|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
UMR 7009 CNRS, Université de Paris VI, Observatoire Oceanologique, 06230 Villefranche-sur-Mer, France
* Author for correspondence (e-mail: lepage{at}obs-vlfr.fr)
Accepted 30 July 2002
| SUMMARY |
|---|
|
|
|---|
Key words: mezzo, Homeobox, Nodal signalling, Endoderm, Mesoderm, sox17, ntl, casanova, faust, mixer, Zebrafish
| INTRODUCTION |
|---|
|
|
|---|
In addition to maternal ligands, receptors and transducers, several zygotic
transcription factors induced by Nodal signalling have been identified as key
regulators of endoderm development. These include the Mix-like homeobox
protein Bon/Mixer; the product of the bonnie and clyde gene
(bon/mixer); the zinc finger-containing factor Gata5, which is
encoded by the faust gene; and the Sox-related gene Casanova.
mixer was originally described in Xenopus as a gene able to
activate sox17 gene expression in presumptive ectodermal cells when
overexpressed (Henry and Melton,
1998
). The C-terminal region of Xenopus Mixer contains a
SIM domain required for interaction with phosphorylated Smads suggesting that
Mixer, like FoxH1/Fast1 can cooperate with Smads to transduce Nodal signals.
Unlike mixer in Xenopus, bon transcripts in zebrafish are
broadly expressed in the marginal region, which contains mesodermal as well as
endodermal precursors. bonnie and clyde mutant embryos display a
reduced number of cells expressing endodermal markers during gastrulation and
later lack a functional gut tube. Therefore, despite the broad early
expression of bon/mixer in presumptive mesoderm and endoderm, only
endodermal tissues are affected in bon mutants. faust
mutants, which have a disrupted gata5 gene, also have a reduced
number of sox17-positive cells and are affected in endoderm
formation, although the faust mutant phenotype is weaker than the
bon mutant phenotype. Mutant embryos that lack the product of the
casanova gene (cas) have the most severe defects regarding
endoderm formation and completely lack sox17 expression during
gastrulation. Ectopic expression of faust/gata5, bon/mixer or
casanova can upregulate sox17 expression in mutants with an
attenuated Nodal signalling pathway (Zoep), demonstrating that
bon, faust and cas are upstream regulators of
sox17. However, only casanova mRNA can induce sox17
in mutants with a completely inactive Nodal signalling pathway
(MZoep) (Kikuchi et al.,
2001
; Aoki et al.,
2002a
). The levels of bon/mixer or faust
transcripts are normal in a casanova mutant background
(Alexander et al., 1999
;
Reiter et al., 2001
). By
contrast, expression of casanova is greatly reduced in bon
or faust mutants embryos (Kikuchi
et al., 2001
; Aoki et al.,
2002a
). In addition, TARAM-A, bon and faust all
require the function of casanova in order to turn on sox17.
Based on this set of observations it has been hypothesised that Bon and
Faust/Gata5 act either upstream of or in parallel with Casanova, and that
Casanova is the most critical regulator of sox17.
Several lines of evidence suggest that in addition to bon/mixer
and faust/gata5, other unidentified factors induced by Nodal
signalling are involved in the regulation of casanova expression
(Alexander et al., 1999
;
Kikuchi et al., 2000
;
Kikuchi et al., 2001
;
Reiter et al., 2001
;
Aoki et al., 2002a
). First,
bon or faust single mutants as well as bon;faust
double mutants embryos still have residual expression of casanova and
sox17. Moreover, overexpression of faust or bon
alone or in combination is not sufficient to cause ectopic expression of
casanova outside the margin and does not restore significant
sox17 expression in cyclops;squint mutants. This suggests
that another factor normally present at the margin is required to induce
sox17 and is lost in Nodal mutants
(Kikuchi et al., 2000
;
Kikuchi et al., 2001
).
Finally, neither bon nor faust mRNAs are able to induce
sox17 or casanova in MZoep embryos. All these
observations have led Alexander et al. and Aoki et al. to postulate the
existence of an unknown factor induced by Nodal signals at the margin of the
blastoderm, which would act at the same level as bon and
faust, and would be a positive regulator of casanova
expression.
We report the identification of a novel paired-like homeobox protein named Mezzo, which may be the missing factor described above. Mezzo is related to the Mix-like/Mixer homeoproteins and like bon/mixer, mezzo is expressed transiently during zebrafish development. Moreover, we show that mezzo transcripts are restricted to mesendoderm precursors during gastrulation and can be induced by activation of the Nodal/TARAM-A signalling pathway. By analysing the expression of mezzo in various mutants with attenuated or completely defective Nodal signalling, we show that activation and maintenance of this gene strictly depend on a functional Nodal signalling pathway. By expressing a constitutively active form of the TARAM-A receptor in the presence of translation inhibitors we have further demonstrated that mezzo, bon/mixer and casanova are all immediate early targets of Nodal signalling, while sox17 is not. Overexpression of mezzo mRNA can induce ectopic expression of casanova and sox17 and can also turn on the pan mesodermal marker gene ntl. We show that the function of mezzo is redundant with that of mixer. mezzo mRNA can partially rescue bon mutants, and when the function of mezzo and bon/mixer is inhibited, embryos develop without any sox17 expression and fail to form prechordal plate mesoderm, a phenotype that suggests a further reduction of Nodal signalling.
These results place mezzo as a new transcription factor with unique properties acting in parallel with bonnie and clyde, faust and casanova in the Nodal signalling pathway controlling specification of mesoderm and endoderm in zebrafish.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Zebrafish strains, embryo manipulation, cycloheximide treatments
Adult zebrafish were maintained at 28.5°C using standard procedures
(Westerfield, 1994
). Wild-type
embryos were collected by natural spawning from the AB strain. Mutant embryos
were obtained by intercrossing heterozygous carrier fish identified by random
crossing. We used the following mutant alleles: one-eyed pinhead,
oepm134 (Schier et al.,
1997
), cyclopsb16
(Hatta et al., 1991
),
squintcz35 (Feldman et
al., 1998
), fausttm236a
(Chen et al., 1996
), bonnie
and clydem425 (Kikuchi et
al., 2000
), casanovata56
(Chen et al., 1996
), no
tailc41b (Odenthal et al.,
1996
) and schmalspurm768
(Pogoda et al., 2000
).
Note that oepm134 which causes a truncation in the C-terminal hydrophobic domain of the protein, is not a null mutation.
cyclops;squint double mutant carriers were identified by backcross
in the progeny of a cross between identified cyclops and identified
squint fish. As expected, one sixteenth of the embryos produced by
intercrossing cyc;sqt carriers displayed the typical double mutant
phenotype (Feldman et al.,
1998
). Adult MZoep and MZsquint fish were a
generous gift of Frederic Rosa and adult MZsur fish were kindly
provided by Dirk Meyer. bonm425 embryos were genotyped
following the procedure published by Kikuchi et al.
(Kikuchi et al., 2000
).
In protein synthesis inhibition experiments, cycloheximide was added to dechorionated embryos at the 64- to 128-cell stage at a final concentration of 50 µg/ml. Cleavage in the treated embryos was usually arrested before the 512-cell stage, an indication of the effectiveness of the translation inhibitor.
RNA and oligonucleotides microinjection
For overexpression studies, the coding sequence of mezzo was
amplified by PCR using the Pfu DNA polymerase and inserted at the
ClaI-XbaI sites of pCS2+
(Turner and Weintraub, 1994
)
to generate pCS2-mezzo. Capped mRNA was synthesised from a template
linearized with Asp718 using the SP6 mMessage mMachine kit (Ambion). Capped
RNA encoding Antivin, TARAM-A*, GFP and NLS ß-Gal were
synthesised as described (Peyrieras et
al., 1998
; Thisse and Thisse,
1999
; Faucourt et al.,
2001
). After synthesis, all the capped RNAs were purified on
Sephadex G50 columns and quantitated by spectrophotometry.
In control experiments where morpholino oligonucleotides were co-injected with RNA containing the 5' UTR region of mezzo, both reagents were mixed together and co-injected.
In situ hybridisation
In situ hybridisation was performed following a protocol adapted from
Harland (Harland, 1991
) with
antisense RNA probes and staged embryos. All the riboprobes were used
following published protocols.
Radiation hybrid mapping
mezzo was mapped on the LN54 radiation hybrid panel
(Hukriede et al., 2001
;
Hukriede et al., 1999
) using
the primers 5' CAGCAACCAATCCCGATTTA 3' and 5'
CAGAGCTTCCTCCAAACTGC 3'.
| RESULTS |
|---|
|
|
|---|
|
mezzo encodes a homeodomain protein related to the Sebox and
Mixer homeoproteins
Analysis of the mezzo transcript sequence revealed an 879 bp
single long open reading frame (ORF) (Fig.
1). Starting at the second ATG (see legend of
Fig. 1B for a justification of
the choice of the initiator codon), the open reading frame is predicted to
encode a protein of 293 amino acids. A comparison of the predicted Mezzo
protein sequence with other protein sequences present in the PIR NBRF and
Swiss Prot databases revealed significant but modest similarities with several
other paired-like homeoproteins. The highest similarity was found
with the human Sebox (E: 7e-15) and mouse OG9 (E: 4e-13)
proteins (Cinquanta et al.,
2000
). An alignment of these three proteins is shown in
Fig. 1A. This alignment shows
that the human and mouse proteins are more related one to the other (63%
identities) than to Mezzo (32% identities). Moreover, the Mezzo protein (293
amino acids) is significantly longer than the human Sebox (221 amino acids)
and mouse OG9 proteins (190 amino acids). Outside the homeodomain, Mezzo and
Sebox share limited sequence homology, sequence conservation being found only
in the last 25 amino acids. This low conservation between two vertebrate
sequences indicates that these genes, while clearly related, are probably not
orthologues. When the comparison was limited to the homeodomain region, the
highest scores were obtained with the Mix-like (Mml) protein from mouse
(Pearce and Evans, 1999
) and
the Mix1 protein from Xenopus (68% identity)
(Rosa, 1989
)
(Fig. 1C). Slightly lower
scores were obtained for the CMIX factor from chick (62% identity)
(Peale et al., 1998
;
Stein et al., 1998
), the
zebrafish Mixer/Bonnie and Clyde protein (58% identity)
(Alexander et al., 1999
), and
the mouse Sebox/OG9 (57% identity). The C-terminal region of Mezzo does not
contain any sequence resembling the acidic domain or the PPNK core sequence
present in the Smad interacting motif (SIM) of some Mix-like factors
(Germain et al., 2000
). Mezzo
therefore represents a divergent member of the Mix-like subclass of
homeoproteins. The C-terminal region of Mezzo is rich in proline (11%) and
serine (13%), two amino acids frequently found in the activator domains of
transcription factors.
Southern analysis revealed that the mezzo gene is very likely to
be a single copy gene (data not shown), while analysis of genomic DNA showed
that the mezzo locus encompasses about 10 kb of sequence in zebrafish
and consists of four exons and three introns. The intron-exon organisation of
the mezzo gene is depicted in Fig.
1D. As for many members of the paired-like class of
homeobox genes, the homeodomain of Mezzo is encoded by two exons separated by
an intron in position 44 of the homeodomain
(Duboule, 1994
). The
mezzo gene was mapped using the radiation hybrid mapping method using
the LN54 mapping pannel (Hukriede et al.,
1999
). The mezzo locus resides on linkage group 5, 0.4 cR
from coe2.
mezzo expression is restricted to the mesendoderm precursors
during gastrulation
The spatial expression of mezzo was analysed by in situ
hybridisation on staged embryos. mezzo transcripts were first
detected by this technique at sphere stage (4 hours) in a small group of cells
at the margin of the blastoderm (Fig.
2A,F). As epiboly started, the expression domain of mezzo
extended over the whole circumference of the margin of the blastoderm
(Fig. 2B,G). Expression of
mezzo was restricted to the blastoderm and no expression was detected
in the yolk syncytial layer. A high magnification view of embryos labelled at
50% epiboly shows that the expression domain of mezzo extends over
six rows of cells, that is over a region that includes the precursors of
mesoderm and endoderm (Fig.
2C,H) (Kimmel et al.,
1990
; Warga and
Nusslein-Volhard, 1999
). At the shield stage, mezzo
transcripts are also expressed in the invaginating axial mesendoderm
(Fig. 2D,I). After the shield
stage, the abundance of the mezzo transcripts declined abruptly, only
a weak expression is detected in embryos at 60% epiboly and no expression at
70% epiboly or later (Fig.
2E,J). The mezzo gene is therefore expressed zygotically
during zebrafish development. The early and transient nature of mezzo
expression was confirmed by northern blot and RT-PCR and no transcripts were
detected in RNA extracted from 4-day-old embryos or from adult fish (data not
shown).
|
The temporal and spatial expression profiles of mezzo are similar
to those of bon/mixer (Fig.
2K-O) (Alexander et al.,
1999
; Kikuchi et al.,
2000
), which has been shown to be regulated by Nodal
signalling.
mezzo expression is regulated by a TARAM-A/antivin
signalling pathway
To determine if mezzo expression is dependent on the Nodal
signalling pathway, we made use of TARAM-A*, a constitutively
activated form of a type I TGFß receptor presumed to be a receptor for
the Nodal factors (Renucci et al.,
1996
; Peyrieras et al.,
1998
; Aoki et al.,
2002b
). We injected mRNA encoding TARAM-A* into one
blastomere of embryos at the eight-cell stage together with mRNA encoding a
nuclear ß-Gal as a lineage tracer. Injected embryos were allowed to
develop up to the 50% epiboly then were fixed in order to analyse the
expression of mezzo. In addition to the normal expression of
mezzo at the margin of the blastoderm, mezzo expression was
strongly induced in the clones of cells inheriting
TARAM-A* RNA (Fig.
3B). To inhibit the Nodal signalling pathway, we overexpressed
antivin, a potent antagonist of Nodal and Activin in zebrafish
(Bisgrove et al., 1999
;
Thisse and Thisse, 1999
).
Injection of mRNA encoding Antivin into embryos at the one- to two-cell stage
drastically reduced the level of mezzo expression at the onset of
gastrulation (Fig. 3C). These
experiments suggest that mezzo, like the other genes acting early in
endoderm specification, is regulated by a TGF-ß signalling pathway.
|
Analysis of mezzo expression in mutants of the Nodal
signalling pathway
To confirm the results above indicating that the Nodal signalling pathway
regulates expression of the mezzo gene, we examined mezzo
expression in various mutants with attenuated or completely defective Nodal
signalling (Fig. 4;
Table 1). We first analysed the
level of mezzo transcripts in embryos carrying mutations in the
cyclops, squint and oep genes, which act early in the Nodal
pathway. In cyclops mutants embryos, mezzo expression was
indistinguishable from control embryos (data not shown). By contrast, in
squint mutant embryos, the expression domain of mezzo was
thinner along the animal-vegetal axis and displayed a gap
(Fig. 4C,I). A similar gap in
the expression domain of mezzo was also observed in embryos lacking
zygotic transcripts of oep (Fig.
4B,H). Double labelling experiments using a probe for the
chordin gene, which is still expressed in the dorsal marginal zone in
absence of Nodal signalling (Gritsman et
al., 1999
) showed that this gap corresponds to the dorsal side of
the margin where the squint ligand is expressed (data not shown). We
then looked at mezzo expression in cyc;sqt double mutant
embryos. In the progeny of crosses between double heterozygotes
cyc;sqt, we found that 21% of the embryos showed a dorsal gap in the
expression domain of mezzo, while 8% had a barely detectable
expression (Fig. 4D,J). From
the frequency of occurrence of these phenotypic classes, we infer that embryos
displaying a dorsal gap are the single squint mutants (3/16th) while
embryos displaying largely absent mezzo expression are the double
mutants (1/16th). Similarly, we found that mezzo expression was
variably affected in schmalspur (MZsur), the variation
correlating with the strength of the MZsur phenotype
(Fig. 4E,K). Two maternal genes
implicated in Nodal signalling (oep and schmalspur) are thus
critically required for normal expression of mezzo.
|
|
To determine if the zygotic genes acting more downstream in the signalling pathway are similarly required, we analysed the expression of mezzo in embryos carrying mutations in the bonnie and clyde, faust, casanova and ntl genes. In all these single mutant backgrounds, expression of mezzo appeared to be normal, suggesting that mezzo is not a downstream target of these zygotic transcription factors. Expression of mezzo in faust;cas double mutant embryos was also indistinguishable from that of control embryos, further indicating that cas does not participate in the regulation of mezzo expression. By contrast, we found that 6% of the embryos derived from a cross between bon;faust double heterozygotes displayed a significant reduction of mezzo expression over half of the circumference of the blastoderm (Fig. 4F,L). This result indicates that, while bon and faust are not individually required for mezzo expression, removing the function of bon and faust does significantly reduce mezzo expression.
Taken together, our analyses of mezzo expression in mutant embryos suggest that transcription of the mezzo gene may be activated by maternal transcription factors in response to Nodal signalling and that Bon/Mixer and GATA5 are subsequently required for sustained expression of this gene.
mezzo, bon/mixer and casanova are immediate early
targets of nodal signalling
Analysis of the temporal expression of mezzo, bon/mixer, casanova
or sox17 shows that all four genes start to be expressed
approximately at the same time, sox17 appearing slightly after the
others (Alexander and Stainier,
1999
; Rodaway et al.,
1999
; Kikuchi et al.,
2000
; Reiter et al.,
2001
; Aoki et al.,
2002b
). Epistasis experiments have revealed that sox17
probably acts downstream of bon/mixer, faust and casanova
during endoderm formation; however, it is not clear whether casanova
acts downstream of or in parallel to bon/mixer and faust
(Alexander and Stainier, 1999
;
Reiter et al., 2001
;
Aoki et al., 2002a
;
Stainier, 2002
). We tested
whether mezzo, bon/mixer, sox17 and casanova are transcribed
in immediate response to Nodal signalling or if their transcription requires
protein synthesis. To achieve this, we injected TARAM-A*
into one- to four-cell stage embryos, then treated the injected embryos with
the protein synthesis inhibitor cycloheximide (CHX) at the 64- to
128-cell-stage and analysed expression of the different genes by in situ
hybridisation at the dome stage. As a control in this experiment, we measured
the expression of no tail (ntl), which has already been
shown to be an immediate early target gene of Nodal signalling in zebrafish
(Vogel and Gerster, 1999
).
Injection of TARAM-A* induced very robust expression of
sox17, ntl, mezzo, bon/mixer and casanova in large patches
of cells (Fig. 5C,H,M,R, data
obtained with mixer are similar to those obtained with mezzo
and are not shown here). By contrast, the response of these different genes
after TARAM-A* injection in the presence of translation
inhibitors was quite different. Ectopic expression of sox17 was
largely suppressed by CHX as expected for a gene acting downstream of
casanova, bon/mixer and faust
(Fig. 5D,E). By contrast,
mezzo (Fig. 5N,O),
casanova (Fig. 5S,T)
and bon/mixer transcripts were clearly detectable after inhibition of
protein synthesis and all three genes behaved in the same manner as the
immediate target gene ntl (Fig.
5I,J).
|
From this experiment, we conclude that transcription of mezzo, bon/mixer and casanova in response to Nodal signalling is probably activated directly by maternal factors. By contrast, sox17 expression is completely dependent on zygotic factors, in agreement with the previous finding that Casanova is necessary for sox17 expression.
Overexpression of mezzo induces ectopic expression of
casanova, sox17 and no tail
To test the role of mezzo in germ layer specification, we
overexpressed it in early zebrafish embryos. Synthetic mRNAs encoding Mezzo or
GFP were microinjected into cleavage stage embryos at the two- to 16-cell
stage and the effects were analysed at the morphological and molecular level.
Embryos injected with 100 pg of GFP mRNA or with low doses (1-5 pg) of
mezzo mRNA developed just like control uninjected embryos.
Developmental defects were observed with higher doses of mezzo
(50-100 pg) and included reduced convergence and extension movements of the
dorsal mesoderm during gastrulation, leading to later defects in neural tube
closure. Overexpression of mezzo was also associated with defects in
patterning of the axial mesoderm, as evidenced by the presence of U-shaped
somites and kinked notochords. More rarely, outgrowths of tissues often
located in the trunk and tail regions, were also observed but head development
was largely normal (data not shown).
To determine whether the observed morphological defects were the
consequence of earlier defects in formation of the mesoderm and endoderm, we
examined the expression of early endodermal and mesodermal marker genes in the
injected embryos. We injected synthetic mRNA encoding Mezzo into eight- or
16-cell stage embryos and analysed at shield stage the expression of
sox17 and casanova (Fig.
6). We found that overexpression of mezzo mRNA induced
strong ectopic expression of sox17 and casanova across the
animal hemisphere (Fig.
6B,D,E,F). The animal cells ectopically expressing sox17
or casanova did not seem to contribute to the hypoblast but remained
in a superficial position in the epiblast. Similar observations have been
reported in previous studies on casanova and bon
(David and Rosa, 2001
;
Kikuchi et al., 2001
;
Aoki et al., 2002a
). The
ability of mezzo RNA to induce ectopic expression of endodermal
markers in presumptive ectodermal cells is remarkable as bon/mixer
RNA is apparently not able to induce sox17 expression outside the
margin (Alexander and Stainier,
1999
; Kikuchi et al.,
2000
).
|
To test the ability of mezzo to promote the expression of
endodermal marker genes in embryos in which the Nodal signalling pathway is
completely inactive, we microinjected mezzo mRNA into embryos derived
from MZoep mothers. In the absence of maternal and zygotic
oep transcripts, cells are unable to respond to Nodal signals and the
expression of endodermal markers genes is abolished
(Fig. 6C) (Alexander et al., 1999
;
Gritsman et al., 1999
;
Kikuchi et al., 2000
). By
contrast, all the injected embryos clearly showed ectopic expression of
sox17 (Fig. 6G),
indicating that mezzo mRNA can partially rescue sox17
expression in MZoep embryos.
Casanova has previously been shown to be largely required for the induction
of sox17 by faust/gata5 and strictly required for the
induction of sox17 by bon/mixer
(Alexander and Stainier, 1999
;
Reiter et al., 2001
;
Aoki et al., 2002a
). We
therefore tested the ability of mezzo mRNA to induce expression of
sox17 in absence of the casanova gene product. Out of 56
injected embryos, 12 (21%) were identified as homozygous cas embryos
by the lack of endogenous sox17 expression in the blastoderm and the
upregulation of this gene in the YSL. Six out of the 12 homozygous embryos
showed weak ectopic expression of sox17 in small patches of cells,
while the other six showed no expression.
(Fig. 6D,H). Overexpression of
mezzo, like overexpression of faust/gata5, can thus activate
low levels of sox17 expression in complete absence of
casanova gene function. Nevertheless, in the normal embryo,
sox17 expression is abolished in the absence of the casanova
gene product. This confirms that Casanova is the most crucial activator of
sox17. It also suggests that, although the sox17 gene may
receive some direct input from Mezzo and Gata5, the main role of Mezzo,
Faust/Gata5 and Bon/Mixer is probably to maintain casanova
transcription.
Taken together, these results strongly suggest that mezzo is indeed a mediator of the Nodal signalling pathway that cooperates with bon/mixer and casanova during endoderm specification.
We next examined whether mezzo could promote the expression of
other downstream targets of the Nodal signalling pathway, and particularly of
mesodermal marker genes such as ntl. We injected mezzo mRNA
into one blastomere of embryos at the eight-cell stage, at doses which induced
ectopic expression of endodermal markers. Out of 163 embryos injected with
mezzo mRNA, 88 (54%) showed an expansion of the ntl
territory compared with control uninjected embryos
(Fig. 7A,B). The remaining
fraction of the injected embryos, however, did not display ectopic
ntl expression but instead showed an interruption in the ring of
marginal ntl expression. Co-injection of ß-gal RNA as a lineage
tracer revealed that when targeted at the margin, high doses of mezzo
mRNA could suppress ntl expression in a cell autonomous manner
(Fig. 7G). To determine if
mesodermal markers were repressed as a consequence of upregulation of
endodermal genes, we performed double in situ hybridisation to detect both
casanova and ntl after injection of mezzo mRNA. We
found that, out of 75 embryos injected into one blastomere at the eight cell
stage, 25 showed marginal clones of cells in which casanova was
overexpressed while ntl expression was simultaneously repressed
(Fig. 7C,H). This result
suggests that ectopic expression of mezzo could repress expression of
ntl at the margin by inducing casanova, consistent with
previous data (Aoki et al.,
2002a
).
|
Similarly, we found that the expression of ntl in the injected embryos at 80% epiboly and during somitogenesis was severely perturbed by mezzo overexpression, leading either to a complete absence of the ntl in part of the marginal region (30%) or to a patchy and broadened marginal and axial expression of ntl (54%) (data not shown). These observations suggest that the developmental defects caused by overexpression of mezzo are the consequences of early patterning defects.
Remarkably, when similar doses of mezzo mRNA were injected into
one internal blastomere of embryos at the 16-cell stage, ectopic ntl
expression was clearly observed near the animal pole in about half of the
injected embryos (n=65) (Fig.
7D,I,J). Thus, mezzo can induce mesodermal markers in
presumptive ectodermal cells. This property distinguishes mezzo from
bon/mixer, which appears to lack mesoderm inducing activity
(Alexander et al., 1999
) (M. P.
and T. L., unpublished).
Inhibition of mezzo function using antisense Morpholino
oligonucleotides
The experiments described above have shown that mezzo is expressed
at the right time and at the right place to be a downstream mediator of Nodal
signalling. Moreover, the results from ectopic expression of mezzo
strongly suggest that this gene is involved in specification of the fate of
mesodermal and endodermal cells. To determine if mezzo function is
required for specification of mesendodermal cells, we used a loss-of-function
approach using antisense morpholino oligonucleotides
(Summerton and Weller, 1997
).
To first test the effectiveness of this approach in the case of
mezzo, we constructed an artificial mRNA where the 5' leader
sequence of mezzo and the sequence coding for the first 43 amino
acids were fused to the coding sequence of the green fluorescent protein to
make (mezzo-GFP mRNA). This mezzo-GFP mRNA was injected in
embryos alone or mixed together with the antisense morpholino directed towards
the 5' end of mezzo (mezzo-MO). An unrelated
morpholino was also injected at various concentrations as a negative control.
All the embryos injected with mezzo-GFP mRNA were brightly
fluorescent when examined at the shield stage
(Fig. 8A) (n>50).
By contrast, embryos co-injected with mezzo-GFP and 12 ng of
mezzo-MO did not show any fluorescence (n>100) when
examined at the same stage indicating that the morpholino oligonucleotides
efficiently reduced translation of the mezzo-GFP mRNA
(Fig. 8F). We then
microinjected this oligonucleotide at various concentrations into wild-type
embryos. Even at high doses (up to 12 ng), injection of mezzo-MO did
not perturb development of the injected embryos and the expression of marker
genes such as ntl and sox17 was normal in these embryos
(data not shown).
|
The lack of effects of mezzo-MO suggested that in wild-type
embryos, another factor was able to compensate for the absence of
mezzo function. To address this possibility, we tested the effects of
inhibiting mezzo function in embryos lacking the activity of various
genes acting in the Nodal pathway (Table
2). We first injected mezzo-MO into embryos derived from
heterozygous squint parents. The squint mutation is
incompletely penetrant and typically 5-15% of the progeny of squint
parents manifests a cyclopic phenotype at 24 hours. We selected pairs of fish
in which the penetrance of the mutation was reproducibly low (near 5%).
Injection of mezzo-MO in the progeny of such fish caused a
significant increase (near 20%) in the percentage of embryos displaying a
cyclopic phenotype (Table 2). A
similar experiment was performed using MZsquint embryos and, again, a
significant increase (from 60% to 100%) in the penetrance of the phenotype was
observed after injection of mezzo-MO. We then extended this analysis
to the oep mutant and to mutants in downstream targets of the Nodal
signalling pathway such as bon, faust and cas. Injection of
mezzo-MO in Zoep, faust and cas mutant backgrounds
increased neither the percentage of mutant embryos nor the severity of the
phenotype. By contrast, injection of mezzo-MO in the progeny of
heterozygous bon parents produced a striking result. About 13% of the
injected embryos showed a cyclopia very similar to that caused by inactivation
of squint or oep (n=262) and most of these cyclopic
embryos also displayed a cardiac phenotype suggesting that only bon
homozygous embryos were affected. We confirmed that the cyclopic embryos were
homozygous bon mutants by determining their genotype by PCR
(Kikuchi et al., 2000
).
Injection of a control antisense MO did not perturb development of the
bon embryos demonstrating that this phenotype was specific to the
mezzo-MO (Fig.
8B).
|
In the case of cyclops, squint or oep mutants,
cyclopia has been correlated with the early loss of goosecoid
(Stachel et al., 1993
;
Thisse et al., 1994
) and later
of hgg1 (Vogel and Gerster,
2000
), two genes expressed in the prechordal mesoderm cells during
and at the end of gastrulation. We analysed the expression of these markers in
embryos derived from bon/+ parents injected with mezzo-MO.
Expression of goosecoid appeared normal in most of the injected
embryos when examined at the shield stage; however, in about 20% of these
embryos, expression of goosecoid was drastically reduced or lost at
70% epiboly (Fig. 8C,H; n=36) in good agreement with the morphological observations.
Similarly, expression of hgg1, a late marker of prechordal mesoderm,
was strongly reduced in the cyclopic embryos at 24 hours
(Fig. 8D,I). These results
confirm that the cyclopia caused by the lack of both Bon and Mezzo proteins is
associated with the loss of prechordal mesoderm precursors during
gastrulation.
We also analysed sox17 expression in bon mutants injected
or not with mezzo-MO. In homozygous bonm425
embryos, expression of sox17 is reduced but not abolished
(Kikuchi et al., 2000
).
Typically, about 20 sox17-expressing cells are still present,
suggesting that additional factors are involved in regulating sox17
expression (Fig. 8E).
Inhibition of mezzo function in bon mutant embryos
eliminated all residual sox17 expression
(Fig. 8J; n=25/82).
This results shows that the activities of Mixer and Mezzo are both required
for specification of the normal number of sox17-expressing cells.
In summary, inhibition of mezzo function using an antisense oligonucleotide increases the penetrance of the squint and MZsquint mutations and increases the severity of the phenotype caused by the lack of bon/mixer, leading to defects in endoderm and prechordal plate development similar to those observed in the oep, cyclops and squint mutants.
Overexpression of mezzo partially rescues the phenotype of
bon mutants
To test if overexpression of mezzo could compensate for the lack
of Mixer in bon mutants, we microinjected mezzo mRNA into
bon mutant embryos. bon mutant embryos have a drastic
reduction of casanova and sox17 expression during
gastrulation and, typically, 25% of the embryos later develop with two well
separated hearts primordia because of improper specification of the endoderm
(Kikuchi et al., 2000
)
(Fig. 9B,E,H;
Table 3). By contrast, when
mezzo mRNA was microinjected into the progeny of bon/+
parents, the percentage of embryos showing a cardia bifida was
consistently around 15% and some embryos displayed a morphologically abnormal
but single heart chamber (Fig.
9C). This suggested that injection of mezzo mRNA had
allowed some mutant embryos to develop with a single heart. In one experiment,
out of 77 injected embryos, only 12 embryos displayed a typical cardia
bifida at 35 hours (15%). Out of the 65 remaining embryos, 15 had a
single but abnormal heart. We genotyped those 15 embryos and found that six
(7.8%) were in fact homozygous bon mutants. The other nine embryos
were heterozygous bon/+ in which mezzo overexpression had probably
caused abnormal heart morphogenesis.
|
|
We conclude that overexpression of mezzo can partially rescue heart morphogenesis in bon homozygous embryos. Because the cardia bifida phenotype of bon mutants is a consequence of abnormal specification of the endodermal cells, the partial rescue of cardiac fusion caused by mezzo suggests that ectopic mezzo may have also partially rescued endodermal gene expression in these embryos. Analysis of sox17 and casanova expression in homozygous bon mutants injected with mezzo mRNA confirmed that mezzo partially rescued the expression of these two endodermal marker genes in bon mutant embryos (Fig. 9F,I). Taken together, these results suggest that the function of Mezzo is partially redundant with the function of Bon/Mixer during endoderm specification.
| DISCUSSION |
|---|
|
|
|---|
mezzo encodes a homeobox transcription factor with sequence similarities to the human Sebox and to the Mix-like and Mixer homeoproteins. The mouse Sebox gene was characterised recently as a paired-like homeobox gene not closely related to any other homeobox gene. In mouse, Sebox is expressed in maturing oocytes as well as in epidermis, brain and liver in newborn and adult mice. By contrast, we found that zebrafish mezzo is expressed early and transiently in mesoderm and endoderm precursors. The expression pattern of mezzo is much more similar to the expression pattern of the early zygotic Bon/Mixer and Mix/Bix genes, which have been shown to participate in the processes of germ layer specification in zebrafish and Xenopus. The significance of the sequence similarities between Sebox and mezzo genes is unclear.
By injecting mRNA encoding TARAM-A* and Antivin we showed that mezzo, like mixer and the mix-like genes, is regulated by TGFß signals. Furthermore, we showed that mezzo expression is reduced in squint and oep mutants, and completely lost in cyc;sqt double mutants. Finally, we found that the activity of the maternal transcription factor Schmalspur/FoxH1 is required for the normal expression of mezzo, although we do not know whether this factor is required for initiation or maintenance of mezzo expression.
An important finding was obtained by analysing the effects of translational inhibitors on the expression of mezzo and of bon/mixer, casanova and sox17 after overexpression of TARAM-A*. We were able to show that the transcriptional activation of mezzo, bon/mixer and casanova in response to activation of the Nodal pathway occurs in absence of post-MBT protein synthesis. By contrast, activation of sox17 was found to require zygotic factors, consistent with the previous finding that sox17 acts downstream of casanova in the process of mesendoderm specification in zebrafish. These results suggest that mezzo, bon/mixer and casanova are, like ntl, immediate downstream targets of maternal factors activated by Nodal signalling.
By analysing mezzo expression in bon;faust double mutants, we also uncovered a requirement for zygotic transcription factors for the maintenance of mezzo expression. The picture emerging from these experiments is that mezzo expression is regulated by maternal factors activated by Nodal signals but that accumulation of mezzo transcripts at the beginning of gastrulation also requires an interplay between zygotic Bon/Mixer and Faust/Gata5 transcription factors.
Role of mezzo in endoderm determination
Recently, Alexander and Stainier
(Alexander and Stainier, 1999
)
proposed a model of endoderm formation based on overexpression experiments and
mutant analysis. In this model, they postulated the existence of a putative
zygotic gene they named X which would be expressed at the margin under the
control of Nodal signals and would be required in parallel with mixer
and gata5 for endoderm formation. The arguments for postulating the
existence of additional factor are the following: first, although in reduced
number compared with controls, sox17-expressing cells are still
present in bon or faust mutants, as well as in
bon;faust double mutants. Second, co-injection of bon/mixer
and gata5 RNAs in MZoep mutant embryos does not restore the
normal number of cells expressing sox17, indicating that additional
factors induced by Nodal signalling are required for this rescue to occur.
Third, overexpression of mixer and/or gata5 in normal
embryos does not activate sox17 expression outside the territory of
the margin, suggesting that a co-factor present only in cells of the margin
restricts spatially the activity of bon and/or gata5. Aoki
and colleagues reached the same conclusion by testing the ability of
bon/mixer to induce casanova in Nodal-deficient embryos
(Aoki et al., 2002a
). Mezzo is
a good candidate for such a factor: it is expressed early and transiently in
the same cells as mixer and gata5 and its expression is
directly controlled by Nodal signalling. Most importantly, ectopic expression
of mezzo induces ectopic expression of the endodermal markers
sox17 and cas even near the animal pole. The ability of
Mezzo to induce expression of endodermal markers in presumptive ectodermal
cells is remarkable compared with the inductive ability of Mixer, which is
restricted to the marginal zone (Alexander
and Stainier, 1999
; Kikuchi et
al., 2000
).
Other early zygotic factors, in addition to Mezzo, might participate with
Mixer and Gata5 in endoderm specification. One candidate is the
homeobox-containing gene pitx2. Like gata5, pitx2 is
expressed transiently in the four vegetal most rows of cells of the margin at
the late blastula stage (Faucourt et al.,
2001
). Moreover, the early expression of pitx2 is
strictly dependent on a functional Nodal signalling pathway as is the late
expression in the left lateral plate mesoderm during determination of
left/right asymmetries (Logan et al.,
1998
; Piedra et al.,
1998
; Ryan et al.,
1998
; Yoshioka et al.,
1998
; Campione et al.,
1999
). In Xenopus, inhibition of pitx2 function
using a chimeric Engrailed-Pitx2 fusion suppresses sox17 expression
in presumptive endoderm and blocks the response of cells to Nodal signalling.
However, overexpression of pitx2 in zebrafish does not promote
expression of endodermal marker genes but instead promotes prechordal plate
markers genes (Essner et al.,
2000
; Faucourt et al.,
2001
) (M. P. and T. L., unpublished). Other factors that might
participate in the regulation of casanova might be orthologues of the
Bix homeobox genes which in Xenopus are transcribed in an
immediate-early response to Nodal signalling
(Tada et al., 1998
;
Ecochard et al., 1998
).
Role of mezzo in mesoderm specification
The processes of endoderm and mesoderm specification are intimately linked
in vertebrates and both germ layers require a functional Nodal signalling
pathway (Dale, 1999
;
Kimelman and Griffin, 2000
;
Whitman, 2001
). The
bon/mixer and milk/Bix genes have been mainly studied in the
context of endoderm specification, although they may also participate in
mesoderm formation as the Bix genes are capable of inducing ventral
mesoderm at low doses and goosecoid at high doses
(Tada et al., 1998
). Our study
suggests a requirement for Mezzo and perhaps bon/mixer in both
development of endoderm and mesoderm. The main evidence supporting this
conclusion is that mezzo, in addition to its ability to promote
endodermal gene expression, is also an inducer of the pan mesodermal gene
marker ntl. These observations are consistent with the spatial and
temporal expression pattern of mezzo. mezzo transcripts are present
in the first six rows of cells at the margin of the blastoderm, a region that
has been shown to contain progenitors of both mesodermal and endodermal
lineages. Interestingly, the Bix genes in Xenopus are first expressed
in both mesoderm and endoderm before becoming restricted to endoderm during
gastrulation (Ecochard et al.,
1998
). An additional indication of roles for mezzo and
bon/mixer in mesoderm formation is that inhibition of mezzo
function in bon mutants interferes with goosecoid expression
and causes a reduction of prechordal plate mesoderm.
In contrast with the inducing activity of mezzo outside the margin
of the blastoderm, we have shown that this homeobox gene can repress
ntl expression when overexpressed in marginal cells and that this
repression is associated with upregulation of casanova. Many studies
in zebrafish and in Xenopus have documented mutual repressive effects
of mesoderm and endoderm determination factors, including Mix1
(Lemaire et al., 1998
;
Latinkic and Smith, 1999
),
Milk/Bix (Ecochard et al.,
1998
; Tada et al.,
1998
), Pitx2 (Faucourt et al.,
2001
), Sox-17 (Engleka et al.,
2001
) and Casanova (Aoki et
al., 2002a
). As we have shown that mezzo is an inducer of
endoderm determination genes such as casanova and sox17, it
is likely that high doses of mezzo lead to repression of ntl
in part by inducing casanova.
Functional redundancy between mezzo and bon/mixer
and relation between mezzo, mixer and cas
Several lines of evidence support the idea that mezzo and
bon/mixer are functionally redundant factors. First, mezzo
and bon/mixer are expressed at the same time in the same cells.
Second, the homeodomains of both genes are structurally related. Third, while
bon mutants still express sox17 in a few cells, injection of
mezzo-MO into bon mutants abolishes this residual
sox17 expression and results in a phenocopy of the cyclops
mutant phenotype. By contrast, injection of mezzo-MO into
cyclops, cas or faust mutant backgrounds does not cause such
a phenotype. Most importantly, injection of mezzo RNA into
bon mutants partially restores expression of endodermal gene markers
and rescues heart morphogenesis, which is disrupted in the absence of
functional bon/mixer gene product.
Based on our various observations, we would like to integrate
mezzo into a model of gene regulation involved in endoderm
specification (Fig. 10)
inspired by those of Stainier et al.
(Stainier et al., 2002
) and
Aoki et al. (Aoki et al.,
2002a
). In this model, mezzo stands as an immediate-early
target of Nodal/TARAM-A/Oep signalling, together with bon/mixer and
faust/gata5. casanova, which we have also shown to be an
immediate-early target of Nodal, occupies the same position but requires
imputs from Mezzo, Bon/Mixer and Faust to assure continual expression.
Finally, in agreement with previous proposals, this model shows that
casanova is a crucial node of this network and the most important
transcriptional regulator of sox17.
|
In conclusion, we have identified a novel transcription factor acting in the gene network that regulates specification of the mesendoderm in zebrafish. The function of mezzo is partially redundant with the function of bon/mixer but differs in that mezzo may also participate in mesoderm formation. Future studies should aim at understanding how these different transcription factors interact and what is the molecular basis for the segregation of the endodermal and mesodermal germ layers from common precursors.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alexander, J., Rothenberg, M., Henry, G. L. and Stainier, D. Y. (1999). casanova plays an early and essential role in endoderm formation in zebrafish. Dev. Biol. 215,343 -357.[CrossRef][Medline]
Alexander, J. and Stainier, D. Y. (1999). A molecular pathway leading to endoderm formation in zebrafish. Curr. Biol. 9,1147 -1157.[CrossRef][Medline]
Aoki, T. O., David, N. B., Minchiotti, G., Saint-Etienne, L.,
Dickmeis, T., Persico, G. M., Strahle, U., Mourrain, P. and Rosa, F. M.
(2002a). Molecular integration of casanova in the Nodal
signalling pathway controlling endoderm formation.
Development 129,275
-286.
Aoki, T. O., Mathieu, J., Saint-Etienne, L., Rebagliati, M. R., Peyrieras, N. and Rosa, F. M. (2002b). Regulation of nodal signalling and mesendoderm formation by TARAM-A, a TGFbeta-related type I receptor. Dev. Biol. 241,273 -288.[CrossRef][Medline]
Bisgrove, B. W., Essner, J. J. and Yost, H. J. (1999). Regulation of midline development by antagonism of lefty and nodal signaling. Development 126,3253 -3262.[Abstract]
Campione, M., Steinbeisser, H., Schweickert, A., Deissler, K., van Bebber, F., Lowe, L. A., Nowotschin, S., Viebahn, C., Haffter, P., Kuehn, M. R. et al. (1999). The homeobox gene Pitx2: mediator of asymmetric left-right signaling in vertebrate heart and gut looping. Development 126,1225 -1234.[Abstract]
Chen, J. N., Haffter, P., Odenthal, J., Vogelsang, E., Brand, M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Hammerschmidt, M., Heisenberg, C. P. et al. (1996). Mutations affecting the cardiovascular system and other internal organs in zebrafish. Development 123,293 -302.[Abstract]
Cinquanta, M., Rovescalli, A. C., Kozak, C. A. and Nirenberg,
M. (2000). Mouse Sebox homeobox gene expression in skin,
brain, oocytes, and two-cell embryos. Proc. Natl. Acad. Sci.
USA 97,8904
-8909.
Dale, L. (1999). Vertebrate development: Multiple phases to endoderm formation. Curr. Biol. 9,R812 -R815.[CrossRef][Medline]
David, N. B. and Rosa, F. M. (2001). Cell
autonomous commitment to an endodermal fate and behaviour by activation of
Nodal signalling. Development
128,3937
-3947.
Dick, A., Mayr, T., Bauer, H., Meier, A. and Hammerschmidt, M. (2000). Cloning and characterization of zebrafish smad2, smad3 and smad4. Gene 246, 69-80.[CrossRef][Medline]
Dickmeis, T., Mourrain, P., Saint-Etienne, L., Fischer, N.,
Aanstad, P., Clark, M., Strahle, U. and Rosa, F. (2001). A
crucial component of the endoderm formation pathway, CASANOVA, is encoded by a
novel sox-related gene. Genes Dev.
15,1487
-1492.
Duboule, D. (1994). Guidebook to the Homeobox Genes. Oxford: Oxford University Press.
Ecochard, V., Cayrol, C., Rey, S., Foulquier, F., Caillol, D., Lemaire, P. and Duprat, A. M. (1998). A novel Xenopus mix-like gene milk involved in the control of the endomesodermal fates. Development 125,2577 -2585.[Abstract]
Engleka, M. J., Craig, E. J. and Kessler, D. S. (2001). VegT activation of Sox17 at the midblastula transition alters the response to nodal signals in the vegetal endoderm domain. Dev. Biol. 237,159 -172.[CrossRef][Medline]
Erter, C. E., Solnica-Krezel, L. and Wright, C. V. (1998). Zebrafish nodal-related 2 encodes an early mesendodermal inducer signaling from the extraembryonic yolk syncytial layer. Dev. Biol. 204,361 -372.[CrossRef][Medline]
Essner, J. J., Branford, W. W., Zhang, J. and Yost, H. J. (2000). Mesendoderm and left-right brain, heart and gut development are differentially regulated by pitx2 isoforms. Development 127,1081 -1093.[Abstract]
Faucourt, M., Houliston, E., Besnardeau, L., Kimelman, D. and Lepage, T. (2001). The pitx2 homeobox protein is required early for endoderm formation and nodal signaling. Dev. Biol. 229,287 -306.[CrossRef][Medline]
Feldman, B., Gates, M. A., Egan, E. S., Dougan, S. T., Rennebeck, G., Sirotkin, H. I., Schier, A. F. and Talbot, W. S. (1998). Zebrafish organizer development and germ-layer formation require nodal-related signals. Nature 395,181 -185.[CrossRef][Medline]
Germain, S., Howell, M., Esslemont, G. M. and Hill, C. S.
(2000). Homeodomain and winged-helix transcription factors
recruit activated Smads to distinct promoter elements via a common Smad
interaction motif. Genes Dev.
14,435
-451.
Gritsman, K., Zhang, J., Cheng, S., Heckscher, E., Talbot, W. S. and Schier, A. F. (1999). The EGF-CFC protein one-eyed pinhead is essential for nodal signaling. Cell 97,121 -132.[CrossRef][Medline]
Harland, R. M. (1991). In situ hybridization: an improved whole mount method for Xenopus embryos. In Methods in Cell Biology, Vol.36 (ed. B. K. Kay and H. J. Peng), pp.685 -695. San Diego, CA: Academic Press.[Medline]
Hatta, K., Kimmel, C. B., Ho, R. K. and Walker, C. (1991). The cyclops mutation blocks specification of the floor plate of the zebrafish central nervous system. Nature 350,339 -341.[CrossRef][Medline]
Henry, G. L. and Melton, D. A. (1998). Mixer, a
homeobox gene required for endoderm development.
Science 281,91
-96.
Hukriede, N., Fisher, D., Epstein, J., Joly, L., Tellis, P.,
Zhou, Y., Barbazuk, B., Cox, K., Fenton-Noriega, L., Hersey, C. et al.
(2001). The LN54 radiation hybrid map of zebrafish expressed
sequences. Genome Res.
11,2127
-2132.
Hukriede, N. A., Joly, L., Tsang, M., Miles, J., Tellis, P.,
Epstein, J. A., Barbazuk, W. B., Li, F. N., Paw, B., Postlethwait, J. H. et
al. (1999). Radiation hybrid mapping of the zebrafish genome.
Proc. Natl. Acad. Sci. USA
96,9745
-9750.
Kikuchi, Y., Trinh, L. A., Reiter, J. F., Alexander, J., Yelon,
D. and Stainier, D. Y. (2000). The zebrafish bonnie and clyde
gene encodes a Mix family homeodomain protein that regulates the generation of
endodermal precursors. Genes Dev.
14,1279
-1289.
Kikuchi, Y., Agathon, A., Alexander, J., Thisse, C., Waldron,
S., Yelon, D., Thisse, B. and Stainier, D. Y. (2001).
casanova encodes a novel Sox-related protein necessary and sufficient for
early endoderm formation in zebrafish. Genes Dev.
15,1493
-1505.
Kimelman, D. and Griffin, K. J. (2000). Vertebrate mesendoderm induction and patterning. Curr. Opin. Genet. Dev. 10,350 -356.[CrossRef][Medline]
Kimmel, C. B., Warga, R. M. and Schilling, T. F.
(1990). Origin and organization of the zebrafish fate map.
Development 108,581
-594.
Latinkic, B. V. and Smith, J. C. (1999). Goosecoid and mix. 1 repress Brachyury expression and are required for head formation in Xenopus. Development 126,1769 -1779.[Abstract]
Lemaire, P., Darras, S., Caillol, D. and Kodjabachian, L. (1998). A role for the vegetally expressed Xenopus gene Mix. 1 in endoderm formation and in the restriction of mesoderm to the marginal zone. Development 125,2371 -2380.[Abstract]
Logan, M., Pagan-Westphal, S. M., Smith, D. M., Paganessi, L. and Tabin, C. J. (1998). The transcription factor Pitx2 mediates situs-specific morphogenesis in response to left-right asymmetric signals. Cell 94,307 -317.[CrossRef][Medline]
Muller, F., Blader, P., Rastegar, S., Fischer, N., Knochel, W. and Strahle, U. (1999). Characterization of zebrafish smad1, smad2 and smad5: the amino- terminus of smad1 and smad5 is required for specific function in the embryo. Mech. Dev. 88, 73-88.[CrossRef][Medline]
Odenthal, J., Haffter, P., Vogelsang, E., Brand, M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J. et al. (1996). Mutations affecting the formation of the notochord in the zebrafish, Danio rerio. Development 123,103 -115.[Abstract]
Peale, F. V., Jr, Sugden, L. and Bothwell, M. (1998). Characterization of CMIX, a chicken homeobox gene related to the Xenopus gene mix. 1. Mech. Dev. 75,167 -170.[CrossRef][Medline]
Pearce, J. J. and Evans, M. J. (1999). Mml, a mouse Mix-like gene expressed in the primitive streak. Mech. Dev. 87,189 -192.[CrossRef][Medline]
Peyrieras, N., Strahle, U. and Rosa, F. (1998). Conversion of zebrafish blastomeres to an endodermal fate by TGF-beta- related signaling. Curr. Biol. 8, 783-786.[CrossRef][Medline]
Piedra, M. E., Icardo, J. M., Albajar, M., Rodriguez-Rey, J. C. and Ros, M. A. (1998). Pitx2 participates in the late phase of the pathway controlling left- right asymmetry. Cell 94,319 -324.[CrossRef][Medline]
Pogoda, H. M., Solnica-Krezel, L., Driever, W. and Meyer, D. (2000). The zebrafish forkhead transcription factor FoxH1/Fast1 is a modulator of nodal signaling required for organizer formation. Curr. Biol. 10,1041 -1049.[CrossRef][Medline]
Randall, R. A., Germain, S., Inman, G. J., Bates, P. A. and Hill, C. S. (2002). Different Smad2 partners bind a common hydrophobic pocket in Smad2 via a defined proline-rich motif. EMBO J. 21,145 -156.[CrossRef][Medline]
Rebagliati, M. R., Toyama, R., Haffter, P. and Dawid, I. B.
(1998). cyclops encodes a nodal-related factor involved in
midline signaling. Proc. Natl. Acad. Sci. USA
95,9932
-9937.
Reiter, J. F., Kikuchi, Y. and Stainier, D. Y. (2001). Multiple roles for Gata5 in zebrafish endoderm formation. Development 128,125 -135.[Abstract]
Renucci, A., Lemarchandel, V. and Rosa, F. (1996). An activated form of type I serine/threonine kinase receptor TARAM-A reveals a specific signalling pathway involved in fish head organiser formation. Development 122,3735 -3743.[Abstract]
Rodaway, A., Takeda, H., Koshida, S., Broadbent, J., Price, B., Smith, J. C., Patient, R. and Holder, N. (1999). Induction of the mesendoderm in the zebrafish germ ring by yolk cell- derived TGF-beta family signals and discrimination of mesoderm and endoderm by FGF. Development 126,3067 -3078.[Abstract]
Rosa, F. M. (1989). Mix. 1, a homeobox RNA inducible by mesoderm inducers, is expressed mostly in the presumptive endodermal cells of Xenopus embryos. Cell 57,965 -974.[CrossRef][Medline]
Ryan, A. K., Blumberg, B., Rodriguez-Esteban, C., Yonei-Tamura, S., Tamura, K., Tsukui, T., de la Pena, J., Sabbagh, W., Greenwald, J., Choe, S. et al. (1998). Pitx2 determines left-right asymmetry of internal organs in vertebrates. Nature 394,545 -551.[CrossRef][Medline]
Sampath, K., Rubinstein, A. L., Cheng, A. M., Liang, J. O., Fekany, K., Solnica-Krezel, L., Korzh, V., Halpern, M. E. and Wright, C. V. (1998). Induction of the zebrafish ventral brain and floorplate requires cyclops/nodal signalling. Nature 395,185 -189.[CrossRef][Medline]
Schier, A. F., Neuhauss, S. C., Helde, K. A., Talbot, W. S. and Driever, W. (1997). The one-eyed pinhead gene functions in mesoderm and endoderm formation in zebrafish and interacts with no tail. Development 124,327 -342.[Abstract]
Sirotkin, H. I., Dougan, S. T., Schier, A. F. and Talbot, W. S. (2000). bozozok and squint act in parallel to specify dorsal mesoderm and anterior neuroectoderm in zebrafish. Development 127,2583 -2592.[Abstract]
Stachel, S. E., Grunwald, D. J. and Myers, P. Z. (1993). Lithium perturbation and goosecoid expression identify a dorsal specification pathway in the pregastrula zebrafish. Development 117,1261 -1274.[Abstract]
Stainier, D. Y. (2002). A glimpse into the
molecular entrails of endoderm formation. Genes Dev.
16,893
-907.
Stein, S., Roeser, T. and Kessel, M. (1998). CMIX, a paired-type homeobox gene expressed before and during formation of the avian primitive streak. Mech. Dev. 75,163 -165.[CrossRef][Medline]
Summerton, J. and Weller, D. (1997). Morpholino antisense oligomers: design, preparation, and properties. Antisense Nucleic Acid Drug Dev. 7,187 -195.[Medline]
Tada, M., Casey, E. S., Fairclough, L. and Smith, J. C. (1998). Bix 1, a direct target of Xenopus T-box genes, causes formation of ventral mesoderm and endoderm. Development 125,3997 -4006.[Abstract]
Thisse, B., Wright, C. V. and Thisse, C. (2000). Activin- and Nodal-related factors control antero-posterior patterning of the zebrafish embryo. Nature 403,425 -428.[CrossRef][Medline]
Thisse, C. and Thisse, B. (1999). Antivin, a novel and divergent member of the TGFbeta superfamily, negatively regulates mesoderm induction. Development 126,229 -240.[Abstract]
Thisse, C., Thisse, B., Halpern, M. E. and Postlethwait, J. H. (1994). Goosecoid expression in neurectoderm and mesendoderm is disrupted in zebrafish cyclops gastrulas. Dev. Biol. 164,420 -429.[CrossRef][Medline]
Turner, D. L. and Weintraub, H. (1994).
Expression of achaete-schute homolog 3 in Xenopus embryos
converts ectodermal cells to a neural fate. Genes Dev.
8,1434
-1447.
Vogel, A. M. and Gerster, T. (1999). Promoter activity of the zebrafish bhikhari retroelement requires an intact activin signaling pathway. Mech. Dev. 85,133 -146.[CrossRef][Medline]
Vogel, A. M. and Gerster, T. (2000). Expression of a zebrafish cathepsin L gene in anterior mesendoderm and hatching gland. Dev. Genes Evol. 206,477 -479.[CrossRef]
Warga, R. M. and Nusslein-Volhard, C. (1999). Origin and development of the zebrafish endoderm. Development 126,827 -838.[Abstract]
Westerfield, M. (1994). The Zebrafish Book. Eugene OR: Institute of Neurosciences, University of Oregon.
Whitman, M. (2001). Nodal signaling in early vertebrate embryos: themes and variations. Dev. Cell 1, 605-617.[CrossRef][Medline]
Yoshioka, H., Meno, C., Koshiba, K., Sugihara, M., Itoh, H., Ishimaru, Y., Inoue, T., Ohuchi, H., Semina, E. V., Murray, J. C. et al. (1998). Pitx2, a bicoid-type homeobox gene, is involved in a lefty-signaling pathway in determination of left-right asymmetry. Cell 94,299 -305.[CrossRef][Medline]
Zhang, J., Talbot, W. S. and Schier, A. F. (1998). Positional cloning identifies zebrafish one-eyed pinhead as a permissive EGF-related ligand required during gastrulation. Cell 92,241 -251.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. Glaser, D. Metcalf, L. Wu, A. H. Hart, L. DiRago, S. Mifsud, A. D'Amico, S. Dagger, C. Campo, A. C. Chan, et al. Enforced expression of the homeobox gene Mixl1 impairs hematopoietic differentiation and results in acute myeloid leukemia PNAS, October 31, 2006; 103(44): 16460 - 16465. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Poulain, M. Furthauer, B. Thisse, C. Thisse, and T. Lepage Zebrafish endoderm formation is regulated by combinatorial Nodal, FGF and BMP signalling Development, June 1, 2006; 133(11): 2189 - 2200. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Willey, A. Ayuso-Sacido, H. Zhang, S. T. Fraser, K. E. Sahr, M. J. Adlam, M. Kyba, G. Q. Daley, G. Keller, and M. H. Baron Acceleration of mesoderm development and expansion of hematopoietic progenitors in differentiating ES cells by the mouse Mix-like homeodomain transcription factor Blood, April 15, 2006; 107(8): 3122 - 3130. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Ng, L. Azzola, K. Sourris, L. Robb, E. G. Stanley, and A. G. Elefanty The primitive streak gene Mixl1 is required for efficient haematopoiesis and BMP4-induced ventral mesoderm patterning in differentiating ES cells Development, March 1, 2005; 132(5): 873 - 884. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kofron, C. Wylie, and J. Heasman The role of Mixer in patterning the early Xenopus embryo Development, May 15, 2004; 131(10): 2431 - 2441. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Kunwar, S. Zimmerman, J. T. Bennett, Y. Chen, M. Whitman, and A. F. Schier Mixer/Bon and FoxH1/Sur have overlapping and divergent roles in Nodal signaling and mesendoderm induction Development, December 1, 2003; 130(23): 5589 - 5599. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||