|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
DEVELOPMENT AND DISEASE |
1 Department of Pediatrics, Neonatal Perinatal Research Institute, Duke University Medical Center, Durham, NC 27710, USA
2 Department of Cell Biology, Duke University Medical Center, Durham, NC 27710, USA
3 Department of Molecular Biomedical Sciences, North Carolina State University Raleigh, NC 27606, USA
4 Institute of Molecular Embryology and Genetics, 4-24-1 Kuhonji, Kumamoto, 862-0976, Japan
*Author for correspondence (e-mail: meyer031{at}mc.duke.edu)
Accepted 1 July 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Fgf8, Mouse, Cardiovascular, Pharyngeal arch, DiGeorge, Neural crest, Cell death, 22q11, Double outlet right ventricle, Transposition, Arch artery, Patterning.
| INTRODUCTION |
|---|
|
|
|---|
Previously, we have targeted the Fgf8 gene locus to generate an allelic series of mutations. In addition to a null allele (Fgf8tm1.4Mrt or Fgf8) and a Cre recombinase-dependent floxed allele of Fgf8 (Fgf8tm1.3Mrt or Fgf8Flox), we have generated a hypomorphic allele (Fgf8tm1.1Mrt or Fgf8neo) that variably lowers the level of functional Fgf8 mRNA (Meyers et al., 1998
). The development of compound heterozygous (Fgf8neo/) embryos (herein termed Fgf8 mutants) is variable, with
20% resembling the Fgf8/ gastrulation phenotype or less severe gastrulation defects. These embryos arrest development between embryonic day (E) 7.5 and E9.5. The remaining 80% of Fgf8neo/ embryos progress to term with neural, limb, craniofacial and/or cardiac defects.
Previously, we have also shown that some of these embryos have abnormalities in left-right axis (LR) determination with cardiac looping abnormalities. Cardiac looping was reversed in 21% and failure or midline looping occurred in 28% (
20% in the current study), while
50% had pulmonary isomerism or abnormal Nodal expression (Meyers and Martin, 1999
). The embryos with midline/failure of looping arrest development at E9.5. This suggests therefore, that at near term, the number of surviving embryos with atrioventricular discordance (looping reversal) in this study should be
30%. This study focuses on the PA and cardiovascular development of the Fgf8neo/ embryos that survive early defects,
50% of which potentially have abnormal LR axis specification.
NCCs are ecto-mesenchymal cells that migrate from the extreme dorsal surface of the embryo to populate numerous structures along the dorsoventral axis. Cranial neural crest arises from the forebrain and hindbrain region to populate craniofacial structures as well as PA1-3, giving rise to the maxilla, mandible as well as other structures of the neck and face. Cardiac neural crest has been defined in the chick as originating between the otic placode and the third somite (Kuratani and Kirby, 1992
; Nishibatake et al., 1987
). These cells populate the third, fourth and sixth PAs, as well as the outflow tract of the heart. Many of the original NCC fate map studies in chick have more recently been confirmed in the mouse through use of the Cre/LoxP transgenic system to lineage trace neural crest derivatives (Jiang et al., 2000
; Li et al., 2000
; Yamauchi et al., 1999
).
NCCs are essential for cardiovascular patterning and experimental models that ablate cardiac NCCs result in characteristic cardiovascular abnormalities such as failure of outflow tract septation and aortic arch artery defects (reviewed by Kirby and Waldo, 1995
). In addition, several mouse genetic models with abnormal NCC development also have these characteristic cardiovascular abnormalities (reviewed by Maschhoff and Baldwin, 2000
). Several human birth defect syndromes, collectively termed 22q11 deletion syndromes, are thought to result from defects in NCC development. Cardiovascular defects include no outflow tract septation (persistent truncus arteriosus), abnormal septation (double outlet right ventricle, tetralogy of Fallot), or abnormal patterning of the aortic arch arteries leading to interruption of the aortic arch and aberrant vascular structures. Craniofacial findings in these syndromes can include cleft palate, abnormal facial features as well as external ear defects. Deficiencies of other NCC-dependent structures such as the thymus and parathyroids are seen as well (reviewed by Lindsay, 2001
).
In this study we present an analysis of the cardiovascular and PA phenotypes present in Fgf8neo/ embryos. Fgf8 mutants have defects in many NCC-derived cardiovascular and craniofacial structures that mimic the 22q11 deletion syndromes. These novel phenotypes define a role for Fgf8 in cardiovascular, PA and NCC development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of Fgf8neo/:: Tie2-lacZ embryos
To follow endothelial cell development, we established Fgf8+/ mice that were transgenic for the Tie2-lacZ transgene in which lacZ is controlled by a Tie2 endothelial cell promoter element (Schlaeger et al., 1997
). Fgf8+/::Tie2-lacZ males were then crossed to Fgf8neo/+ females to generate control and Fgf8neo/ embryos also transgenic for Tie2-lacZ. Embryos were examined for ß-Galactosidase (ß-Gal) activity and cleared in a 50% glycerol/phosphate buffered saline (PBS) solution for visualization. Of note, the pericardial sac was removed prior to staining and the embryos were rotated slowly at 37°C to improve penetration of deep tissue.
Generation of Fgf8neo/::R26R::P0-Cre embryos
To lineage trace NCCS in Fgf8 mutants, we generated males that were Fgf8+/ and transgenic for P0-Cre (Yamauchi et al., 1999
), and crossed these to Fgf8neo/+ females also transgenic for the Cre reporter transgenic line R26R (Soriano, 1999
). Embryos were then fixed and stained for ß-Gal activity. Embryos were cleared as above.
In situ hybridization
Whole-mount mRNA in situ hybridization was performed essentially as described (Neubuser et al., 1997
) using digoxigenin antisense riboprobes constructed from linearized plasmids. All in situ results were confirmed in at least three mutant and three control embryos treated identically.
Immunohistochemistry
Immunohistochemistry was performed on embryos fixed in 4% PFA (overnight 4°C) and washed in PBT (PBS with 0.1%Triton X-100). Embryos were blocked (PBT, 3% BSA, 10% sheep serum) for 1 hour followed by incubation (in block) with/without primary antibody at 4°C overnight. Embryos were then washed in 1:5 block:PBT three times for 1 hour each. Embryos were incubated overnight with secondary antibody in block followed by washing (3x1 hour each) in 1:5 block:PBT and then mounted with DABCO.
Whole-mount cranial nerves were visualized with monoclonal 2H3 antibody (Developmental Studies Hybridoma Bank and developed by T. Jessel and J. Dodd) as described (Swiatek and Gridley, 1993
). Embryos were washed and alkaline phosphatase-conjugated secondary antibody added. Embryos were washed again and then stained for alkaline phosphatase with NBT/BCIP in 0.1 mM levamisole.
Whole-mount proliferation was performed by detecting cells in metaphase with anti-phosphorylated histone H3 IgG (Upstate Biotechnology) and an Alexa Red secondary antibody (Molecular Probes). Embryos were then dehydrated, cleared and mounted for confocal analysis as described (Zucker et al., 1999
).
Cell death
Whole-mount cell death was performed using Lysotracker Red (Molecular Probes) essentially as described (Zucker et al., 1999
) with the following modifications: sterile lactated ringers was substituted for Tyrodes buffer; 2-4 µM Lysotracker was used for 30 minutes while rotating at 37°C in an air filled tube; embryos were washed three times in lactated ringers and then four times in PBS over the course of 30 minutes at room temperature with gentle inversion; embryos were then fixed, dehydrated and cleared as described.
TUNEL assay (Roche) was performed on PO-Cre::R26R::Fgf8neo/ embryos that were first stained for lacZ in whole mount. Embryos were dehydrated, embedded in paraffin wax and sectioned at 6 µm. TUNEL was then performed essentially as described by the manufacturer.
Genotyping
Fgf8neo/ embryos are identifiable as early as E8.5 by defects at the mid-hindbrain boundary. Heterozygous adult mice and embryos at earlier stages were genotyped as described (Meyers and Martin, 1999
). P0-Cre and Msx2-Cre transgenic mice were genotyped using the PCR primers (5' TGATGAGGTTCGCAAGAACC:: 3' CCATGAGTGAACGAACCTGG) contained within the Cre gene; R26R and Tie2-lacZ transgenic mice were genotyped using the PCR primers (5' ATCCTCTGCATGGTCAGGTC:: 3' CGTGGCCTGATTCATTCC) contained within the lacZ gene. Throughout the study, Fgf8+/+, Fgf8neo/+ or Fgf8+/ littermate embryos were considered wild-type/control embryos as they demonstrate no identifiable phenotype.
Confocal analysis
Embryos where indicated were analyzed on a Zeiss LSM 410 laser-scanning confocal microscope. For cell death and proliferation, z-sectioning series were done with single pass 1-4 µm sections. Sections were then stacked and converted to Quicktime movie images using NIH Image v. 1.62 software for serial viewing.
Ectopic application of FGF8
ICR mouse E9.5 embryos were incubated in stationary culture (DMEM with 20% fetal calf serum, penicillin and streptomycin antibiotics). Heparin beads (Sigma H5263) were coated with 1 mg/ml FGF8 protein (b isoform; R&D Systems) or PBS with 1 mg/ml BSA. Embryos were placed on their left sides and 1-3 beads were placed over the right caudal arches. Embryos were then cultured for 4-6 hours at 37° and 5% CO2. Media was washed off and embryos fixed overnight in 4% paraformaldehyde in preparation for in situ hybridization.
| RESULTS |
|---|
|
|
|---|
|
|
In addition to these extracardiac defects, there were intracardiac defects as well in Fgf8neo/ embryos. The left ventricle was often hypoplastic (compare Fig. 1A with 1B) and histological analysis revealed atrial and ventricular septal defects in all mutants examined (n=12) that had outflow tract defects (Fig. 1H,I). In addition, two of the 12 sectioned mutants had defects in the atrioventricular junction consisting of a singular atrioventricular valve (Fig. 1I). Thirty-four percent (40/119) of mutants had grossly normal cardiac development, most likely reflecting the variable reduction in Fgf8 expression characteristic of the hypomorphic allele (Meyers et al., 1998
).
Fgf8neo/ embryos have defective aortic arch artery development
In order to understand how these cardiovascular defects arose from loss of Fgf8, we examined cardiovascular development between E8.5 and E10.5 using the endothelial cell marking Tie2-lacZ transgene (Schlaeger et al., 1997
) to visualize arch artery development in Fgf8 mutants (n=23) and controls (n=37). Seventy-eight percent (18/23) of Fgf8neo/ mutant embryos had gross defects in the endothelial pattern of the arch arteries. In E9.5 wild-type embryos, arch arteries 1-3 are well formed while the fourth is beginning to form (Fig. 2A). These arteries were often smaller or absent in similar stage mutants (Fig. 2B,C). At E10.5 the third, fourth and sixth arch arteries of wild type are readily apparent (Fig. 2G), while defects, including hypoplasia or complete absence of the third and/or fourth arch arteries, was present in 60% (14/23) of Fgf8 mutants (Fig. 2H,I). We did not detect a LR bias to the defects seen in Fgf8 mutants as nine had bilateral, five had left-sided and four had right-sided defects.
|
Fgf8neo/ embryos have abnormal pharyngeal arch development
One of the most striking defects on gross examination of Fgf8neo/ embryos at earlier stages is abnormal development of the PAs. As early as E8.0, hypoplasia of the first PA can be identified; by E10.5, Fgf8 mutants have obviously smaller first and second pharyngeal arches (compare Fig. 3A with 3B). These arches show a reduction in both total size, but also in the formation of the pharyngeal clefts, which are the ectodermal junctions between arches (compare Fig. 3C with 3D and arrowheads in 3E with those in 3F). Besides the clefts, the PAs also have internal endodermal pouches that delineate each arch. The first two endothelial pouches appeared grossly intact (Fig. 3C,D). More caudal, the third and fourth arches were small or absent in Fgf8 mutants as well, when examined by laser confocal optical section (Fig. 3E,F). Pharyngeal pouches 3 and 4 were difficult to identify in mutants, suggesting they were also small or absent. To better define the pouches, we examined the expression of Pax1, which is expressed in the developing endodermal pouches (Deutsch et al., 1988
). While Pax1 was expressed in the first and second pouch (Fig. 3G,H), the expression was abnormal with a fusion of these two pouches. This is consistent with the absence of the more proximal region of the second PA we have observed in some of these embryos (Fig. 2C, arrowhead). In addition, later stages demonstrated loss of Pax1 expression in the caudal pouches of mutants (Fig. 3I,J), presumably because these structures were absent, consistent with the morphological examination.
|
The first PA develops as two distinct rostral and caudal structures, termed the maxillary and the mandibular components, respectively. The maxillary component contributes to the maxilla, zygomatic arch, squamosal bone and a region of the palate. Defects in all of these structures are seen in Fgf8neo/ embryos (Fig. 4A,B and data not shown). The mandibular component contributes to Meckels cartilage, which forms the malleus and incus (middle ear bones) and supports mandible development. Again, defects in all three of these structures occurred with absent or severely hypoplastic Meckels cartilage (data not shown), absent malleus and incus, as well as a severely defective mandible and tympanic ring (Fig. 4C-F). Other craniofacial defects included reduced or absent alisphenoid, presphenoid, squamosal, pterygoid, palatine and alatemporalis bones (Fig. 3A,B and data not shown).
|
The second PA gives rise to Reicherts cartilage, which in turn contributes to the stapes, as well as the styloid process and the dorsal aspect of the hyoid bone. In Fgf8neo/ embryos, the stapes was normal or slightly smaller while the styloid process was thickened and/or shortened (Fig. 4E,F). Although most were normal, a small number of Fgf8 mutants had mild defects in the hyoid bone. The mild nature of this defect is surprising given the severe defects noted in arch 2 earlier in development (Fig. 2C, Fig. 3B,H). The external ear, which develops from several hillocks at the dorsal base of the first and second arch, was also either hypoplastic or completely absent in a majority of Fgf8 mutants, suggesting proximal segments of the first two arches are defective as well (Fig. 4G,H).
The third and fourth arches contribute to laryngeal cartilages as well as to several glands in the neck including the thymus, thyroid and parathyroid glands. The thymus of most mutants were smaller, single lobed or completely absent (data not shown). In addition, some mutant embryos had a reduction in the size and number of sub-mandibular glands. Minor defects in the laryngeal cartilages of Fgf8 mutants occurred but were rare.
We next examined the development of the NCC-derived cranial nerves. We found subtle defects in the development of cranial nerves 4, 5, 7, 9 and 10. The trochlear (4) was completely absent (data not shown), most probably as a result of the deletion of the mid-hindbrain (from which the fourth nerve arises) previously described in these mutants (Meyers et al., 1998
). Cranial nerves 5, 7, 9 and 10 had truncated end processes consistent with the loss of arch and craniofacial tissue described above (Fig. 4I,J). The grossly normal size and location of the nerves suggested that these abnormalities are secondary to loss of target tissues and not due to abnormal specification or patterning of the cranial nerves themselves.
Neural crest is specified and migrates in Fgf8neo/ embryos
Most or all of the above defects are consistent with abnormal development of the PAs and more specifically of the cranial and cardiac NCCs. Given the defects we observed in NCC-derived structures, we next sought to determine if NCCs are specified and migrate in Fgf8 mutant embryos. We examined two markers, Crabp1 and Ap2a, both expressed in migrating NCCs (Dencker et al., 1990
; Mitchell et al., 1991
). Ap2a (Fig. 5A,B) and Crabp1 (Fig. 5C,D) were grossly normal in quantity and migration pattern when examined in Fgf8 mutants at E9.5. However, at later stages (E10.5), a mild reduction was seen in the expression of both markers, suggesting that NCCs are specified and migrate but are not maintained (data not shown).
|
At E10.5, there was a modest decrease in the domain that was ß-Gal-positive in the pharyngeal arches, suggesting that loss of arch tissue at least partially results from loss of NCCs (Fig. 5E,F, red brackets). In addition, we also noted decreased NCCs entering the outflow tract of the heart. Normally, the NCCs enter the outflow tract of the heart in two discrete prongs (Fig. 5G). When Fgf8 mutants (n=5) were compared with controls (n=15) stage matched for somite number (±2 somites), the prongs of NCCs were either smaller (Fig. 5H) or almost completely absent (data not shown; n=1). These prongs were smaller, despite NCCs traveling a similar distance into the outflow tract when compared with controls, confirming that they were at a comparable stage of development (arrows Fig. 5H). It should also be noted that all stage-matched controls displayed similar prongs in the outflow tract, suggesting that PO-Cre was giving a consistent recombination pattern and that the timing of NCCs entering the outflow tract was also relatively consistent between wild-type embryos at the same somite stage.
NCCs proliferate normally in Fgf8neo/ embryos
A reduction of NCCs in Fgf8neo/ embryos after specification and migration indicates either an abnormality in proliferation or survival of NCCs in the absence of normal levels of Fgf8. We first examined proliferation using an antiphospho-histone H3 antibody to mark cells in metaphase. Whole-mount embryos were then examined using confocal laser microscopy optical sections (see Materials and Methods). Representative confocal sections of E9.5 embryos are shown in Fig. 6A-C. We were unable to detect a significant difference of proliferation within the arches of Fgf8neo/ embryos (n=3) when compared with control littermates. However, we cannot rule out that subtle differences in proliferation, or changes in proliferation occurring at earlier stages, are contributing to the decreased NCCs seen in these mutants.
|
Fgf8 expression correlates with areas of cell death
We performed whole-mount Fgf8 mRNA in situ hybridization to determine the expression pattern of Fgf8 in wild-type embryos relative to the areas of cell death seen in Fgf8 mutants. Strikingly, the expression of Fgf8 in the developing arches corresponds well with the areas of increased cell death seen in the mutants. At E8.0, Fgf8 expression in the forebrain and lower arches closely approximates the apoptosis seen (compare arrow and arrowheads in Fig. 6E,F). At E8.5, there continues to be increased death either adjacent to or immediately below the arch expression of Fgf8, while new cell death is occurring in the mid-hindbrain region where Fgf8 is also expressed (compare Fig. 6H with 6I). At E9.5, the area of cell death caudal to the otocyst appears adjacent or immediately dorsal to a broad domain of Fgf8 mRNA expression (compare Fig. 6K with 6L, arrowheads).
The expression of Fgf8 relative to the areas of cell death seen in Fgf8neo/ embryos coupled with the phenotype later seen in these mutants strongly suggests that Fgf8 is required for migrating NCC survival. To indirectly examine whether some of the cells dying are in fact neural crest, we first compared whole-mount lineage-traced neural crest expression to the areas of cell death. NCCs were marked by lacZ using the P0-Cre transgenic line crossed to the Cre reporter R26R (Fig. 6O). When compared with the pattern of cell death in the lateral optical section of a stage-matched Fgf8 mutant (Fig. 6N), the pattern of expression strikingly matches that of the NCCs, suggesting that some of the pharyngeal arch NCCs are dying in Fgf8 mutants (compare Figs 5A-D, 6O with 6N).
To determine definitively that some NCCs are dying in Fgf8 mutants, we examined lineage-traced NCCs in Fgf8 mutants for cell death. Using TUNEL assay on R26R::P0-Cre::Fgf8neo/ embryos, we detected mesenchymal cells that were blue (Fig. 7A), apoptotic (Fig. 7B) and overlapping (Fig. 7C). Closer examination of the overlap (Fig. 7D) revealed the expected nuclear localization of the TUNEL product as well as the cytoplasmic ß-gal activity.
|
Fgf8neo/ embryos resemble Tbx1/ embryos
Recently, the T-box containing transcription factor Tbx1, which is present in the human 22q11 deletion region, has been shown to be required for pharyngeal arch and cardiovascular development when deficient in the mouse. Tbx1/ embryos have multiple defects in heart development as well defects in the tympanic ring, zygomatic arch, temporal bone, external ear, palate and thymus (Jerome and Papaioannou, 2001
). In addition, the pharyngeal arches are markedly hypoplastic (Vitelli et al., 2002a
). All of these defects are observed in Fgf8 mutants (Fig. 4). Therefore we next sought to determine if Fgf8 and Tbx1 are in a common molecular pathway of arch/NCC development.
Fgf8 is not required for Tbx1 expression
To determine if expression of Tbx1 requires Fgf8, we examined the expression of Tbx1 mRNA in Fgf8neo/ embryos at E9.5 and E10.5. While the embryos examined had hypoplastic arches, Tbx1 was clearly expressed in these mutants (n=8), suggesting Fgf8 is not required to induce Tbx1 (Fig. 8A,B). However there was loss of Tbx1 expression in the core of the first and second arches as well as around the developing third arch artery (6/8). This most probably indicates that the tissues that normally express Tbx1 were absent; however, we cannot rule out that Fgf8 may be required to maintain, but not induce, some domains of Tbx1 expression such as in the core of PA1 and PA2 (Fig. 8).
|
dHAND expression is maintained in Fgf8neo/ hypoplastic arches
One other potentially important arch developmental gene that may be regulated by Fgf8 is the basic helix loop helix transcription factor dHAND (Hand2 Mouse Genome Informatics). dHAND is expressed in the pharyngeal arches and has been implicated in NCC development as dHAND/ embryos have hypoplasia of the pharyngeal arches as well as cardiovascular patterning defects (Thomas et al., 1998
). The arch defects seen in dHAND null embryos are reminiscent of the hypoplasia seen in Fgf8 mutants. In addition, dHAND expression requires endothelin 1 (Et1) signaling (Charite et al., 2001
; Clouthier et al., 2000
), and Fgf8 is required for Et1 expression in the first PA (Trumpp et al., 1999
). We therefore examined the expression of dHAND in Fgf8 mutant embryos. Surprisingly, dHAND expression was conserved or even expanded in Fgf8 mutants, despite the presence of severely hypoplastic arches at E9.5 (Fig. 8C,D and data not shown). At E10.5, expression continued to be maintained despite almost complete absence of arches 1 and 2 (Fig. 8E,F, arrows). Examination of the medial first arch in these same embryos revealed an apparent expansion of the dHAND domain in the Fgf8 mutant (Fig. 8G,H). One possible explanation for this finding is that the distal tips of the pharyngeal arches are maintained while the more proximal domains are lost, which is consistent with previous findings in the first arch (Trumpp et al., 1999
; Tucker et al., 1999
). To test this we examined three more markers expressed in the arches at E9.5. Dlx2 is a member of the distal-less gene family and is expressed in the mesenchyme of arches 1 and 2 (Qiu et al., 1995
). Fgf8 mutants consistently had reduced expression of Dlx2 in the first arch and absent expression in arch 2 (Fig. 8I,J). Similarly, the homeobox gene Msx1, which is thought to be regulated by dHAND (Thomas et al., 1998
), was reduced or absent in arch 1 and 2, while present in the distal tip of wild type (Fig. 8K,L). Finally, the transcription factor Gli1, a target of the hedgehog signaling pathway, is also expressed in the developing arches (Platt et al., 1997
). Shh/ mutants also have hypoplastic (Chiang et al., 1996
) arches with increased cell death (E. N. M., unpublished). Gli1 expression was retained in the distal PA1 but was absent from PA2 in Fgf8 mutants (Fig. 8M,N) consistent with the dHAND and Dlx2 findings. All of these data suggest that distal first PA signaling is relatively spared, while second PA derivatives are absent in Fgf8 mutants. We suggest that these pathways are primarily affected by the loss of tissue and not through direct regulation by Fgf8, except possibly that dHAND expression may be restricted by Fgf8.
| DISCUSSION |
|---|
|
|
|---|
The constellation of craniofacial and cardiovascular abnormalities seen in the Fgf8 mutant are reminiscent of defects seen in mouse embryos that disrupt the syntenic region of human chromosome 22q and are thought to result from defective NCC development. Recent evidence suggests that the T-Box transcription factor Tbx1 is a critical gene within this chromosomal deletion (Jerome and Papaioannou, 2001
; Lindsay et al., 2001
; Merscher et al., 2001
). Although there is strong evidence that Tbx1 is a critical gene within the 22q11 critical region in the mouse, humans with a del22q11-like phenotype but not the deletion have yet to be found with a defect in the Tbx1 gene (Gong et al., 2001
). Inheritance patterns and other data strongly suggest the presence of modifying factors that may alter the phenotype of the del22q11 syndrome (Taddei et al., 2001
). Because of the similarities in phenotype, it is tempting to speculate that Fgf8 may be a Tbx1 modifying factor. This is a reasonable hypothesis as there is evidence for Fgf regulation by T-box genes in other areas of development (Griffin et al., 1998
; Rodriguez-Esteban et al., 1999
), as well as a requirement of Fgfs for T-box gene function (Casey et al., 1998
; Strong et al., 2000
). More specifically, Tbx6 is not expressed in Fgf8/ embryos (Sun et al., 1999
).
We have demonstrated that Tbx1 is expressed in Fgf8 mutants but that the expression is reduced in the core of rostral arches, as well as around the third arch artery. This loss of expression appeared to correlate with lost tissue and most probably does not represent a direct effect on Tbx1 expression. FGF2 has been shown to induce Tbx4 and Tbx5 rapidly in the chick (Isaac et al., 2000
). However, when we placed FGF8 protein on E9.5 mouse PAs, we could not induce Tbx1, suggesting that Fgf8 is not capable of inducing Tbx1. One caveat to this experiment is that we may have attempted to induce Tbx1 at a time when the tissue was no longer competent to respond to Fgf8. However, it is more likely that Fgf8 cannot regulate Tbx1. These data suggest that if Fgf8 shares a common signaling pathway with Tbx1, Fgf8 lies downstream of Tbx1. Data from Vitelli et al. (Vitelli et al., 2002b
) support this model as Fgf8 is not expressed in the endoderm of Tbx1/ embryos and Fgf8+/::Tbx1+/ double heterozygous embryos have an enhanced phenotype over that of Fgf8+/+::Tbx1+/ embryos.
While there is evidence of some interaction, there are several differences in the phenotypes of Fgf8neo/ embryos and Tbx1/ embryos. Disruption of NCC migration is seen in Tbx1/ embryos (Vitelli et al., 2002a
) but not in Fgf8 mutants (Fig. 5B,D) suggesting different mechanisms of action. Tbx1+/ embryos are also haplo-insufficient and have a low frequency of defects in aortic arch artery development. We examined 23 Fgf8+/ embryos at E10.5 for defects in arch artery development and found only one with abnormal arch artery patterning when compared with wild-type controls. In addition, we found that 196/418 (47% of predicted 50%) Fgf8+/ mice were present at weaning age, suggesting no significant increased perinatal or neonatal lethality in heterozygous embryos. Tbx1/ embryos also are reported to have defects in first and second cervical vertebrae and fusion of the basisphenoid/basiocciptal bones (Jerome and Papaioannou, 2001
). We did not observe these defects in Fgf8 mutants.
One other genetic pathway we have investigated is that of the HAND transcription factors. dHAND is reported to be a downstream target of the endothelin pathway gene Et1 (Clouthier et al., 2000
). Et1/ embryos and knockouts of the endothelin receptors have cardiovascular and other defects that resemble the defects we observed in Fgf8 mutants and Et1 is reported to require Fgf8 for expression. Although most genes examined (Dlx2, Msx1 and Gli1) were reduced or absent from the arches of Fgf8 mutants, dHAND was normal or expanded, suggesting a possible complex regulatory loop between the dHAND gene and Fgf8 that we are investigating further.
Cardiovascular defects due to L-R axis and NCC abnormalities
How reduction of Fgf8 results in the cardiovascular defects described remains unclear. It seems likely that the arch artery defects are due to hypoplasia of the pharyngeal arches and/or loss of NCCs. It also seems likely that the intracardiac defects may be related to LR defects and not necessarily NCC development. However, how transposition and double outlet right ventricle occur is less clear. Fgf8 mutants clearly have defects in several neural crest-derived structures and have a moderate amount of NCC death. Our NCC lineage trace indicates that fewer NCCs are entering the outflow tract of the heart, and, in the case of one mutant, little or no NCCs were seen entering the outflow tract. It is tempting to speculate that decreased NCCs entering the outflow tract results in defects such as double outlet right ventricle, and that more severe reductions of NCCs result in persistent truncus arteriosus. This is consistent with the findings of M. Kirby and colleagues who demonstrated that ablation of neural crest can lead to double outlet right ventricle rather than persistent truncus arteriosus, possibly owing to partial NCC ablation (Kirby and Waldo, 1995
). It is also consistent with the observation that individuals with del22q11 have a range of cardiac defects that include outflow tract defects other than persistent truncus arteriosus.
However, these cardiac defects must also be considered with the knowledge that
50% of Fgf8 mutants are predicted to have defects in LR axis in the form of right isomerism, while 30% have cardiac looping reversals. Reversal of looping results in atrioventricular discordance (right atria with left ventricle, left atria with right ventricle). This does not necessarily result in outflow tract defects, as the alignment of ventricles with the outflow tract arteries may be independent of the alignment with the atria. However, some evidence suggests that abnormal LR axis specification does result in outflow tract defects, as other mouse models of right isomerism also frequently demonstrate outflow tract defects such as double outlet right ventricle (reviewed by Kathiriya and Srivastava, 2000
). Whether there are also pharyngeal arch and/or NCC abnormalities in these genetic models remains to be determined.
It seems clear that all of the cardiovascular defects could result from either alterations in LR axis specification or NCCs or some combination of both. In fact, it is hypothetically possible that LR signals pattern NCCs as these streams enter the arches and the outflow tract as distinct left and right populations (E. N. M., unpublished). LR differences in NCCs could theoretically account for why arch arteries regress/remain asymmetrically with respect to left and right.
In addition to neural crest and LR axis problems, Fgf8 mutants also have defects in endoderm formation (Fig. 3). There is a apparent loss of endoderm structures, and the caudal pharyngeal pouches do not express Pax1 in Fgf8neo/ embryos. Pharyngeal endoderm has previously been proposed as crucial for NCC development (Couly et al., 2002
). Recent evidence suggests that cells are added from the pharyngeal tissue and contribute to the lengthening of the outflow tract (Kelly et al., 2001
; Mjaatvedt et al., 2001
; Waldo et al., 2001
). Loss of these cells could also theoretically result in shortening of the outflow tract and subsequently malalignment, such as double outlet right ventricle. Tissue-specific Cre transgenics that are expressed in the endoderm exclusive of the ectoderm, or vice versa, could be used to address which or if both expression domains are important for what defects by eliminating complicating LR patterning defects.
How does Fgf8 affect NCCs
FGFs have been shown to influence proliferation, differentiation, migration, and survival of cells depending on the developmental context (reviewed by Ornitz and Itoh, 2001
). Fgf8 is expressed in several domains that could affect NCC development (Crossley and Martin, 1995
) and has previously been proposed to be important for pharyngeal arch development based on its expression pattern (Wall and Hogan, 1995
). Between E7.5 and E8.0, Fgf8 is expressed in the primitive streak and the developing tail as the embryonic axis extends (Fig. 6F). Theoretically, Fgf8 in these domains could be important for the specification of NCC precursors that will form at the border between neural and non-neural ectoderm, as has previously been suggested for Fgfs in vitro (Villanueva et al., 2002
) (reviewed by Baker and Bronner-Fraser, 1997
).
Fgf8 has also been implicated in NCC migration and specification (Kubota and Ito, 2000
; Trainor et al., 2002
). However, most or all of the NCCs appear to be specified and to migrate properly in Fgf8 mutants, so that the primary defects appear to result from the partial failure of NCC survival as they migrate and enter the pharyngeal arches. Fgf8 is expressed in the overlying arch ectoderm as well as the pharyngeal endoderm, which are in approximation with the migrating NCCs in all of the developing arches. Either or both of these domains of expression may therefore be crucial to maintain NCCs directly or indirectly. The importance of Fgf8 expression within first arch ectoderm for NCC survival has previously been demonstrated (Trumpp et al., 1999
; Tucker et al., 1999
). The expression of Fgf8 in the arches is dynamic, with more diffuse expression early as each arch forms (Fig. 6F,I), and more restricted expression as the arch becomes more defined (Fig. 6L). Our data suggest that similar to the first PA, Fgf8 expression in lower arches (ectodermal and/or endodermal) is required for NCC survival.
In summary, we have demonstrated that Fgf8 mutants have NCC defects that resemble some aspects of the 22q11 deletion syndromes. NCCs are specified and migrate in Fgf8 mutants, but undergo cell death in the absence of normal Fgf8 mRNA levels. Although Fgf8 mutants resemble Tbx1/ mouse embryos, whether Tbx1 acts on NCCs through Fgf8 remains to be determined. Cardiac and craniofacial defects in these mutants most likely result from loss of NCCs in combination with abnormal specification of the LR axis. Whether Fgf8 affects NCCs directly or indirectly and what domains of Fgf8 expression are crucial for NCC survival are areas we are investigating further. A variety of genetic and in vitro manipulations should help to answer these questions.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alsan, B. H. and Schultheiss, T. M. (2002). Regulation of avian cardiogenesis by Fgf8 signaling. Development 129, 1935-1943.
Baker, C. V. and Bronner-Fraser, M. (1997). The origins of the neural crest. Part I: Embryonic induction. Mech. Dev. 69, 3-11.[Medline]
Casey, E. S., OReilly, M. A., Conlon, F. L. and Smith, J. C. (1998). The T-box transcription factor Brachyury regulates expression of eFGF through binding to a non-palindromic response element. Development 125, 3887-3894.[Abstract]
Charite, J., McFadden, D. G., Merlo, G., Levi, G., Clouthier, D. E., Yanagisawa, M., Richardson, J. A. and Olson, E. N. (2001). Role of Dlx6 in regulation of an endothelin-1-dependent, dHAND branchial arch enhancer. Genes Dev. 15, 3039-3049.
Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J. L., Westphal, H. and Beachy, P. A. (1996). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383, 407-413.[Medline]
Clouthier, D. E., Williams, S. C., Yanagisawa, H., Wieduwilt, M., Richardson, J. A. and Yanagisawa, M. (2000). Signaling pathways crucial for craniofacial development revealed by endothelin-A receptor-deficient mice. Dev. Biol. 217, 10-24.[Medline]
Couly, G., Creuzet, S., Bennaceur, S., Vincent, C. and le Douarin, N. M. (2002). Interactions between Hox-negative cephalic neural crest cells and the foregut endoderm in patterning the facial skeleton in the vertebrate head. Development 129, 1061-1073.
Crossley, P. H. and Martin, G. R. (1995). The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development 121, 439-451.[Abstract]
Dencker, L., Annerwall, E., Busch, C. and Eriksson, U. (1990). Localization of specific retinoid-binding sites and expression of cellular retinoic-acid-binding protein (CRABP) in the early mouse embryo. Development 110, 343-352.
Deutsch, U., Dressler, G. R. and Gruss, P. (1988). Pax 1, a member of a paired box homologous murine gene family, is expressed in segmented structures during development. Cell 53, 617-625.[Medline]
Farrell, M. J., Burch, J. L., Wallis, K., Rowley, L., Kumiski, D., Stadt, H., Godt, R. E., Creazzo, T. L. and Kirby, M. L. (2001). FGF-8 in the ventral pharynx alters development of myocardial calcium transients after neural crest ablation. J. Clin. Invest. 107, 1509-1517.[Medline]
Garg, V., Yamagishi, C., Hu, T., Kathiriya, I. S., Yamagishi, H. and Srivastava, D. (2001). Tbx1, a DiGeorge syndrome candidate gene, is regulated by sonic hedgehog during pharyngeal arch development. Dev. Biol. 235, 62-73.[Medline]
Gong, W., Gottlieb, S., Collins, J., Blescia, A., Dietz, H., Goldmuntz, E., McDonald-McGinn, D. M., Zackai, E. H., Emanuel, B. S., Driscoll, D. A. et al. (2001). Mutation analysis of TBX1 in non-deleted patients with features of DGS/VCFS or isolated cardiovascular defects. J. Med. Genet. 38, E45.
Griffin, K. J., Amacher, S. L., Kimmel, C. B. and Kimelman, D. (1998). Molecular identification of spadetail: regulation of zebrafish trunk and tail mesoderm formation by T-box genes. Development 125, 3379-3388.[Abstract]
Isaac, A., Cohn, M. J., Ashby, P., Ataliotis, P., Spicer, D. B., Cooke, J. and Tickle, C. (2000). FGF and genes encoding transcription factors in early limb specification. Mech. Dev. 93, 41-48.[Medline]
Jerome, L. A. and Papaioannou, V. E. (2001). DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1. Nat. Genet. 27, 286-291.[Medline]
Jiang, X., Rowitch, D., Soriano, P., McMahon, A. P. and Sucov, H. (2000). Fate of the mammalian cardiac neural crest. Development 127, 1607-1616.[Abstract]
Kathiriya, I. S. and Srivastava, D. (2000). Left-right asymmetry and cardiac looping: implications for cardiac development and congenital heart disease. Am. J. Med. Genet. 97, 271-279.[Medline]
Kelly, R. G., Brown, N. A. and Buckingham, M. E. (2001). The arterial pole of the mouse heart forms from Fgf10-expressing cells in pharyngeal mesoderm. Dev. Cell 1, 435-440.[Medline]
Kirby, M. L. and Waldo, K. L. (1995). Neural crest and cardiovascular patterning. Circ. Res. 77, 211-215.
Kubota, Y. and Ito, K. (2000). Chemotactic migration of mesencephalic neural crest cells in the mouse. Dev. Dyn. 217, 170-179.[Medline]
Kuratani, S. C. and Kirby, M. L. (1992). Migration and distribution of circumpharyngeal crest cells in the chick embryo. Formation of the circumpharyngeal ridge and E/C8+ crest cells in the vertebrate head region. Anat. Rec. 234, 263-280.[Medline]
Lewandoski, M., Sun, X. and Martin, G. (2000). Fgf8 signalling from the AER is essential for normal limb development. Nat. Genet. 26, 460-463.[Medline]
Li, J., Chen, F. and Epstein, J. A. (2000). Neural crest expression of Cre recombinase directed by the proximal Pax3 promoter in transgenic mice. Genesis 26, 162-164.[Medline]
Lindsay, E. A. (2001). Chromosomal microdeletions: dissecting del22q11 syndrome. Nat. Rev. Genet. 2, 858-868.[Medline]
Lindsay, E. A. and Baldini, A. (2001). Recovery from arterial growth delay reduces penetrance of cardiovascular defects in mice deleted for the DiGeorge syndrome region. Hum. Mol. Genet. 10, 997-1002.
Lindsay, E. A., Vitelli, F., Su, H., Morishima, M., Huynh, T., Pramparo, T., Jurecic, V., Ogunrinu, G., Sutherland, H. F., Scambler, P. J. et al. (2001). Tbx1 haploinsufficieny in the DiGeorge syndrome region causes aortic arch defects in mice. Nature 410, 97-101.[Medline]
Maschhoff, K. L. and Baldwin, H. S. (2000). Molecular determinants of neural crest migration. Am. J. Med. Genet. 97, 280-288.[Medline]
Merscher, S., Funke, B., Epstein, J. A., Heyer, J., Puech, A., Lu, M. M., Xavier, R. J., Demay, M. B., Russell, R. G., Factor, S. et al. (2001). TBX1 is responsible for cardiovascular defects in velo-cardio- facial/DiGeorge syndrome. Cell 104, 619-629.[Medline]
Meyers, E. N. and Martin, G. R. (1999). Differences in left-right axis pathways in mouse and chick: functions of FGF8 and SHH. Science 285, 403-406.
Meyers, E. N., Lewandoski, M. and Martin, G. R. (1998). An Fgf8 mutant allelic series generated by Cre-and Flp-mediated recombination. Nat. Genet. 18, 136-141.[Medline]
Mitchell, P., Timmons, P., Herbert, J., Rigby, P. and Tijan, R. (1991). Transcription factor Ap-2 is exspressed in neural crest cell lineages during mouse embryogenesis. Genes Dev. 5, 105-119.
Mjaatvedt, C. H., Nakaoka, T., Moreno-Rodriguez, R., Norris, R. A., Kern, M. J., Eisenberg, C. A., Turner, D. and Markwald, R. R. (2001). The outflow tract of the heart is recruited from a novel heart-forming field. Dev. Biol. 238, 97-109.[Medline]
Moon, A. M. and Capecchi, M. R. (2000). Fgf8 is required for outgrowth and patterning of the limbs. Nat. Genet. 26, 455-459.[Medline]
Neubuser, A., Peters, H., Balling, R. and Martin, G. R. (1997). Antagonistic interactions between FGF and BMP signaling pathways: a mechanism for positioning the sites of tooth formation. Cell 90, 247-255.[Medline]
Nishibatake, M., Kirby, M. L. and van Mierop, L. H. (1987). Pathogenesis of persistent truncus arteriosus and dextroposed aorta in the chick embryo after neural crest ablation. Circulation 75, 255-264.
Ornitz, D. M. and Itoh, N. (2001). Fibroblast growth factors. Genome Biol. 2, 3005.1-3005.12.
Platt, K. A., Michaud, J. and Joyner, A. L. (1997). Expression of the mouse Gli and Ptc genes is adjacent to embryonic sources of hedgehog signals suggesting a conservation of pathways between flies and mice. Mech. Dev. 62, 121-135.[Medline]
Qiu, M., Bulfone, A., Martinez, S., Meneses, J. J., Shimamura, K., Pedersen, R. A. and Rubenstein, J. L. (1995). Null mutation of Dlx-2 results in abnormal morphogenesis of proximal first and second branchial arch derivatives and abnormal differentiation in the forebrain. Genes Dev. 9, 2523-2538.
Reifers, F., Walsh, E., Leger, S., Stainier, D. and Brand, M. (2000). Induction and differentiation of the zebrafish heart requires fibroblast growth factor 8 (fgf8/acerebellar). Development 127, 225-235.[Abstract]
Rodriguez-Esteban, C., Tsukui, T., Yonei, S., Magallon, J., Tamura, K. and Izpisua Belmonte, J. C. (1999). The T-box genes Tbx4 and Tbx5 regulate limb outgrowth and identity. Nature 398, 814-818.[Medline]
Schlaeger, T. M., Bartunkova, S., Lawitts, J. A., Teichmann, G., Risau, W., Deutsch, U. and Sato, T. N. (1997). Uniform vascular-endothelial-cell-specific gene expression in both embryonic and adult transgenic mice. Proc Natl Acad Sci USA 94, 3058-3063.
Schneider, R. A., Hu, D., Rubenstein, J. L., Maden, M. and Helms, J. A. (2001). Local retinoid signaling coordinates forebrain and facial morphogenesis by maintaining FGF8 and SHH. Development 128, 2755-2767.
Soriano, P. (1999). Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71.[Medline]
Strong, C. F., Barnett, M. W., Hartman, D., Jones, E. A. and Stott, D. (2000). Xbra3 induces mesoderm and neural tissue in Xenopus laevis. Dev. Biol. 222, 405-419.[Medline]
Sun, X., Meyers, E. N., Lewandoski, M. and Martin, G. R. (1999). Targeted disruption of Fgf8 causes failure of cell migration in the gastrulating mouse embryo. Genes Dev. 13, 1834-1846.
Swiatek, P. J. and Gridley, T. (1993). Perinatal lethality and defects in hindbrain development in mice homozygous for a targeted mutation of the zinc finger gene Krox20. Genes Dev. 7, 2071-2084.
Taddei, I., Morishima, M., Huynh, T. and Lindsay, E. A. (2001). Genetic factors are major determinants of phenotypic variability in a mouse model of the DiGeorge/del22q11 syndromes. Proc. Natl. Acad. Sci. USA 98, 11428-11431.
Thomas, T., Kurihara, H., Yamagishi, H., Kurihara, Y., Yazaki, Y., Olson, E. N. and Srivastava, D. (1998). A signaling cascade involving endothelin-1, dHAND and msx1 regulates development of neural-crest-derived branchial arch mesenchyme. Development 125, 3005-3014.[Abstract]
Trainor, P. A., Ariza-McNaughton, L. and Krumlauf, R. (2002). Role of the isthmus and FGFs in resolving the paradox of neural crest plasticity and prepatterning. Science 295, 1288-1291.
Trumpp, A., Depew, M. J., Rubenstein, J. L., Bishop, J. M. and Martin, G. R. (1999). Cre-mediated gene inactivation demonstrates that FGF8 is required for cell survival and patterning of the first branchial arch. Genes Dev. 13, 3136-3148.
Tucker, A. S., Yamada, G., Grigoriou, M., Pachnis, V. and Sharpe, P. T. (1999). Fgf-8 determines rostral-caudal polarity in the first branchial arch. Development 126, 51-61.[Abstract]
Villanueva, S., Glavic, A., Ruiz, P. and Mayor, R. (2002). Posteriorization by FGF, Wnt and retinoic acid is required for neural crest induction. Dev. Biol. 241, 289-301.[Medline]
Vitelli, F., Morishima, M., Taddei, I., Lindsay, E. A. and Baldini, A. (2002a). Tbx1 mutation causes multiple cardiovascular defects and disrupts neural crest and cranial nerve migratory pathways. Hum. Mol. Genet. 11, 915-922.
Vitelli, F., Taddei, I., Morishima, M., Meyers, E. N., Lindsay, E. A. and Baldini, A. (2002b). A genetic link between Tbx1 and fibroblast growth factor signaling. Development 129, 4605-4611.
Waldo, K. L., Kumiski, D. and Kirby, M. L. (1996). Cardiac neural crest is essential for the persistence rather than the formation of an arch artery. Dev. Dyn. 205, 281-292.[Medline]
Waldo, K. L., Kumiski, D. H., Wallis, K. T., Stadt, H. A., Hutson, M. R., Platt, D. H. and Kirby, M. L. (2001). Conotruncal myocardium arises from a secondary heart field. Development 128, 3179-3188.
Wall, N. A. and Hogan, B. L. (1995). Expression of bone morphogenetic protein-4 (BMP-4), bone morphogenetic protein-7 (BMP-7), fibroblast growth factor-8 (FGF-8) and sonic hedgehog (SHH) during branchial arch development in the chick. Mech. Dev. 53, 383-392.[Medline]
Yamauchi, Y., Abe, K., Mantani, A., Hitoshi, Y., Suzuki, M., Osuzu, F., Kuratani, S. and Yamamura, K. (1999). A novel transgenic technique that allows specific marking of the neural crest cell lineage in mice. Dev. Biol. 212, 191-203.[Medline]
Zucker, R. M., Hunter, E. S., 3rd and Rogers, J. M. (1999). Apoptosis and morphology in mouse embryos by confocal laser scanning microscopy. Methods 18, 473-480.[Medline]
This article has been cited by other articles:
![]() |
T. Nakamura, J. Gulick, M. C. Colbert, and J. Robbins Protein tyrosine phosphatase activity in the neural crest is essential for normal heart and skull development PNAS, July 7, 2009; 106(27): 11270 - 11275. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Hoffmann, M. A. Peterson, J. M. Friedland-Little, S. A. Anderson, and I. P. Moskowitz sonic hedgehog is required in pulmonary endoderm for atrial septation Development, May 15, 2009; 136(10): 1761 - 1770. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Rochais, K. Mesbah, and R. G. Kelly Signaling Pathways Controlling Second Heart Field Development Circ. Res., April 24, 2009; 104(8): 933 - 942. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Goldmuntz, S. Woyciechowski, D. Renstrom, P. J. Lupo, and L. E. Mitchell Variants of Folate Metabolism Genes and the Risk of Conotruncal Cardiac Defects Circ Cardiovasc Genet, December 1, 2008; 1(2): 126 - 132. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Newbern, J. Zhong, R. S. Wickramasinghe, X. Li, Y. Wu, I. Samuels, N. Cherosky, J. C. Karlo, B. O'Loughlin, J. Wikenheiser, et al. Mouse and human phenotypes indicate a critical conserved role for ERK2 signaling in neural crest development PNAS, November 4, 2008; 105(44): 17115 - 17120. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-P. Chang, K. Stankunas, C. Shang, S.-C. Kao, K. Y. Twu, and M. L. Cleary Pbx1 functions in distinct regulatory networks to pattern the great arteries and cardiac outflow tract Development, November 1, 2008; 135(21): 3577 - 3586. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Park, Y. Watanabe, G. Smyth, S. Miyagawa-Tomita, E. Meyers, J. Klingensmith, T. Camenisch, M. Buckingham, and A. M. Moon An FGF autocrine loop initiated in second heart field mesoderm regulates morphogenesis at the arterial pole of the heart Development, November 1, 2008; 135(21): 3599 - 3610. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Goddeeris, S. Rho, A. Petiet, C. L. Davenport, G. A. Johnson, E. N. Meyers, and J. Klingensmith Intracardiac septation requires hedgehog-dependent cellular contributions from outside the heart Development, May 15, 2008; 135(10): 1887 - 1895. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ryckebusch, Z. Wang, N. Bertrand, S.-C. Lin, X. Chi, R. Schwartz, S. Zaffran, and K. Niederreither Retinoic acid deficiency alters second heart field formation PNAS, February 26, 2008; 105(8): 2913 - 2918. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-L. Laugwitz, A. Moretti, L. Caron, A. Nakano, and K. R. Chien Islet1 cardiovascular progenitors: a single source for heart lineages? Development, January 15, 2008; 135(2): 193 - 205. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Snarr, J. L. O'Neal, M. R. Chintalapudi, E. E. Wirrig, A. L. Phelps, S. W. Kubalak, and A. Wessels Isl1 Expression at the Venous Pole Identifies a Novel Role for the Second Heart Field in Cardiac Development Circ. Res., November 9, 2007; 101(10): 971 - 974. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Rizzoti and R. Lovell-Badge SOX3 activity during pharyngeal segmentation is required for craniofacial morphogenesis Development, October 1, 2007; 134(19): 3437 - 3448. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Smolen, B. J. Schott, R. A. Stewart, S. Diederichs, B. Muir, H. L. Provencher, A. T. Look, D. C. Sgroi, R. T. Peterson, and D. A. Haber A Rap GTPase interactor, RADIL, mediates migration of neural crest precursors Genes & Dev., September 1, 2007; 21(17): 2131 - 2136. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. S. Hakim, L. A. DiMichele, J. T. Doherty, J. W. Homeister, H. E. Beggs, L. F. Reichardt, R. J. Schwartz, J. Brackhan, O. Smithies, C. P. Mack, et al. Conditional Deletion of Focal Adhesion Kinase Leads to Defects in Ventricular Septation and Outflow Tract Alignment Mol. Cell. Biol., August 1, 2007; 27(15): 5352 - 5364. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wagner and M. A. Q. Siddiqui Signal Transduction in Early Heart Development (I): Cardiogenic Induction and Heart Tube Formation Experimental Biology and Medicine, July 1, 2007; 232(7): 852 - 865. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lin, L. Cui, W. Zhou, D. Dufort, X. Zhang, C.-L. Cai, L. Bu, L. Yang, J. Martin, R. Kemler, et al. beta-Catenin directly regulates Islet1 expression in cardiovascular progenitors and is required for multiple aspects of cardiogenesis PNAS, May 29, 2007; 104(22): 9313 - 9318. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Goddeeris, R. Schwartz, J. Klingensmith, and E. N. Meyers Independent requirements for Hedgehog signaling by both the anterior heart field and neural crest cells for outflow tract development Development, April 15, 2007; 134(8): 1593 - 1604. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Riley, M. A. Mansilla, J. Ma, S. Daack-Hirsch, B. S. Maher, L. M. Raffensperger, E. T. Russo, A. R. Vieira, C. Dode, M. Mohammadi, et al. Impaired FGF signaling contributes to cleft lip and palate PNAS, March 13, 2007; 104(11): 4512 - 4517. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Fagman, J. Liao, J. Westerlund, L. Andersson, B.E. Morrow, and M. Nilsson The 22q11 deletion syndrome candidate gene Tbx1 determines thyroid size and positioning Hum. Mol. Genet., February 1, 2007; 16(3): 276 - 285. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamazaki, M. Tsuneto, M. Yoshino, K.-I. Yamamura, and S.-I. Hayashi Potential of Dental Mesenchymal Cells in Developing Teeth Stem Cells, January 1, 2007; 25(1): 78 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Aggarwal, J. Liao, A. Bondarev, T. Schimmang, M. Lewandoski, J. Locker, A. Shanske, M. Campione, and B. E. Morrow Dissection of Tbx1 and Fgf interactions in mouse models of 22q11DS suggests functional redundancy Hum. Mol. Genet., November 1, 2006; 15(21): 3219 - 3228. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Stock, W. R. Jackman, and J. Trapani Developmental genetic mechanisms of evolutionary tooth loss in cypriniform fishes Development, August 15, 2006; 133(16): 3127 - 3137. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. von Scheven, L. E. Alvares, R. C. Mootoosamy, and S. Dietrich Neural tube derived signals and Fgf8 act antagonistically to specify eye versus mandibular arch muscles Development, July 15, 2006; 133(14): 2731 - 2745. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Franco FGF signalling in the cardiac fields Cardiovasc Res, July 1, 2006; 71(1): 1 - 3. [Full Text] [PDF] |
||||
![]() |
A. Marguerie, F. Bajolle, S. Zaffran, N. A. Brown, C. Dickson, M. E. Buckingham, and R. G. Kelly Congenital heart defects in Fgfr2-IIIb and Fgf10 mutant mice Cardiovasc Res, July 1, 2006; 71(1): 50 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Park, L. A. Ogden, A. Talbot, S. Evans, C.-L. Cai, B. L. Black, D. U. Frank, and A. M. Moon Required, tissue-specific roles for Fgf8 in outflow tract formation and remodeling Development, June 15, 2006; 133(12): 2419 - 2433. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ilagan, R. Abu-Issa, D. Brown, Y.-P. Yang, K. Jiao, R. J. Schwartz, J. Klingensmith, and E. N. Meyers Fgf8 is required for anterior heart field development Development, June 15, 2006; 133(12): 2435 - 2445. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Storm, S. Garel, U. Borello, J. M. Hebert, S. Martinez, S. K. McConnell, G. R. Martin, and J. L. R. Rubenstein Dose-dependent functions of Fgf8 in regulating telencephalic patterning centers Development, May 1, 2006; 133(9): 1831 - 1844. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. DiNapoli, J. Batchvarov, and B. Capel FGF9 promotes survival of germ cells in the fetal testis Development, April 15, 2006; 133(8): 1519 - 1527. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Arnold, U. Werling, E. M. Braunstein, J. Liao, S. Nowotschin, W. Edelmann, J. M. Hebert, and B. E. Morrow Inactivation of Tbx1 in the pharyngeal endoderm results in 22q11DS malformations Development, March 1, 2006; 133(5): 977 - 987. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, F. Cerrato, H. Xu, F. Vitelli, M. Morishima, J. Vincentz, Y. Furuta, L. Ma, J. F. Martin, A. Baldini, et al. Tbx1 expression in pharyngeal epithelia is necessary for pharyngeal arch artery development Development, December 1, 2005; 132(23): 5307 - 5315. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kawauchi, J. Shou, R. Santos, J. M. Hebert, S. K. McConnell, I. Mason, and A. L. Calof Fgf8 expression defines a morphogenetic center required for olfactory neurogenesis and nasal cavity development in the mouse Development, December 1, 2005; 132(23): 5211 - 5223. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. A. Stennard and R. P. Harvey T-box transcription factors and their roles in regulatory hierarchies in the developing heart Development, November 15, 2005; 132(22): 4897 - 4910. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ishii, J. Han, H.-Y. Yen, H. M. Sucov, Y. Chai, and R. E. Maxson Jr Combined deficiencies of Msx1 and Msx2 cause impaired patterning and survival of the cranial neural crest Development, November 15, 2005; 132(22): 4937 - 4950. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Groves, C. L. Hammond, and S. M. Hughes Fgf8 drives myogenic progression of a novel lateral fast muscle fibre population in zebrafish Development, October 1, 2005; 132(19): 4211 - 4222. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. O. Perantoni, O. Timofeeva, F. Naillat, C. Richman, S. Pajni-Underwood, C. Wilson, S. Vainio, L. F. Dove, and M. Lewandoski Inactivation of FGF8 in early mesoderm reveals an essential role in kidney development Development, September 1, 2005; 132(17): 3859 - 3871. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Epstein and M. S. Parmacek Recent Advances in Cardiac Development With Therapeutic Implications for Adult Cardiovascular Disease Circulation, July 26, 2005; 112(4): 592 - 597. [Full Text] [PDF] |
||||
![]() |
R. D. Knight, Y. Javidan, T. Zhang, S. Nelson, and T. F. Schilling AP2-dependent signals from the ectoderm regulate craniofacial development in the zebrafish embryo Development, July 1, 2005; 132(13): 3127 - 3138. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Vincent, N. R. Dunn, R. Sciammas, M. Shapiro-Shalef, M. M. Davis, K. Calame, E. K. Bikoff, and E. J. Robertson The zinc finger transcriptional repressor Blimp1/Prdm1 is dispensable for early axis formation but is required for specification of primordial germ cells in the mouse Development, March 15, 2005; 132(6): 1315 - 1325. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Nichols and T. L. Creazzo L-type Ca2+ channel function in the avian embryonic heart after cardiac neural crest ablation Am J Physiol Heart Circ Physiol, March 1, 2005; 288(3): H1173 - H1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Crump, L. Maves, N. D. Lawson, B. M. Weinstein, and C. B. Kimmel An essential role for Fgfs in endodermal pouch formation influences later craniofacial skeletal patterning Development, November 15, 2004; 131(22): 5703 - 5716. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hu, H. Yamagishi, J. Maeda, J. McAnally, C. Yamagishi, and D. Srivastava Tbx1 regulates fibroblast growth factors in the anterior heart field through a reinforcing autoregulatory loop involving forkhead transcription factors Development, November 1, 2004; 131(21): 5491 - 5502. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Mrass, M. Rendl, M. Mildner, F. Gruber, B. Lengauer, C. Ballaun, L. Eckhart, and E. Tschachler Retinoic Acid Increases the Expression of p53 and Proapoptotic Caspases and Sensitizes Keratinocytes to Apoptosis: A Possible Explanation for Tumor Preventive Action of Retinoids Cancer Res., September 15, 2004; 64(18): 6542 - 6548. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sock, S. D. Rettig, J. Enderich, M. R. Bosl, E. R. Tamm, and M. Wegner Gene Targeting Reveals a Widespread Role for the High-Mobility-Group Transcription Factor Sox11 in Tissue Remodeling Mol. Cell. Biol., August 1, 2004; 24(15): 6635 - 6644. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Kaartinen, M. Dudas, A. Nagy, S. Sridurongrit, M. M. Lu, and J. A. Epstein Cardiac outflow tract defects in mice lacking ALK2 in neural crest cells Development, July 15, 2004; 131(14): 3481 - 3490. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Stottmann, M. Choi, Y. Mishina, E. N. Meyers, and J. Klingensmith BMP receptor IA is required in mammalian neural crest cells for development of the cardiac outflow tract and ventricular myocardium Development, May 1, 2004; 131(9): 2205 - 2218. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Creuzet, B. Schuler, G. Couly, and N. M. Le Douarin From the Cover: Reciprocal relationships between Fgf8 and neural crest cells in facial and forebrain development PNAS, April 6, 2004; 101(14): 4843 - 4847. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Gruber and J. A. Epstein Development Gone Awry: Congenital Heart Disease Circ. Res., February 20, 2004; 94(3): 273 - 283. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zakin and E. M. De Robertis Inactivation of mouse Twisted gastrulation reveals its role in promoting Bmp4 activity during forebrain development Development, January 15, 2004; 131(2): 413 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Macatee, B. P. Hammond, B. R. Arenkiel, L. Francis, D. U. Frank, and A. M. Moon Ablation of specific expression domains reveals discrete functions of ectoderm- and endoderm-derived FGF8 during cardiovascular and pharyngeal development Development, December 22, 2003; 130(25): 6361 - 6374. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Dupe, N. Matt, J.-M. Garnier, P. Chambon, M. Mark, and N. B. Ghyselinck A newborn lethal defect due to inactivation of retinaldehyde dehydrogenase type 3 is prevented by maternal retinoic acid treatment PNAS, November 25, 2003; 100(24): 14036 - 14041. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Wright and S. L. Mansour Fgf3 and Fgf10 are required for mouse otic placode induction Development, August 1, 2003; 130(15): 3379 - 3390. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bachiller, J. Klingensmith, N. Shneyder, U. Tran, R. Anderson, J. Rossant, and E. M. De Robertis The role of chordin/Bmp signals in mammalian pharyngeal development and DiGeorge syndrome Development, August 1, 2003; 130(15): 3567 - 3578. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Niederreither, J. Vermot, I. L. Roux, B. Schuhbaur, P. Chambon, and P. Dolle The regional pattern of retinoic acid synthesis by RALDH2 is essential for the development of posterior pharyngeal arches and the enteric nervous system Development, June 1, 2003; 130(11): 2525 - 2534. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Packham and J. D. Brook T-box genes in human disorders Hum. Mol. Genet., April 2, 2003; 12(90001): R37 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Vermot, K. Niederreither, J.-M. Garnier, P. Chambon, and P. Dolle Decreased embryonic retinoic acid synthesis results in a DiGeorge syndrome phenotype in newborn mice PNAS, February 18, 2003; 100(4): 1763 - 1768. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamagishi, J. Maeda, T. Hu, J. McAnally, S. J. Conway, T. Kume, E. N. Meyers, C. Yamagishi, and D. Srivastava Tbx1 is regulated by tissue-specific forkhead proteins through a common Sonic hedgehog-responsive enhancer Genes & Dev., January 15, 2003; 17(2): 269 - 281. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Vitelli, I. Taddei, M. Morishima, E. N. Meyers, E. A. Lindsay, and A. Baldini A genetic link between Tbx1 and fibroblast growth factor signaling Development, January 10, 2002; 129(19): 4605 - 4611. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||