miura (mfh-1), B. Morrow (tbx-1), D. Srivastava (hrt-1) and D. Ornitz (Fgf10).

Flow cytometry
Thymocytes from embryos at 18.5 days of gestation were dispersed through nylon mesh into PBS, washed, counted on a hemocytometer using Trypan Blue to exclude non-viable cells, stained for cell surface markers (PE-anti-CD25, PerCP-anti-CD8, APC-anti-CD4, FITC-anti-CD44 from PharMingen), washed, resuspended in PBS and analyzed by flow cytometry on a FACSCaliber® (Becton Dickinson).

Alkaline phosphatase staining
Alkaline phosphatase staining of wholemounts was performed as previously described (Moon et al., 2000Go).

Whole-mount TUNEL analysis
Somite matched E9.5 embryos were fixed and subjected to Terminal UTP nick end labeling (TUNEL) as described elsewhere (Stadler et al., 2001Go). Confocal analysis was performed as above. Photomicrographs were taken at 8x magnification.

Fluorescent imaging
FITC, CY5, and Texas red fluorescence were recorded using a BioRad MRC 1024 laser-scanning confocal imaging system fitted to a Leitz Aristoplan microscope using filters supplied by the manufacturer. A digital Kalman averaging filter was used to reduce background fluorescence.


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Compound heterozygous mice bearing hypomorphic and null alleles of Fgf8 produce less Fgf8 mRNA than controls and display lethal malformations
In order to bypass embryonic lethality resulting from complete ablation of Fgf8 function in embryonic mice, we investigated the role of Fgf8 in cardiovascular and pharyngeal arch development with a hypomorphic allele. The Fgf8H allele contains a neomycin phosphotransferase (neor) and alkaline phosphatase reporter genes in the 3' untranslated region of an otherwise intact Fgf8 locus (Fig. 1A). This has significant transcriptional consequences. Quantitative RT-PCR amplification (Fig. 1B), reveals that compound heterozygotes bearing hypomorphic (Fgf8H) and null (Fgf8) alleles of Fgf8 (Fgf8H/–, henceforth called mutants), reproducibly generate less Fgf8 mRNA, when compared with control littermates. The decreased function of the hypomorphic relative to the wild-type allele clear if one compares the compound heterozygotes (in which the only source of Fgf8 mRNA is the Fgf8H allele) and null heterozygotes (in which only the Fgf8+ allele produces Fgf8 mRNA). We have previously shown that removal of the neor gene from the Fgf8H allele restores its function (Moon and Capecchi, 2000Go).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 1. The presence of the neor gene in the 3'untranslated region (UTR) of the Fgf8 gene has transcriptional and morphological consequences. (A) The Fgf8H hypomorphic and Fgf8 alleles. The neomycin phosphotransferase gene (neor, blue arrow) and alkaline phosphatase reporter gene (AP, yellow block arrowhead) are located in the 3'UTR of Fgf8. PCR primers used to amplify exon 5 containing reverse transcription (RT) products are shown as black arrowheads (P1 and P2). LoxP sites are shown as red arrowheads. The null allele lacks Fgf8 exon 5 as previously described (Moon and Capecchi, 2000Go). If recombined by Cre recombinase, the Fgf8H allele produces the AP reporter regulated by the Fgf8 promoter. (B) Semi-quantitative RT/PCR of cDNAs prepared by reverse transcription of mRNA isolated from E9.5 embryos. The amount of exon 5 containing Fgf8 mRNA is decreased in Fgf8 mutants (Fgf8H/–, white arrowheads) when compared with wild type (Fgf8+/+), null heterozygote (Fgf8+/–) or hypomorph allele heterozygote (Fgf8H/+) littermate controls. The results displayed show the amplification products obtained with amplification cycles of X or X+1 to assure that the amplification was performed within the linear range for each product and that the signal obtained was not saturated. The control panel shows RT-PCR products using GAPDH primers and confirms that specimens from the Fgf8H/– mutant embryos contain comparable amounts of total mRNA with controls, although the amount of Fgf8 mRNA in Fgf8H/– compound heterozygous, hypomorphic mutants is markedly decreased. (C) Newborn Fgf8H/– mutant and Fgf8H/+ control. The mutant is smaller, cyanotic and edematous with obvious craniofacial abnormalities (arrowheads). All of the mutants had CNS and mandibular malformations, 30% had a cleft palate. (D-G) Skeleton preps of Fgf8H/– mutant and control. (E) The mutant exhibits micrognathia, fusion of the maxilla (mx), jugal bone (jg) and mandible (mb), and absence of the tympanic ring (t, yellow arrowhead). (G) Cleft palate (arrowhead) in a mutant resulting from failure of fusion of the palatine shelves (pl) with the maxillary shelves (ms).

 
Decreased production of Fgf8 mRNA has important phenotypic consequences. Fgf8H/– mutants are small and die as neonates with cyanosis, respiratory distress, edema and multiple congenital anomalies (Fig. 1C). Craniofacial abnormalities are present in all of these animals: 100% have micrognathia and 30% have bony cleft palate (Fig. 1D); other facial malformations such as fusion of the temporomandibular joint and absence of the tympanic ring are more variable within and between mutants. Central nervous system malformations are seen in all mutants including hypoplasia or aplasia of the cerebellum and olfactory bulbs (data not shown). These phenotypes reflect dose sensitivity for FGF8 because Fgf8+/– null allele heterozygotes (which produce approximately 50% the wild type amount of Fgf8 mRNA) and Fgf8+/H hypomorph allele heterozygotes (which produce a quantity intermediate to that of wild type and null heterozygotes) are normal.

Fgf8H/– mice die from congenital cardiovascular defects
Multiple, severe developmental defects contribute to the neonatal demise of some mutants; however, most die a cardiovascular death, with progressive cyanosis and respiratory failure. We discovered cardiovascular defects in 95% of 60 term mutants, most of which were lethal malformations (Fig. 2, summarized in Table 1).



View larger version (130K):
[in this window]
[in a new window]
 
Fig. 2. E18.5 Fgf8H/– mutants exhibit lethal cardiovascular malformations. (A,E) Frontal and left oblique views of wild-type newborn heart and great vessels: the aorta (ao) arises from the left ventricle (lv) and is located to the right and posterior to the main pulmonary artery (mpa); the left aortic arch (aa) gives rise to the brachiocephalic (b), left common carotid (lcc) and left subclavian (lsc) and the aorta descends on the left (dao). The MPA arises from the right ventricle (rv). The ductus arteriosus (da) is closing (E, arrowhead). (B-D) Persistent Truncus Arteriosus results from failure of outflow tract septation. (B) Frontal view; a single vessel, the truncus (t), originates from the right ventricle (RV). (C) Left lateral view reveals origin of the left branch pulmonary artery (pa) and LCC from the truncal vessel. A right aortic arch was noted (raa). Broken lines have been superimposed to help clarify the anatomy. (D) Viewed from inside the RV, the truncal vessel overrides a large membranous ventricular septal defect (VSD, arrowhead), which is the only path of egress from the LV. The right atrium (ra) has been removed. (F-H) Double outlet right ventricle results from failure of outflow tract rotation and alignment. (F) Frontal view, MPA is anterior and towards the left of the aorta (Ao). (G) Right lateral view after removal of the right atrium and RV-free wall; note origins of Ao and MPA from the RV, there is a subaortic VSD (arrowhead), a right aortic arch and right patent ductus arteriosus (pda). (H) Left lateral view after removal of the LV free wall shows a probe passing from left ventricle through VSD into Ao; an atrial septal defect is visible from the left atrium (la, arrowhead). (I-L) D-Transposition of the great arteries results from failure of outflow tract rotation and alignment. (I) Frontal view; parallel circulation due to aberrant origin of the Ao anteriorly and from the RV and the MPA posteriorly from the LV. (J) Right lateral view shows right aortic arch (arrowhead), right descending aorta (dao) and right atrium (ra). (K) Right oblique view with probe passing from RV into Ao. (L) Left lateral view with probe passing from LV into MPA; there was no VSD. (M-P) Corrosion casts of the embryonic arterial vasculature reveal aortic arch anomalies in Fgf8H/– mutants. (M) Dorsal view of a control embryo; note continuity between ascending and descending aorta via the left aortic arch (laa), which is derived from the embryonic left fourth aortic arch artery. (N) Right dorsal oblique view of a control embryo; the PDA is visible, as is the LAA. (O) Posterior view of a mutant with interrupted aortic arch, type B; note discontinuity between ascending and descending aortas (red arrowhead) with the carotids arising from the ascending aorta and the left subclavian and descending aorta arising from the patent ductus arteriosus. (P) Dorsal oblique view of a mutant with a right aortic arch. A left-sided PDA and right aortic arch (raa) are shown. Broken lines have been superimposed to clarify the anatomy. This is a vascular ring encompassing the trachea and esophagus, which can cause airway obstruction and swallowing difficulties.

 

View this table:
[in this window]
[in a new window]
 
Table 1.
 
Outflow tract septation, rotation and alignment defects were common in these mutants. Persistent truncus arteriosus was the most embryologically primitive lesion observed and results from complete failure of septation of the primitive truncal vessel to form the ascending aorta and main pulmonary artery. Instead, the branch pulmonary arteries, the great vessels of the head and neck, and the descending aorta all arise from a single vessel (Fig. 2B-D). Transposition of the great arteries is a defect in which the aorta arises abnormally from the right ventricle and the pulmonary artery from the left ventricle (inverted ventriculo-arterial alignment, Fig. 2I-L). After birth and upon the closure of the ductus arteriosus, two parallel circulations form such that the systemic circulation is deprived of oxygen and death rapidly ensues. Double outlet right ventricle (Fig. 2F-H) and Tetralogy of Fallot (overriding aorta, ventricular septal defect, pulmonary stenosis and hypertrophy of the right ventricle) are more complex rotation/alignment defects that were observed.

Vascular defects were observed in the majority of mutants (see Table 1) and included interrupted aortic arch type B, in which the arch of the aorta fails to form between the left common carotid artery and left subclavian artery (IAAB, Fig. 2O); right aortic arch (Fig. 2P); and anomalous origin of the subclavian arteries. These defects indicate that formation, stabilization or remodeling of the fourth PAAs is disrupted in the mutants. The right and left fourth PAAs form between E 9.5-E10.0. The right fourth PAA gives rise to the origin of the right subclavian artery. The left fourth PAA becomes the arch of the aorta between the left common carotid artery and left subclavian artery which is the portion of the aorta that is absent in IAAB.

To evaluate fourth PAA formation, we performed intravascular ink injections in E9.5 to E 11.5 mutants and controls. At E9.5, prior to the formation of the fourth PAA, mutant animals have patent PAAs 1-3, as do controls (Fig. 3A,B). The fourth PAA is not patent to ink injection in E10.0 to E11.5 mutants (Fig. 3C-F). All mutants display abnormal fourth PAA formation bilaterally at E10.5 (Table 2). The absence of these arteries can not be attributed to growth delay, as the sixth PAA is present by E10-10.5 (Fig. 3D,F,H,J). A mutant sectioned coronally through the pharyngeal arches and immunohistochemically stained with the endothelial marker PECAM demonstrates that endothelial cells can be detected in the left fourth arch region, although they are disorganized and no vessel lumen is evident (Fig. 3H, left side). On the right-hand side of this animal, the right fourth vessel appears patent in the section displayed, but serial sections revealed that it never connected with the dorsal aorta.



View larger version (60K):
[in this window]
[in a new window]
 
Fig. 3. Formation of the fourth pharyngeal arch arteries (PAAs) is abnormal in Fgf8H/– mutants. (A-F) Left lateral view after intracardiac ink injection to visualize the developing PAAs at E9.5 (A,B), 10.5 (C,D) and 11.5 (E,F) in Fgf8 mutants (B,D,F) and somite/stage matched controls (A,C,E). The PAAs are numbered and the aortic sac (as) and dorsal aorta (da) labeled. Note complete absence of the fourth PAAs in the mutants at E10.5 and E11.5, although the third and sixth PAAs are present. (G-J) Formation of the third pharyngeal pouch and fourth pharyngeal arch is disrupted in Fgf8H/– mutants. Immunohistochemistry for PECAM to stain the endothelium of the PAAs; plane of transverse sections through the arches is shown in inset of H. (G,I) control embryo, ventral (G) and dorsal (I); the ventral section is at the junction of the aortic sac with the origins of the second, third and fourth arch arteries. (H,J) Mutant embryo, ventral (H) and dorsal (J) transverse sections; the fourth pharyngeal arch tissue is hypoplastic, fused to the third arch and avascular on the left, although disorganized PECAM-positive endothelial cells are present (arrowheads); there is no third pouch on the left. The right fourth PAA is minimally endothelialized and never connects to the dorsal aorta (data not shown). The sixth arch arteries are larger than normal and have already fused with the dorsal aorta in section J. The rostral pharynx (rp) and caudal pharynx (cp) are labeled and the pharyngeal arches are numbered and labeled left (l) or right (r).

 

View this table:
[in this window]
[in a new window]
 
Table 2.
 
At E10.5, mutants frequently had hypoplastic fourth pharyngeal arch tissue fused to the third arch and no third pouch (Fig. 3H,J). In combination with the vascular defects reported above, this finding suggests that formation of the fourth arch itself and patterning of the third and fourth arches may be disrupted. To determine if decreased FGF8 in the mutants altered expression of transcription factors expressed during fourth arch development, we performed whole mount in situ hybridization in E9.5 and E10.5 embryos. Mfh1 (Foxc2 – Mouse Genome Informatics) encodes a winged helix transcription factor that has been shown to be expressed in the pharyngeal arch vessels and mesenchyme from E9.5; ablation of Mfh1 function results in interrupted aortic arch type B due to aberrant remodeling of the fourth PAA (Iida et al., 1997Go). Mfh1 expression appeared normal in Fgf8 mutants (Fig. 4A) Expression of Hrt1, which encodes a basic helix-loop-helix transcription factor expressed in the developing arch mesenchyme and endoderm and is a downstream mediator of Notch signaling (Nakagawa et al., 2000Go; Nakagawa et al., 1999Go), also appeared normal in Fgf8 mutants (Fig. 4B). Although Fgf8H/– and Tbx1 mutants have overlapping phenotypes and are both genes are expressed in the pouch endoderm, we did not detect any change in the pattern of Tbx1 expression at these stages (Fig. 4C).



View larger version (88K):
[in this window]
[in a new window]
 
Fig. 4. Mesenchymal expression of Fgf10 is decreased, while Mfh1, Hrt1 and Tbx1 appear normal in Fgf8H/– mutants. Views of the pharyngeal arch area, head is at the top. Arches are numbered in the controls. (A) Mfh1, (B) Hrt1, (C) Tbx1 and (D,E) Fgf10 expression in E9.5 and E10.5 control and mutant embryos. (E) Note the markedly decreased signal in the pharyngeal arches, including area of the developing fourth arch and putative secondary heart field, although expression in limb bud and ototcyst is relatively intact.

 
We have previously shown that ectodermal FGF8 maintains mesenchymal Fgf10 expression in the developing limb bud and questioned whether a similar relationship occurred between FGF8 and Fgf10 in the pharyngeal arch epithelia and mesenchyme (Moon and Capecchi, 2000Go). Examination of Fgf10 expression at E9.5 and E10.5 (Fig. 4D,E) revealed markedly decreased signal in the pharyngeal arch mesenchyme, including the regions of the developing fourth arch and putative secondary heart field (Kelly et al., 2001Go).

Fgf8H/– mice exhibit thymic and parathyroid aplasia and hypoplasia
The thymus and parathyroid glands develop from the third and fourth pharyngeal pouch endoderm and migrate caudally to their final location in the mediastinum. We analyzed mutants by gross dissection and in sections, and found that 50% of mutants had no detectable thymus, while in another 50% the thymus was hypoplastic with small single or double lobes or strands of thymic tissue ectopically located in the rostral region of the neck (Fig. 5A-C). Rarely, ectopic thymic tissue could be found penetrating into the oropharynx of E18.5 mutants (data not shown). The parathyroid glands were aplastic or hypoplastic in 50% of mutants (Fig. 5D-F).



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 5. Fgf8H/– mutants display glandular phenotypes and T-cell deficiency attributable to altered pharyngeal pouch development. eighty percent of mutants had thymic (Ty) hypo/aplasia and 50% had parathyroid hypo/aplasia. (A-C) Thoracotomies, (D-F) Hematoxylin and Eosin stained paraffin wax-embedded sections. The trachea (tr), esophagus (e) and thyroids (td) are also indicated. (A) Normal bi-lobed thymus in a control E18.5 embryo. (B) Hypoplastic, mono-lobed thymus in a mutant. (C) Thymic aplasia in a mutant (arrowhead). (D) Normal bilateral parathyroid glands in a control E18.5 embryo (arrowheads). (E) Parathyroid aplasia in a mutant (arrowheads), the entire cervical region of this animal was sectioned and no parathyroids were detected. (F) Ectopic, hypoplastic parathyroid (arrowhead) adjacent to internal carotid vessel (v) in a mutant. (G) Representative FACS plots of control and mutant thymi. (H) Percent (left panel) and total (right panel) CD4CD8double negative (DN) and CD4+CD8+double positive (DP) thymocytes in n=9 control embryos or n=2 mutant embryos with thymic hypoplasia. Mutants with thymic hypoplasia have 20% of the normal number of T cells. Note that 50% of mutant embryos have no thymus. Data are shown as mean±s.e.m.

 
Fgf8 mutants have a T-cell deficiency
One of the cardinal features of individuals with deletion 22q11 and DiGeorge sequence is a variable immunodeficiency associated with decreased number of T cells (Jawad et al., 2001Go). Though 50% of the Fgf8 mutants had aplasia of the thymus, we were able to evaluate T cells in those with hypoplastic glands. Fig. 5G shows representative FACS (fluorescence activated cell sort) plots comparing T cells obtained from control and mutant thymi immunostained with anti CD4 and anti CD8 antibodies. In Fig. 5H, the percent (left panel) and total (right panel) number of CD4CD8double negative (DN) and CD4+CD8+double positive (DP) thymocytes are compared in E18.5 controls and mutants; mutants had 20% of the normal number of T cells. The thymocyte subpopulations were normal and no difference was detected in CD44 or CD25 staining of double negative-gated thymocytes (data not shown).

Fgf8 is not expressed in neural crest cells
The Fgf8H/– mutant phenotypes are striking in their similarity to human del22q11 syndromes and animal models of neural crest dysfunction. Although Fgf8 expression has not been reported in neural crest in the mouse, it is possible that these defects arise from a deficiency of FGF8 in a previously undetected expression domain in neural crest. To determine if Fgf8 is expressed in premigratory or migratory neural crest, we combined the Wnt1-Cre transgene (Jiang et al., 2000Go) with the alkaline phosphatase (AP) reporter/conditional features of the Fgf8H allele (Moon and Capecchi, 2000Go) (Fig. 1A). LoxP sites flank exon 5 and neor, and enable conditional expression of the AP reporter upon Cre-mediated recombination of the Fgf8H allele. In this experiment, cells of the Wnt1 lineage, including premigratory cardiac neural crest (Echelard et al., 1994Go), contain the recombined Fgf8H allele; thus, blue AP staining indicates cells that currently or previously express(ed) Wnt1, and that currently express Fgf8 (Fig. 6). We detected overlapping domains of Wnt1 and Fgf8 expression in the isthmus and frontonasal prominences at E9.5 (Crossley and Martin, 1995Go; Echelard et al., 1994Go), but none in the domain of premigratory or migratory cardiac neural crest, which originates in rhombomeres six through eight, at either E8.5 or E9.5. These results suggest that the cardiovascular and glandular phenotypes of Fgf8 mutants result from altered signaling between the pharyngeal epithelium, the mesodermal mesenchyme, and neural crest en route to the arches, outflow tract and heart.



View larger version (86K):
[in this window]
[in a new window]
 
Fig. 6. Premigratory and migratory cardiac and pharyngeal neural crest do not express Fgf8. Wnt1-Cre was used to drive expression of the alkaline phosphatase (AP) reporter gene from the Fgf8H allele in premigratory and migrating neural crest; Cre-mediated recombination of the Fgf8H allele results in expression of the AP gene regulated by the Fgf8 promoter and is detected as blue staining. (A) E8.5 control embryo bearing the Fgf8H allele. (B) E8.5 embryo bearing the Fgf8H and the Wnt1-Cre transgene; no staining is detected, indicating that Fgf8 is not expressed in any cells of the Wnt1-Cre lineage at this stage. (C) E9.5 control embryo with the Fgf8H allele. (D) E9.5 embryo bearing the Fgf8H allele and the Wnt1-Cre transgene; blue staining reveals overlapping domains of Wnt1 and Fgf8 expression in the isthmus and frontonasal prominences (arrows). No activity in neural crest of rhombomeres 6-8 (R6, R7 arrowheads), which are the origin of premigratory third and fourth pharyngeal and cardiac neural crest.

 
Pharyngeal and cardiac neural crest undergoes abnormal apoptosis in Fgf8H/– mice
We questioned whether neural crest survival and migration were affected by decreased FGF8 in the pharyngeal ectoderm and endoderm of the pharyngeal arches. Using whole-mount TUNEL analysis, we found an increased number of apoptotic cells and abnormal domains of apoptosis in the pharyngeal arches of mutants when compared with controls (Fig. 7A-C). The expression of Fgf8 is also shown to help the reader visualize how the apoptotic domains relate spatially to regions of Fgf8 expression (Fig. 7D-F). Note that there are domains of apoptosis adjacent and relatively distant to locations of normal FGF8 signaling.



View larger version (115K):
[in this window]
[in a new window]
 
Fig. 7. There is increased apoptosis in the pharyngeal arches of Fgf8H/– mutants in domains adjacent and remote to Fgf8 expression. Whole mount TUNEL analysis was performed on 25 somite, stage-matched control. (A) and mutant (B,C) embryos. Pharyngeal arches are numbered and the otocyst is labeled (O); note the increased number of apoptotic cells in normal domains in the rostral arches (white arrowheads in B) and abnormal domains of apoptosis in the postotic region of the developing fourth and sixth arches (yellow arrowheads) in the mutants. Fgf8 expression by in situ hybridization on E9.5 control and mutant embryos. (D,E) Pharyngeal region of control embryo and (E) mutant embryo; note severely decreased quantity of Fgf8 message in the mutant (red arrowheads, consistent with results in Fig. 1B). Domains of apoptosis in B and C are seen both adjacent, and relatively distant, to normal regions of Fgf8 expression.

 
To determine specifically if abnormal apoptosis was occurring in neural crest, we performed fluorescent immunohistochemistry using anti-AP-2{alpha} antibody to label migrating neural crest in cryosectioned embryos (Mitchell et al., 1991Go). Domains of apoptosis in the neural tube and developing ganglia were present in mutants and controls at the 25 somite stage (Fig. 8A,B, blue arrowheads), but the domains were much larger in the mutants (Fig. 8, yellow arrowheads). In the mutants, there were additional abnormal domains of apoptosis and many TUNEL/antiAP-2{alpha} double-labeled cells (yellow signal, yellow arrowheads) in neural crest migrating from rhombomeres 6 and 7 into the lateral developing fourth and sixth arches. This finding was reproducible and persisted to the 29 somite stage (Fig. 8C,D). No reproducible differences in proliferation were detected at this stage, as assayed with an antiphosphohistone H3 antibody to label chromatin in proliferating cells. Note that in whole-mount TUNEL and cryosectioned specimens, many of the apoptotic cells are distant from the sources of FGF8 in the pharyngeal pouches and clefts shown in Fig. 7 (Crossley and Martin, 1995Go; Heikinheimo et al., 1994Go; MacArthur et al., 1995Go).



View larger version (129K):
[in this window]
[in a new window]
 
Fig. 8. Migrating cardiac neural crest undergoes abnormal apoptosis in Fgf8H/– mutants. Fluorescent immunohistochemistry was performed on transverse cryosections using a combination of anti-AP-2/FITC (green), TUNEL/Texas red (red) and either (A,B) anti-Tuj1/Cy5 (blue) which labels neuronal tubulin, or (C,D) antiPHH3/Cy5 (blue), which labels chromatin in proliferating cells. (A,B) Twenty-five somite stage matched (A) control and (B) mutant; plane and region of sections are illustrated by broken lines in Fig. 7B. White asterisks mark the third PAA in parallel. (C,D) Twenty-nine somite stage matched (C) control and (D) mutant; sections begin just posterior to the junction of the third aortic arch artery with the dorsal aorta (ao). From left to right, sections proceed from anterior to posterior through the post-otic region. Blue arrowheads indicate normal domains of apoptosis, including regions of developing ganglia and neural tube that label with anti-Tuj1. Yellow arrowheads indicate increased numbers of apoptotic cells in normal domains or abnormal domains of apoptosis in mutant neural crest mesenchyme. Yellow staining indicates double labeling of cardiac/pharyngeal neural crest cells with anti-AP-2{alpha} and TUNEL, and reveals abnormal apoptosis in lateral neural crest of the developing fourth arch. No reproducible differences in PHH3 staining were detected at this stage.

 

    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have described an Fgf8 hypomorphic mouse that displays a range of pharyngeal and cardiovascular phenotypes that closely phenocopies human del22q11 syndrome. We postulate that these developmental defects result from an insufficient dosage of FGF8 locally in the pharyngeal arches. The fact that both Fgf8+/H and Fgf8+/– heterozygotes are normal indicates that a crucial decrease in the dose of FGF8 occurs when the hypomorphic and null alleles are combined in a single embryo. If the phenotypes were due to an effect of the neor gene on other loci, Fgf8+/H heterozygotes would be affected. Furthermore, ablation of Fgf8 function in the pharyngeal arch ectoderm using a tissue-specific Cre recombinase and a nonhypomorphic conditional allele reproduces many features of the phenotype (Arenkiel and Moon, unpublished data) and reveals that the roles of FGF8 in left-right specification (Meyers and Martin, 1999Go) and in pharyngeal and cardiovascular development are separable. Meyers and colleagues have previously described aberrant Fgf8 splicing into a neor gene targeted to an intron that resulted in a hypomorphic allele (Meyers et al., 1998Go); this hypomorphic affect appears to be significantly more severe than that resulting from placement of neor in the 3'UTR that we describe. They described a range of defects in their compound heterozygotes including early embryonic death, gastrulation failure, severe CNS malformations and left-right asymmetry defects, which indicates earlier and more severe FGF8 deficiency in these animals (Meyers et al., 1998Go; Meyers and Martin, 1999Go). Our Fgf8H/– mice have focal developmental defects from reduced FGF8 dose, indicating that this hypomorphic allele produces sufficient functional Fgf8 message for the embryo to gastrulate and specify the left-right axis correctly. The work of both groups reveals that different tissues have different dosage requirements for FGF8 likely reflecting redundancy other FGFs (Moon et al., 2000Go; Moon and Capecchi, 2000Go; Lewandoski et al., 2000Go; Sun et al., 2000Go).

Deficiency of FGF8 causes cardiovascular, craniofacial and glandular phenotypes resulting from abnormal pharyngeal arch development, altered mesenchymal expression of Fgf10 and decreased neural crest survival. Similar to our observation in the developing limb (Moon and Capecchi, 2000Go), we found that epithelial FGF8 is required for expression of Fgf10 in the pharyngeal arch mesenchyme, including the region of the developing fourth pharyngeal arch and the putative secondary heart field (Kelly et al., 2001Go). Further experiments will be required to determine if aspects of the outflow tract defects seen in Fgf8 hypomorphs are related to this finding. Tissue-specific ablation of FGF8 in the pharyngeal epithelia may clarify its role in this region.

Although cardiac neural crest does not itself express Fgf8, Fgf8 mutants display increased apoptosis in this tissue, indicating that FGF8 signaling from pouch endoderm and ectoderm is important for its survival. FGF receptors are expressed in the ectoderm and throughout the mesenchyme of the pharyngeal arches (MacArthur et al., 1995Go; Orr-Urtreger et al., 1993Go; Orr-Urtreger et al., 1991Go; Peters et al., 1992Go). Our whole-mount TUNEL and analysis of apoptosis in sections reveals that some of the apoptosis is (not surprisingly) directly adjacent to sites of epithelial Fgf8 expression (Crossley and Martin, 1995Go; Heikinheimo et al., 1994Go; MacArthur et al., 1995Go) (Fig. 7) and probably reflects the failure of FGF8/FGFR1- or FGF8/FGFR2-mediated signaling. However, other large domains of mesenchymal apoptosis are relatively distant from these sources. This finding suggests that altered FGF8 signaling is sensed or relayed distant to its expression domains; such relays may, or may not, be based on FGF/FGFR interactions. We have reported the same phenomenon in proximal limb mesenchyme after conditional ablation of FGF8 in the distal limb ectoderm (Moon and Capecchi, 2000Go) and reproduced this finding after ablation of both FGF4 and FGF8 in the limb ectoderm (A. M. Boulet, M. R. C. and A. M. M., unpublished). Ablation of FGF8 in first arch ectoderm results in abnormal apoptosis of neural crest-derived mesenchyme (much of which is distant to the epithelial FGF8 source (Trumpp et al., 1999Go), similar to that described here.

The phenotypes of Fgf8 and Tbx1 mutants confirm that pharyngeal endoderm plays a crucial role in patterning the pharyngeal neural crest and mesoderm-derived mesenchyme (Couly et al., 2002Go; LeDouarin, 1982Go; Piotrowski and Nusslein-Volhard, 2000Go; Thomas et al., 1998Go; Veitch et al., 1999Go; Wendling et al., 2000Go). The importance of cardiac neural crest in the pathogenesis of the human del22q11 syndromes is supported by neural crest ablations in chick (Creazzo et al., 1998Go) and the splotch mouse (Conway et al., 1997bGo; Epstein et al., 2000Go). Several mouse models with neural crest dysfunction exhibit conotruncal and aortic arch defects (Bamforth et al., 2001Go; Feiner et al., 2001Go; Mendelsohn et al., 1994Go; Schorle et al., 1996Go; Zhang et al., 1996Go). Our results concur with accumulating evidence that neural crest cells rely on signals from adjacent tissues for patterning and survival en route to their targets (Trainor and Krumlauf, 2000Go) and indicate an important role for epithelial-mesenchymal interactions in neural crest function during development.

Aortic arch abnormalities arise from defects in formation or remodeling of the PAAs, although models vary considerably in pathogenesis. In neural crest-ablated chicks, PAA 3, PAA 4 and PAA 6 are formed but rapidly regress (Kirby, 1999Go). This indicates that interactions between neural crest, the primitive vessel and possibly the mesodermal mesenchyme are required for stabilization and subsequent remodeling of the vessel. In Df1 heterozygotes or Tbx1 haploinsufficient mice, the fourth PAA is specifically affected. These mutants initially form an endothelialized tube that is not stabilized and by E10.5, 100% of animals have a nonpatent vessel (Lindsay and Baldini, 2001Go; Lindsay et al., 1999Go; Lindsay et al., 2001Go). Recovery from this defect is variable resulting in a 30% incidence of primarily right-sided cardiovascular defects. Homozygous mutants of Crkol, Mfh1 or genes in the endothelin signaling pathway all demonstrate fourth PAA defects in which arteries form normally, but regress to a variable extent after E11.5 (Guris et al., 2001Go; Iida et al., 1997Go; Kurihara et al., 1995Go; Yanagisawa et al., 1998Go). Our Fgf8 mutants exhibit early defects in vessel formation and stabilization similar to the Tbx1 and Df1 mutants described by Lindsay and colleagues (Lindsay and Baldini, 2001Go; Lindsay et al., 1999Go; Lindsay et al., 2001Go). Endothelial cells are aggregated in the fourth arch at E10.5, but patent vessel lumens are not evident. However, we see a greater proportion of left sided and bilateral defects at E10.5, and no evidence of recovery by E11.5. This results in a greater incidence of fourth PAA defects in the newborns, particularly the more severe left-sided phenotypes of IAAB and right aortic arch.

The Fgf8 hypomorphic phenotype suggests that Fgf8 may contribute to the variability of human del22q11 phenotypes as a modifier, or may be a causative locus in syndromic individuals that do not have deletions of 22q11. Complete inactivation of one allele of Fgf8 in conjunction with a decrease in function of the remaining allele in mice provides a spectrum of disease closely resembling that seen in humans. FGF8 may participate directly in molecular pathways affected by deletions in the 22q11 region or function in parallel pathways required for normal development of pharyngeal arch and neural crest-derived tissues.

Given the lack of genotype-phenotype correlation in humans with the 22q11 deletion, it is possible that dysfunction of other developmentally active loci is required to produce the most severe del22q11 phenotypes. To test this hypothesis in mice, we are searching for genetic interactions by evaluating mice bearing combinations of mutant loci known to generate aspects of this phenotype. Screening individuals with del22q11 for mutations on the nondeleted chromosome 22 or for mutations in genes known to contribute to pharyngeal arch development (Fgf8, Pax3, for example) will provide another important test of this hypothesis.


    ACKNOWLEDGMENTS
 
We thank the Capecchi laboratory, Gary Schoenwolf and Michael Bamshad for helpful discussions and critical reading of the manuscript; we also appreciate the tissue culture and vivarium staff for their technical expertise and effort. We appreciate Mary Scriven’s assistance with the figures. D. F. is a PCMC Foundation Fellow and is supported by the University of Utah Children’s Health Research Center. A. M. M. is supported by the Program in Human Molecular Biology and Genetics, and NIH K08HD1373.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Bamforth, S. D., Braganca, J., Eloranta, J. J., Murdoch, J. N., Marques, F. I., Kranc, K. R., Farza, H., Henderson, D. J., Hurst, H. C. and Bhattacharya, S. (2001). Cardiac malformations, adrenal agenesis, neural crest defects and exencephaly in mice lacking Cited2, a new Tfap2 co-activator. Nat. Genet. 29, 469-474.[Medline]

Birgbauer, E., Sechrist, J., Bronner-Fraser, M. and Fraser, S. (1995). Rhombomeric origin and rostrocaudal reassortment of neural crest cells revealed by intravital microscopy. Development 121, 935-945.[Abstract]

Bockman, D. E. and Kirby, M. L. (1984). Dependence of thymus development on derivatives of the neural crest. Science 223, 498-500.[Abstract/Free Full Text]

Bockman, D. E., Redmond, M. E. and Kirby, M. L. (1989). Alteration of early vascular development after ablation of cranial neural crest. Anat. Rec. 225, 209-217.[Medline]

Burn, J., Takao, A., Wilson, D., Cross, I., Momma, K., Wadey, R., Scambler, P. and Goodship, J. (1993). Conotruncal anomaly face syndrome is associated with a deletion within chromosome 22q11. J. Med. Genet. 30, 822-824.[Abstract/Free Full Text]

Chieffo, C., Garvey, N., Gong, W., Roe, B., Zhang, G., Silver, L., Emanuel, B. S. and Budarf, M. L. (1997). Isolation and characterization of a gene from the DiGeorge chromosomal region homologous to the mouse Tbx1 gene. Genomics 43, 267-277.[Medline]

Conway, S. J., Henderson, D. J. and Copp, A. J. (1997a). Pax3 is required for cardiac neural crest migration in the mouse: evidence from the splotch (Sp2H) mutant. Development 124, 505-514.[Abstract]

Conway, S. J., Henderson, D. J., Kirby, M. L., Anderson, R. H. and Copp, A. J. (1997b). Development of a lethal congenital heart defect in the splotch (Pax3) mutant mouse. Cardiovasc. Res. 36, 163-173.[Abstract/Free Full Text]

Couly, G., Creuzet, S., Bennaceur, S., Vincent, C. and le Douarin, N. M. (2002). Interactions between Hox-negative cephalic neural crest cells and the foregut endoderm in patterning the facial skeleton in the vertebrate head. Development 129, 1061-1073.[Abstract/Free Full Text]

Creazzo, T. L., Godt, R. E., Leatherbury, L., Conway, S. J. and Kirby, M. L. (1998). Role of cardiac neural crest cells in cardiovascular development. Annu. Rev. Physiol. 60, 267-286.[Medline]

Crossley, P. H. and Martin, G. R. (1995). The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development 121, 439-451.[Abstract]

Dietrich, S. and Gruss, P. (1995). undulated phenotypes suggest a role of Pax-1 for the development of vertebral and extravertebral structures. Dev. Biol. 167, 529-548.[Medline]

DiGeorge, A. M. (1965). Discussion on a new concept of the cellular basis of immunology. J. Pediatr. 67, 907.

Echelard, Y., Vassileva, G. and McMahon, A. P. (1994). Cis-acting regulatory sequences governing Wnt-1 expression in the developing mouse CNS. Development 120, 2213-2224.[Abstract]

Emanuel, B. S., McDonald-McGinn, D., Saitta, S. C. and Zackai, E. H. (2001). The 22q11.2 deletion syndrome. Adv. Pediatr. 48, 39-73.[Medline]

Epstein, J. A., Li, J., Lang, D., Chen, F., Brown, C. B., Jin, F., Lu, M. M., Thomas, M., Liu, E., Wessels, A. et al. (2000). Migration of cardiac neural crest cells in Splotch embryos. Development 127, 1869-1878.[Abstract]

Etchevers, H. C., Couly, G., Vincent, C. and le Douarin, N. M. (1999). Anterior cephalic neural crest is required for forebrain viability. Development 126, 3533-3543.[Abstract]

Feiner, L., Webber, A. L., Brown, C. B., Lu, M. M., Jia, L., Feinstein, P., Mombaerts, P., Epstein, J. A. and Raper, J. A. (2001). Targeted disruption of semaphorin 3C leads to persistent truncus arteriosus and aortic arch interruption. Development 128, 3061-3070.[Abstract/Free Full Text]

Franz, T. (1989). Persistent truncus arteriosus in the Splotch mutant mouse. Anat. Embryol. 180, 457-464.[Medline]

Garg, V., Yamagishi, C., Hu, T., Kathiriya, I. S., Yamagishi, H. and Srivastava, D. (2001). Tbx1, a DiGeorge syndrome candidate gene, is regulated by sonic hedgehog during pharyngeal arch development. Dev. Biol. 235, 62-73.[Medline]

Gottlieb, S., Driscoll, D. A., Punnett, H. H., Sellinger, B., Emanuel, B. S. and Budarf, M. L. (1998). Characterization of 10p deletions suggests two nonoverlapping regions contribute to the DiGeorge syndrome phenotype. Am. J. Hum. Genet. 62, 495-498.[Medline]

Goulding, M., Sterrer, S., Fleming, J., Balling, R., Nadeau, J., Moore, K. J., Brown, S. D., Steel, K. P. and Gruss, P. (1993). Analysis of the Pax-3 gene in the mouse mutant splotch. Genomics 17, 355-363.[Medline]

Guris, D. L., Fantes, J., Tara, D., Druker, B. J. and Imamoto, A. (2001). Mice lacking the homologue of the human 22q11.2 gene CRKL phenocopy neurocristopathies of DiGeorge syndrome. Nat. Genet. 27, 293-298.[Medline]

Heikinheimo, M., Lawshe, A., Shackelford, G. M., Wilson, D. B. and MacArthur, C. A. (1994). Fgf-8 expression in the post-gastrulation mouse suggests roles in the develoopment of the face, limbs and central nervous system. Mech. Dev. 48, 129-138.[Medline]

Herve, J., Warnet, J. F., Jeaneau-Bellego, E., Portnoi, M. F., Taillemitte, J. L. and Herve, F. (1984). Partial monosomy of the short arm of chromosome 10, associated with Rieger’s syndrome and a Di George type partial immunodeficiency. Ann. Pediatr. 31, 77-80.

Iida, K., Koseki, H., Kakinuma, H., Kato, N., Mizutani-Koseki, Y., Ohuchi, H., Yoshioka, H., Noji, S., Kawamura, K., Kataoka, Y. et al. (1997). Essential roles of the winged helix transcription factor MFH-1 in aortic arch patterning and skeletogenesis. Development 124, 4627-4638.[Abstract]

Jawad, A. F., McDonald-Mcginn, D. M., Zackai, E. and Sullivan, K. E. (2001). Immunologic features of chromosome 22q11.2 deletion syndrome (DiGeorge syndrome/velocardiofacial syndrome). J. Pediatr. 139, 715-723.[Medline]

Jerome, L. A. and Papaioannou, V. E. (2001). DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1. Nat. Genet. 27, 286-291.[Medline]

Jiang, X., Rowitch, D. H., Soriano, P., McMahon, A. P. and Sucov, H. M. (2000). Fate of the mammalian cardiac neural crest. Development 127, 1607-1616.[Abstract]

Kelly, R. G., Brown, N. A. and Buckingham, M. E. (2001). The arterial pole of the mouse heart forms from Fgf10-expressing cells in pharyngeal mesoderm. Dev. Cell 1, 435-440.[Medline]

Kimber, W. L., Hsieh, P., Hirotsune, S., Yuva-Paylor, L., Sutherland, H. F., Chen, A., Ruiz-Lozano, P., Hoogstraten-Miller, S. L., Chien, K. R., Paylor, R. et al. (1999). Deletion of 150 kb in the minimal DiGeorge/velocardiofacial syndrome critical region in mouse. Hum. Mol. Genet. 8, 2229-2237.[Abstract/Free Full Text]

Kirby, M. (1999). Contribution of neural crest to heart and vessel morphology. In Heart Development (ed. N. Rosenthal), pp. 179-193. San Diego, CA: Academic Press.

Kirby, M. L. and Waldo, K. L. (1990). Role of neural crest in congenital heart disease. Circulation 82, 332-340.[Free Full Text]

Kurihara, Y., Kurihara, H., Oda, H., Maemura, K., Nagai, R., Ishikawa, T. and Yazaki, Y. (1995). Aortic arch malformations and ventricular septal defect in mice deficient in endothelin-1. J. Clin. Invest. 96, 293-300.

Le Douarin, N. M. and Jotereau, F. V. (1975). Tracing of cells of the avian thymus through embryonic life in interspecific chimeras. J. Exp. Med. 142, 17-40.[Abstract/Free Full Text]

LeDouarin, N. (1982). The Neural Crest. Cambridge: Cambridge University Press.

LeLievre, C. S. and LeDouarin, N. (1975). Mesenchymal derivatives of the neural crest: analysis of chimaeric quail and chick embryos. J. Embryol. Exp. Morphol. 34, 125-154.[Medline]

Lewandoski, M., Sun, X. and Martin, G. R. (2000). Fgf8 signalling from the AER is essential for normal limb development. Nat. Genet. 26, 460-463.[Medline]

Lindsay, E. A. (2001). Chromosomal microdeletions: dissecting del22q11 syndrome. Nat. Rev. Genet. 2, 858-868.[Medline]

Lindsay, E. A. and Baldini, A. (2001). Recovery from arterial growth delay reduces penetrance of cardiovascular defects in mice deleted for the DiGeorge syndrome region. Hum. Mol. Genet. 10, 997-1002.[Abstract/Free Full Text]

Lindsay, E. A., Botta, A., Jurecic, V., Carattini-Rivera, S., Cheah, Y. C., Rosenblatt, H. M., Bradley, A. and Baldini, A. (1999). Congenital heart disease in mice deficient for the DiGeorge syndrome region. Nature 401, 379-383.[Medline]

Lindsay, E. A., Vitelli, F., Su, H., Morishima, M., Huynh, T., Pramparo, T., Jurecic, V., Ogunrinu, G., Sutherland, H. F., Scambler, P. J. et al. (2001). Tbx1 haploinsufficieny in the DiGeorge syndrome region causes aortic arch defects in mice. Nature 410, 97-101.[Medline]

MacArthur, C. A., Lawshe, A., Xu, J., Santos-Ocampo, S., Heikinheimo, M., Chellaiah, A. T. and Ornitz, D. M. (1995). FGF-8 isoforms activate receptor splice forms that are expressed in mesenchymal regions of mouse development. Development 121, 3603-3613.[Abstract]

Manley, N. R. and Capecchi, M. R. (1998). Hox group 3 paralogs regulate the development and migration of the thymus, thyroid, and parathyroid glands. Dev. Biol. 195, 1-15.[Medline]

Mendelsohn, C., Lohnes, D., Decimo, D., Lufkin, T., LeMeur, M., Chambon, P. and Mark, M. (1994). Function of the retinoic acid receptors (RARs) during development (II). Multiple abnormalities at various stages of organogenesis in RAR double mutants. Development 120, 2749-2771.[Abstract]

Merscher, S., Funke, B., Epstein, J. A., Heyer, J., Puech, A., Lu, M. M., Xavier, R. J., Demay, M. B., Russell, R. G., Factor, S. et al. (2001). TBX1 is responsible for cardiovascular defects in velo-cardio-facial/DiGeorge syndrome. Cell 104, 619-629.[Medline]

Meyers, E. N. and Martin, G. R. (1999). Differences in left-right axis pathways in mouse and chick: functions of FGF8 and SHH. Science 285, 403-406.[Abstract/Free Full Text]

Meyers, E. N., Lewandoski, M. and Martin, G. R. (1998). An Fgf8 mutant allelic series generated by Cre- and Flp-mediated recombination. Nat. Genet. 18, 136-141.[Medline]

Mitchell, P. J., Timmons, P. M., Hebert, J. M., Rigby, P. W. and Tjian, R. (1991). Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis. Genes Dev. 5, 105-119.[Abstract/Free Full Text]

Moon, A. M., Boulet, A. M. and Capecchi, M. R. (2000). Normal limb development in conditional mutants of Fgf4. Development 127, 989-996.[Abstract]

Moon, A. M. and Capecchi, M. R. (2000). FGF8 is required for outgrowth and patterning of the limbs. Nat. Genet. 26, 455-459.[Medline]

Nakagawa, O., Nakagawa, M., Richardson, J. A., Olson, E. N. and Srivastava, D. (1999). HRT1, HRT2, and HRT3: a new subclass of bHLH transcription factors marking specific cardiac, somitic, and pharyngeal arch segments. Dev. Biol. 216, 72-84.[Medline]

Nakagawa, O., McFadden, D. G., Nakagawa, M., Yanagisawa, H., Hu, T., Srivastava, D. and Olson, E. N. (2000). Members of the HRT family of basic helix-loop-helix proteins act as transcriptional repressors downstream of Notch signaling. Proc. Natl. Acad. Sci. USA 97, 13655-13660.[Abstract/Free Full Text]

Orr-Urtreger, A., Bedford, M. T., Burakova, T., Arman, E., Zimmer, Y., Yayon, A., Givol, D. and Lonai, P. (1993). Developmental localization of the splicing alternatives of fibroblast growth factor receptor-2 (FGFR2). Dev. Biol. 158, 475-486.[Medline]

Orr-Urtreger, A., Givol, D., Yayon, A., Yarden, Y. and Lonai, P. (1991). Developmental expression of two murine fibroblast growth factor receptors, flg and bek. Development 113, 1419-1434.[Abstract]

Peters, H., Neubuser, A., Kratochwil, K. and Balling, R. (1998). Pax9-deficient mice lack pharyngeal pouch derivatives and teeth and exhibit craniofacial and limb abnormalities. Genes Dev. 12, 2735-2747.[Abstract/Free Full Text]

Peters, K. G., Werner, S., Chen, G. and Williams, L. T. (1992). Two FGF receptor genes are differentially expressed in epithelial and mesemchymal tissues during limb formation and organogenesis in the mouse. Development 114, 233-243.[Abstract]

Piotrowski, T. and Nusslein-Volhard, C. (2000). The endoderm plays an important role in patterning the segmented pharyngeal region in zebrafish (Danio rerio). Dev. Biol. 225, 339-356.[Medline]

Puech, A., Saint-Jore, B., Merscher, S., Russell, R. G., Cherif, D., Sirotkin, H., Xu, H., Factor, S., Kucherlapati, R. and Skoultchi, A. I. (2000). Normal cardiovascular development in mice deficient for 16 genes in 550 kb of the velocardiofacial/DiGeorge syndrome region. Proc. Natl. Acad. Sci. USA 97, 10090-10095.[Abstract/Free Full Text]

Revest, J. M., Suniara, R. K., Kerr, K., Owen, J. J. and Dickson, C. (2001). Development of the thymus requires signaling through the fibroblast growth factor receptor R2-IIIb. J. Immunol. 167, 1954-1961.[Abstract/Free Full Text]

Robinson, H. B., Jr (1975). DiGeorge’s or the III-IV pharyngeal pouch syndrome: pathology and a theory of pathogenesis. Perspect. Pediatr. Pathol. 2, 173-206.[Medline]

Saint-Jore, B., Puech, A., Heyer, J., Lin, Q., Raine, C., Kucherlapati, R. and Skoultchi, A. I. (1998). Goosecoid-like (Gscl), a candidate gene for velocardiofacial syndrome, is not essential for normal mouse development. Hum. Mol. Genet. 7, 1841-1849.[Abstract/Free Full Text]

Scambler, P. J. (2000). The 22q11 deletion syndromes. Hum. Mol. Genet. 9, 2421-2426.[Abstract/Free Full Text]

Schorle, H., Meier, P., Buchert, M., Jaenisch, R. and Mitchell, P. J. (1996). Transcription factor AP-2 essential for cranial closure and craniofacial development. Nature 381, 235-238.[Medline]

Shprintzen, R. J., Goldberg, R. B., Lewin, M. L., Sidoti, E. J., Berkman, M. D., Argamaso, R. V. and Young, D. (1978). A new syndrome involving cleft palate, cardiac anomalies, typical facies, and learning disabilities: velo-cardio-facial syndrome. Cleft Palate J. 15, 56-62.[Medline]

Stadler, H. S., Higgins, K. M. and Capecchi, M. R. (2001). Loss of Eph-receptor expression correlates with loss of cell adhesion and chondrogenic capacity in Hoxa13 mutant limbs. Development 128, 4177-4188.[Abstract/Free Full Text]

Sun, X., Lewandoski, M., Meyers, E. N., Liu, Y. H., Maxson, R. E., Jr and Martin, G. R. (2000). Conditional inactivation of Fgf4 reveals complexity of signalling during limb bud development. Nat. Genet. 25, 83-86.[Medline]

Thomas, T., Kurihara, H., Yamagishi, H., Kurihara, Y., Yazaki, Y., Olson, E. N. and Srivastava, D. (1998). A signaling cascade involving endothelin-1, dHAND and msx1 regulates development of neural-crest-derived branchial arch mesenchyme. Development 125, 3005-3014.[Abstract]

Trainor, P. and Krumlauf, R. (2000). Plasticity in mouse neural crest cells reveals a new patterning role for cranial mesoderm. Nat. Cell Biol. 2, 96-102.[Medline]

Trumpp, A., Depew, M. J., Rubenstein, J. L., Bishop, J. M. and Martin, G. R. (1999). Cre-mediated gene inactivation demonstrates that FGF8 is required for cell survival and patterning of the first branchial arch. Genes Dev. 13, 3136-3148.[Abstract/Free Full Text]

Tucker, A. S., Al Khamis, A., Ferguson, C. A., Bach, I., Rosenfeld, M. G. and Sharpe, P. T. (1999a). Conserved regulation of mesenchymal gene expression by Fgf-8 in face and limb development. Development 126, 221-228.[Abstract]

Tucker, A. S., Yamada, G., Grigoriou, M., Pachnis, V. and Sharpe, P. T. (1999b). Fgf-8 determines rostral-caudal polarity in the first branchial arch. Development 126, 51-61.[Abstract]

Van Mierop, L. H. and Kutsche, L. M. (1986). Cardiovascular anomalies in DiGeorge syndrome and importance of neural crest as a possible pathogenetic factor. Am. J. Cardiol. 58, 133-137.[Medline]

Veitch, E., Begbie, J., Schilling, T. F., Smith, M. M. and Graham, A. (1999). Pharyngeal arch patterning in the absence of neural crest. Curr. Biol. 9, 1481-1484.[Medline]

Wadey, R., McKie, J., Papapetrou, C., Sutherland, H., Lohman, F., Osinga, J., Frohn, I., Hofstra, R., Meijers, C., Amati, F. et al. (1999). Mutations of UFD1L are not responsible for the majority of cases of DiGeorge Syndrome/velocardiofacial syndrome without deletions within chromosome 22q11. Am. J. Hum. Genet. 65, 247-249.[Medline]

Wendling, O., Dennefeld, C., Chambon, P. and Mark, M. (2000). Retinoid signaling is essential for patterning the endoderm of the third and fourth pharyngeal arches. Development 127, 1553-1562.[Abstract]

Yamagishi, H., Garg, V., Matsuoka, R., Thomas, T. and Srivastava, D. (1999). A molecular pathway revealing a genetic basis for human cardiac and craniofacial defects. Science 283, 1158-1161.[Abstract/Free Full Text]

Yanagisawa, H., Hammer, R. E., Richardson, J. A., Williams, S. C., Clouthier, D. E. and Yanagisawa, M. (1998). Role of Endothelin-1/Endothelin-A receptor-mediated signaling pathway in the aortic arch patterning in mice. J. Clin. Invest. 102, 22-33.[Medline]

Zhang, J., Hagopian-Donaldson, S., Serbedzija, G., Elsemore, J., Plehn-Dujowich, D., McMahon, A. P., Flavell, R. A. and Williams, T. (1996). Neural tube, skeletal and body wall defects in mice lacking transcription factor AP-2. Nature 381, 238-241.[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
DMMHome page
C. Catela, D. Bilbao-Cortes, E. Slonimsky, P. Kratsios, N. Rosenthal, and P. te Welscher
Multiple congenital malformations of Wolf-Hirschhorn syndrome are recapitulated in Fgfrl1 null mice
Dis. Model. Mech., May 1, 2009; 2(5-6): 283 - 294.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
F. Rochais, K. Mesbah, and R. G. Kelly
Signaling Pathways Controlling Second Heart Field Development
Circ. Res., April 24, 2009; 104(8): 933 - 942.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
K. R. Chien, I. J. Domian, and K. K. Parker
Cardiogenesis and the Complex Biology of Regenerative Cardiovascular Medicine
Science, December 5, 2008; 322(5907): 1494 - 1497.
[Abstract] [Full Text] [PDF]


Home page
Circ Cardiovasc GenetHome page
E. Goldmuntz, S. Woyciechowski, D. Renstrom, P. J. Lupo, and L. E. Mitchell
Variants of Folate Metabolism Genes and the Risk of Conotruncal Cardiac Defects
Circ Cardiovasc Genet, December 1, 2008; 1(2): 126 - 132.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Newbern, J. Zhong, R. S. Wickramasinghe, X. Li, Y. Wu, I. Samuels, N. Cherosky, J. C. Karlo, B. O'Loughlin, J. Wikenheiser, et al.
Mouse and human phenotypes indicate a critical conserved role for ERK2 signaling in neural crest development
PNAS, November 4, 2008; 105(44): 17115 - 17120.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Kim, A. R. Wende, S. Sena, H. A. Theobald, J. Soto, C. Sloan, B. E. Wayment, S. E. Litwin, M. Holzenberger, D. LeRoith, et al.
Insulin-Like Growth Factor I Receptor Signaling Is Required for Exercise-Induced Cardiac Hypertrophy
Mol. Endocrinol., November 1, 2008; 22(11): 2531 - 2543.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
C.-P. Chang, K. Stankunas, C. Shang, S.-C. Kao, K. Y. Twu, and M. L. Cleary
Pbx1 functions in distinct regulatory networks to pattern the great arteries and cardiac outflow tract
Development, November 1, 2008; 135(21): 3577 - 3586.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. Zhang, Y. Lin, Y. Zhang, Y. Lan, C. Lin, A. M. Moon, R. J. Schwartz, J. F. Martin, and F. Wang
Frs2{alpha}-deficiency in cardiac progenitors disrupts a subset of FGF signals required for outflow tract morphogenesis
Development, November 1, 2008; 135(21): 3611 - 3622.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
E. J. Park, Y. Watanabe, G. Smyth, S. Miyagawa-Tomita, E. Meyers, J. Klingensmith, T. Camenisch, M. Buckingham, and A. M. Moon
An FGF autocrine loop initiated in second heart field mesoderm regulates morphogenesis at the arterial pole of the heart
Development, November 1, 2008; 135(21): 3599 - 3610.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Ryckebusch, Z. Wang, N. Bertrand, S.-C. Lin, X. Chi, R. Schwartz, S. Zaffran, and K. Niederreither
Retinoic acid deficiency alters second heart field formation
PNAS, February 26, 2008; 105(8): 2913 - 2918.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. Rizzoti and R. Lovell-Badge
SOX3 activity during pharyngeal segmentation is required for craniofacial morphogenesis
Development, October 1, 2007; 134(19): 3437 - 3448.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Z. S. Hakim, L. A. DiMichele, J. T. Doherty, J. W. Homeister, H. E. Beggs, L. F. Reichardt, R. J. Schwartz, J. Brackhan, O. Smithies, C. P. Mack, et al.
Conditional Deletion of Focal Adhesion Kinase Leads to Defects in Ventricular Septation and Outflow Tract Alignment
Mol. Cell. Biol., August 1, 2007; 27(15): 5352 - 5364.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Lin, L. Cui, W. Zhou, D. Dufort, X. Zhang, C.-L. Cai, L. Bu, L. Yang, J. Martin, R. Kemler, et al.
beta-Catenin directly regulates Islet1 expression in cardiovascular progenitors and is required for multiple aspects of cardiogenesis
PNAS, May 29, 2007; 104(22): 9313 - 9318.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
V. S. Aggarwal, J. Liao, A. Bondarev, T. Schimmang, M. Lewandoski, J. Locker, A. Shanske, M. Campione, and B. E. Morrow
Dissection of Tbx1 and Fgf interactions in mouse models of 22q11DS suggests functional redundancy
Hum. Mol. Genet., November 1, 2006; 15(21): 3219 - 3228.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
G. von Scheven, L. E. Alvares, R. C. Mootoosamy, and S. Dietrich
Neural tube derived signals and Fgf8 act antagonistically to specify eye versus mandibular arch muscles
Development, July 15, 2006; 133(14): 2731 - 2745.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
D. Franco
FGF signalling in the cardiac fields
Cardiovasc Res, July 1, 2006; 71(1): 1 - 3.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Marguerie, F. Bajolle, S. Zaffran, N. A. Brown, C. Dickson, M. E. Buckingham, and R. G. Kelly
Congenital heart defects in Fgfr2-IIIb and Fgf10 mutant mice
Cardiovasc Res, July 1, 2006; 71(1): 50 - 60.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
E. J. Park, L. A. Ogden, A. Talbot, S. Evans, C.-L. Cai, B. L. Black, D. U. Frank, and A. M. Moon
Required, tissue-specific roles for Fgf8 in outflow tract formation and remodeling
Development, June 15, 2006; 133(12): 2419 - 2433.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
R. Ilagan, R. Abu-Issa, D. Brown, Y.-P. Yang, K. Jiao, R. J. Schwartz, J. Klingensmith, and E. N. Meyers
Fgf8 is required for anterior heart field development
Development, June 15, 2006; 133(12): 2435 - 2445.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
Y. E. Yu, M. Morishima, A. Pao, D.-Y. Wang, X.-Y. Wen, A. Baldini, and A. Bradley
A Deficiency in the Region Homologous to Human 17q21.33-q23.2 Causes Heart Defects in Mice
Genetics, May 1, 2006; 173(1): 297 - 307.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. S. Arnold, U. Werling, E. M. Braunstein, J. Liao, S. Nowotschin, W. Edelmann, J. M. Hebert, and B. E. Morrow
Inactivation of Tbx1 in the pharyngeal endoderm results in 22q11DS malformations
Development, March 1, 2006; 133(5): 977 - 987.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
R. V. Hoch and P. Soriano
Context-specific requirements for Fgfr1 signaling through Frs2 and Frs3 during mouse development
Development, February 15, 2006; 133(4): 663 - 673.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Z. Zhang, F. Cerrato, H. Xu, F. Vitelli, M. Morishima, J. Vincentz, Y. Furuta, L. Ma, J. F. Martin, A. Baldini, et al.
Tbx1 expression in pharyngeal epithelia is necessary for pharyngeal arch artery development
Development, December 1, 2005; 132(23): 5307 - 5315.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S. Kawauchi, J. Shou, R. Santos, J. M. Hebert, S. K. McConnell, I. Mason, and A. L. Calof
Fgf8 expression defines a morphogenetic center required for olfactory neurogenesis and nasal cavity development in the mouse
Development, December 1, 2005; 132(23): 5211 - 5223.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
F. A. Stennard and R. P. Harvey
T-box transcription factors and their roles in regulatory hierarchies in the developing heart
Development, November 15, 2005; 132(22): 4897 - 4910.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Ishii, J. Han, H.-Y. Yen, H. M. Sucov, Y. Chai, and R. E. Maxson Jr
Combined deficiencies of Msx1 and Msx2 cause impaired patterning and survival of the cranial neural crest
Development, November 15, 2005; 132(22): 4937 - 4950.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. A. Groves, C. L. Hammond, and S. M. Hughes
Fgf8 drives myogenic progression of a novel lateral fast muscle fibre population in zebrafish
Development, October 1, 2005; 132(19): 4211 - 4222.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S. D. Vincent, N. R. Dunn, R. Sciammas, M. Shapiro-Shalef, M. M. Davis, K. Calame, E. K. Bikoff, and E. J. Robertson
The zinc finger transcriptional repressor Blimp1/Prdm1 is dispensable for early axis formation but is required for specification of primordial germ cells in the mouse
Development, March 15, 2005; 132(6): 1315 - 1325.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. A. Nichols and T. L. Creazzo
L-type Ca2+ channel function in the avian embryonic heart after cardiac neural crest ablation
Am J Physiol Heart Circ Physiol, March 1, 2005; 288(3): H1173 - H1178.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
T. Hu, H. Yamagishi, J. Maeda, J. McAnally, C. Yamagishi, and D. Srivastava
Tbx1 regulates fibroblast growth factors in the anterior heart field through a reinforcing autoregulatory loop involving forkhead transcription factors
Development, November 1, 2004; 131(21): 5491 - 5502.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
V. Kaartinen, M. Dudas, A. Nagy, S. Sridurongrit, M. M. Lu, and J. A. Epstein
Cardiac outflow tract defects in mice lacking ALK2 in neural crest cells
Development, July 15, 2004; 131(14): 3481 - 3490.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
Y. Kameda, Y. Arai, T. Nishimaki, and O. Chisaka
The Role of Hoxa3 Gene in Parathyroid Gland Organogenesis of the Mouse
J. Histochem. Cytochem., May 1, 2004; 52(5): 641 - 652.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
T. L. Macatee, B. P. Hammond, B. R. Arenkiel, L. Francis, D. U. Frank, and A. M. Moon
Ablation of specific expression domains reveals discrete functions of ectoderm- and endoderm-derived FGF8 during cardiovascular and pharyngeal development
Development, December 22, 2003; 130(25): 6361 - 6374.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. M. Maynard, G. T. Haskell, A. Z. Peters, L. Sikich, J. A. Lieberman, and A.-S. LaMantia
A comprehensive analysis of 22q11 gene expression in the developing and adult brain
PNAS, November 25, 2003; 100(24): 14433 - 14438.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
T. Piotrowski, D.-g. Ahn, T. F. Schilling, S. Nair, I. Ruvinsky, R. Geisler, G.-J. Rauch, P. Haffter, L. I. Zon, Y. Zhou, et al.
The zebrafish van gogh mutation disrupts tbx1, which is involved in the DiGeorge deletion syndrome in humans
Development, October 15, 2003; 130(20): 5043 - 5052.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
T. J. Wright and S. L. Mansour
Fgf3 and Fgf10 are required for mouse otic placode induction
Development, August 1, 2003; 130(15): 3379 - 3390.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
D. Bachiller, J. Klingensmith, N. Shneyder, U. Tran, R. Anderson, J. Rossant, and E. M. De Robertis
The role of chordin/Bmp signals in mammalian pharyngeal development and DiGeorge syndrome
Development, August 1, 2003; 130(15): 3567 - 3578.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. Niederreither, J. Vermot, I. L. Roux, B. Schuhbaur, P. Chambon, and P. Dolle
The regional pattern of retinoic acid synthesis by RALDH2 is essential for the development of posterior pharyngeal arches and the enteric nervous system
Development, June 1, 2003; 130(11): 2525 - 2534.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Nakamura, M. Sano, Z. Songyang, and M. D. Schneider
A Wnt- and beta -catenin-dependent pathway for mammalian cardiac myogenesis
PNAS, May 13, 2003; 100(10): 5834 - 5839.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. A. Packham and J. D. Brook
T-box genes in human disorders
Hum. Mol. Genet., April 2, 2003; 12(90001): R37 - 44.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Vermot, K. Niederreither, J.-M. Garnier, P. Chambon, and P. Dolle
Decreased embryonic retinoic acid synthesis results in a DiGeorge syndrome phenotype in newborn mice
PNAS, February 18, 2003; 100(4): 1763 - 1768.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
H. Yamagishi, J. Maeda, T. Hu, J. McAnally, S. J. Conway, T. Kume, E. N. Meyers, C. Yamagishi, and D. Srivastava
Tbx1 is regulated by tissue-specific forkhead proteins through a common Sonic hedgehog-responsive enhancer
Genes & Dev., January 15, 2003; 17(2): 269 - 281.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frank, D. U.
Right arrow Articles by Moon, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frank, D. U.
Right arrow Articles by Moon, A. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?