|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
Department of Genetics, Cell Biology, and Development, University of Minnesota, Minneapolis, MN 55455, USA
* Author for correspondence (e-mail: bob-h{at}umn.edu)
Accepted 2 August 2002
| SUMMARY |
|---|
|
|
|---|
Key words: mec-8, unc-52, Perlecan, Alternative splicing, RRM
| INTRODUCTION |
|---|
|
|
|---|
UNC-52 plays an essential role in muscle development: unc-52 null
mutations cause severe defects in myofilament lattice assembly in body-wall
muscle and lead to arrest and paralysis at the twofold stage of embryonic
morphogenesis (Hresko et al.,
1994
; Williams and Waterston,
1994
). UNC-52 is concentrated under the muscle dense bodies and M
lines in the basement membrane between muscle and hypodermis
(Francis and Waterston, 1991
;
Hresko et al., 1994
;
Mullen et al., 1999
). UNC-52
begins to accumulate in the basement membrane during early embryonic
morphogenesis (Hresko et al.,
1994
), when it is faintly detected within muscle cells
(Mullen et al., 1999
),
suggesting that it is produced by muscle. Basement membranes around the
pharynx, gonad and the anal depressor and sex muscles also contain UNC-52 at
various stages (Francis and Waterston,
1991
; Mullen et al.,
1999
). UNC-52 proteins are homologs of mammalian perlecan
(Rogalski et al., 1993
), an
extracellular matrix protein found in all basement membranes and synthesized
by many vertebrate cell types (Noonan and
Hassell, 1993
). Mice and humans that lack perlecan have abnormal
cartilage development and defects in certain basement membranes
(Arikawa-Hirasawa et al., 1999
;
Arikawa-Hirasawa et al., 2001
;
Costell et al., 1999
;
Nicole et al., 2000
).
unc-52 generates several different mRNA and protein isoforms.
Transcripts with alternative 3' ends generate short (S), medium (M) and
long (L) UNC-52 isoforms; mutational analysis has shown that only M isoforms
are required for proper embryonic and larval development
(Mullen et al., 1999
).
Antibodies that detect M and L isoforms stain the body-wall muscle basement
membrane in embryos (Mullen et al.,
1999
). Exons 16, 17 and 18 of unc-52 are alternatively
spliced to generate M and L isoforms with varying numbers of copies of a motif
found in neural cell adhesion molecules (11-14 copies of the motif for M
isoforms), which appear to be largely functionally redundant
(Mullen et al., 1999
). Weak
alleles of unc-52 that cause progressive muscle disruption and late
larval and adult paralysis cluster in this alternatively spliced region
(Rogalski et al., 1995
).
Defects in these unc-52(viable) animals appear to be caused by
reduced levels of UNC-52 in larvae (Mullen
et al., 1999
). Some unc-52(viable) mutations generate
nonsense codons in exon 17 (e669 and e1012) or exon 18
(e444 and e998). Animals homozygous for any of these alleles
seem to be normal during embryogenesis and early larval development.
Loss-of function mutations in mec-8 enhance
unc-52(viable) alleles: mec-8; unc-52(viable) embryos
resemble unc-52(null) embryos
(Lundquist and Herman, 1994
)
and have severely reduced levels of UNC-52
(Lundquist et al., 1996
;
Mullen et al., 1999
).
mec-8 is required to generate unc-52 transcripts that have
either exon 15 spliced directly to exon 19 or exon 16 spliced directly to exon
19 (Lundquist et al., 1996
).
These mRNAs skip unc-52(viable) mutations and provide enough UNC-52
for normal embryonic and early larval development. Other unc-52 mRNA
isoforms that lack either exon 17 or exon 18 have been identified
(Rogalski et al., 1995
), but
anti-UNC-52 staining of mec-8; unc-52(viable) embryos suggests that
these mec-8-independent mRNA isoforms are spatially restricted or are
present at low levels during embryogenesis
(Mullen et al., 1999
).
We show that MEC-8 is a nuclear protein and is expressed primarily in
hypodermal cells when mec-8-dependent UNC-52 isoforms begin to
accumulate. We have found that transgenic expression of MEC-8 in hypodermis
(but not in muscle) can suppress both embryonic and postembryonic phenotypes
caused by unc-52 mutations. We have constructed tissue-specific
unc-52 minigenes whose patterns of expression are
mec-8-dependent when mec-8 is expressed in the same tissue.
Finally, we have used mosaic analysis to show that UNC-52 is not a
cell-autonomous product of muscle, as suggested previously
(Moerman et al., 1996
), but is
probably produced by the hypodermis. We propose that MEC-8 regulates the
alternative splicing of unc-52 pre-mRNA directly and that the
regulation occurs primarily in the hypodermis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Molecular biology and germline transformation
Standard molecular biology techniques were used
(Sambrook et al., 1989
). PCRs
were performed as recommended using either Vent (Promega) or Pfu (Stratagene)
thermostable DNA polymerase. Plasmids pPD52.99, pPD93.97 and pPD95.75
(www.ciwemb.edu)
were generated by A. Fire, S. Xu, J. Ahn and G. Seydoux. Constructs were
injected at 20 ng/µl along with 100 ng/µl plasmid pRF4 containing
rol-6(su1006sd) (Mello and Fire,
1995
), 50 ng/µl R1p16 containing unc-36(+) (obtained
from L. Lobel) or 100 ng/µl pTG96 containing sur-5::gfp
(Yochem et al., 1998
).
Chromosomal integration of arrays was induced by
-irradiation
(Mello and Fire, 1995
).
mec-8::gfp
A 6 kb ApaI-PvuI fragment from a previously-described
8.5-kb XhoI mec-8 genomic subclone
(Lundquist et al., 1996
) was
cloned into the SmaI site of pPD95.75. The MEC-8::GFP fusion protein
made by this construct is predicted to contain all but the last 18 amino acids
of MEC-8; its expression rescued the dye-filling defect of mec-8
animals (Lundquist and Herman,
1994
) but failed to rescue other mec-8 phenotypes.
Antibodies
A 0.93-kb EagI-EcoRI mec-8 cDNA fragment
(Lundquist et al., 1996
) was
cloned into the SmaI site of pGEX-2T (Amrad). GST::MEC-8 fusion
protein was purified by SDS-polyacrylamide gel electrophoresis. Rabbits were
immunized four times in 10 months with 400 µg GST::MEC-8 and 1 ml Ribi
Adjuvant System (Sigma). Serum collected after the third immunization was
affinity purified (Bar-Peled and Raikhel,
1996
). Antibody staining was performed as described
(Bowerman et al., 1993
;
Finney and Ruvkun, 1990
).
Antibody dilutions were: 1:500-2000 anti-MEC-8 serum; 1:100 affinity-purified
anti-MEC-8; 1:500 anti-LIN-26 (Labouesse
et al., 1996
) and anti-ß-galactosidase (ß-gal; Promega);
1:1000 DM5.6 (Miller et al.,
1983
) and MH2 (Francis and
Waterston, 1991
); and 1:500 goat anti-rabbit or anti-mouse 2°
antibodies conjugated to FITC, rhodamine (Cappel) or Cy3 (Jackson
ImmunoResearch).
mec-8 tissue-specific expression constructs
Phlh-1::mec-8(+) was created by inserting mec-8 cDNA
sequence into pPD52.99 using the restriction enzymes NheI and
NcoI. mec-8 cDNA sequence was PCR amplified using primers
GAGCTAGCGAAGTTTGAGCCATAACGATTG and CTCCATGGTCAAGACAATAGAAGTTCC.
Pdpy-7::mec-8(+) was created by replacing the
HindIII-NheI fragment containing Phlh-1 with a
HindIII-XbaI fragment containing Pdpy-7
(Gilleard et al., 1997
).
Pdpy-7 was PCR-amplified from cosmid C38F3 (provided by A. Coulson)
using primers CAAAGCTTCTCCGGTAGCGGCGG and CTTCTAGATTTATCTGGAACAAAATGTAAG.
Suppression of unc-52 and rescue of mec-8; unc-52
synthetic lethality
Animals of general genotype unc-52; unc-36; mnEx[mec-8(+)
unc-36(+)] were generated by crossing unc-36; mnEx males with
unc-52; unc-36 hermaphrodites, picking array-bearing (non-Unc-36)
cross progeny, and picking many of their progeny to establish unc-52;
unc-36; mnEx lines, in which all Unc-36 animals were also Unc-52.
unc-52(su250e669ts) was not suppressed in seven lines
generated by injection of Phlh-1::mec-8(+) and R1p16 into
unc-52(su250e669); unc-36 hermaphrodites.
Animals of general genotype mec-8; unc-52; unc-36; mnEx[mec-8(+) unc-36(+)] were generated by crossing unc-36; him-5; mnEx males to unc-52; unc-36 hermaphrodites; non-Unc-36 male progeny were then crossed to mec-8; unc-36 hermaphrodites, and non-Unc-36 hermaphrodite progeny were picked and allowed to self-fertilize. Finally, many non-Unc-36 progeny were picked from broods that contained Unc-52 segregants and were progeny tested.
unc-52::gfp minigene constructs
unc-52 exons 17-19 were PCR amplified from wild-type or
unc-52(e444) genomic DNA using primers GCGAGCTCAACACAGACAATCCCTGAAGG
and GAGAGCTCTTTGGCTCAAGCGGTGTAAC and cloned into the SacI site of
pPD93.97. unc-52 exons 15-17 were PCR-amplified from wild-type or
unc-52(e669) genomic DNA using primers
GCTCTAGATGCATCCAAACATCCAACTCCAG and GCTCTAGAAAGGCAAACCAGGTGTGAC, and cloned
into vectors containing exons 17-19 using XbaI and SalI. The
HindIII-XbaI fragment containing Pmyo-3 was
replaced with a HindIII-XbaI fragment containing
Pdpy-7 for expression in hypodermal cells. Constructs were
co-injected with either R1p16 or pRF4.
Males carrying integrated minigenes were crossed to mec-8(u74) or mec-8(u74); unc-36 hermaphrodites. Array-bearing Mec F2 progeny were picked. Plates with all roller or all non-Unc-36 progeny were retained; the embryos of subsequent generations were examined for GFP. At least two independent integrated lines were tested for each construct. mec-8; unc-36; mnIs25[Pmyo-3::unc-52::gfp rol-6(su1006)] strains carrying extrachromosomal arrays with tissue-specific mec-8(+) expression constructs were generated by crossing unc-36; him-5; mnEx113[Phlh-1::mec-8(+) unc-36(+)] or unc-36; mnEx136[Pdpy-7::mec-8(+) unc-36(+)] males to mec-8; unc-36; mnIs25 hermaphrodites. Non-Unc-36 roller F2 progeny were picked and progeny tested.
unc-52 mosaic analysis
Extrachromosomal arrays mnEx126 and mnEx133, each
carrying unc-52(+) unc-36(+) sur-5::gfp, were
generated by injecting overlapping cosmids ZC101 and C3836 (5 ng/µl each)
along with R1p16 and pTG96 into unc-36; him-5 hermaphrodites.
Non-Unc-36 males were used to transfer the arrays into different genetic
backgrounds. Potential mosaics were scored for cell-autonomous expression of
GFP as described by Yochem et al. (Yochem
et al., 1998
). For example, C(-) mosaics lacked GFP in hyp11 and
the DVC neuron, which descend from the two immediate daughters of C,
respectively, and lacked GFP in C-derived body wall muscles.
| RESULTS |
|---|
|
|
|---|
|
The pattern of GFP expression by transgenic embryos carrying
mec-8::gfp was very similar to the pattern of MEC-8 expression seen
by immunolocalization. GFP was seen in most nuclei at about the 50-cell stage.
Just prior to morphogenesis, GFP became brighter in hypodermal nuclei and
faded in the nuclei of other cells. During embryonic elongation, hypodermal
nuclei exhibited bright GFP fluorescence while other nuclei fluoresced faintly
or not at all (Fig. 1G,H). The
nuclei of hypodermal cells and their precursor cells were marked by staining
with anti-LIN-26 (Labouesse et al.,
1996
). The only difference between the GFP expression and the
anti-MEC-8 staining was that the faint expression seen in non-hypodermal
nuclei carrying mec-8::gfp was not detected with anti-MEC-8 serum.
This difference could have been caused by overexpression or perdurance of the
MEC-8::GFP fusion protein or by poor antibody sensitivity to low levels of
MEC-8.
MEC-8 is expressed in many different tissues in larvae
In L1-L4 larvae, MEC-8 was detected by anti-MEC-8 serum in the nuclei of
the large hypodermal syncytium, hyp7, that covers most of the worm
(Fig. 1J,K). This staining was
fainter than the staining of the embryonic hypodermal nuclei, became even
fainter during later larval development and was undetectable in adults. The
nuclei of head hypodermal cells not fused with hyp7 (hyp4 and hyp5 nuclei in
particular) stained well with anti-MEC-8 in all larval stages and in adults.
Anti-MEC-8 also stained the nuclei of many neurons in the head (probably
including chemosensory neurons); a few neurons in the central body region
[including the ALM (Fig. 1L)
and AVM touch neurons, and neurons in the post-deirid]; vulval nuclei in L4
and adult stage hermaphrodites (Fig.
1L); anterior- and posterior-most intestinal nuclei; and other
unidentified nuclei in the head and tail. The anterior-most muscle nuclei in
the heads of larvae had low but detectable levels of MEC-8, but none of the
muscle cells in the main body appeared to stain with anti-MEC-8.
This pattern of MEC-8 expression was largely confirmed using the mec-8::gfp reporter construct. For example, GFP was detected in larval hyp7 nuclei at levels reduced from those seen in embryonic hypodermis and was not detected in larval body muscle cells. There were some differences between the antibody and GFP results: first, we were unable to detect GFP reliably in the nuclei of ALM and AVM; and second, the nuclei of ventral hypodermal cells had detectable levels of GFP in young (L1-L2 stage) larvae but did not appear to stain with anti-MEC-8 antibodies.
mec-8 can regulate expression of unc-52 minigenes
expressed in embryonic muscle or hypodermis
We constructed three pairs of unc-52 minigenes to monitor
cell-specific mec-8-dependent alternative splicing in living embryos.
All six minigenes contain a region of the unc-52 gene extending from
within exon 15 into the beginning of exon 19
(Fig. 2) and are fused at their
3' ends to a nuclear localization signal and a gene for green
fluorescent protein (gfp). For the first pair of minigenes, the
unc-52 sequence is wild type. The second pair contain the nonsense
mutation e669 in exon 17, and the third pair contain the nonsense
mutation e444 in exon 18. Each member of a minigene pair is driven
either by the myo-3 promoter, which drives expression in body wall
muscle, or by the dpy-7 promoter, which drives expression in
hypodermis, from just prior to embryonic elongation until the end of the
fourth larval stage (Gilleard et al.,
1997
). All six constructs were integrated into chromosomes, made
homozygous and analyzed in at least two independent lines. The cell-specific
promoters led to the expected cell-specific expression of GFP; thus, the
Pdpy-7::unc-52(+)::gfp construct gave strong GFP expression
specifically in hypodermis, and the Pmyo-3::unc-52(+)::gfp
construct gave strong GFP expression specifically in body muscle
(Fig. 3A-D). In both cases, GFP
expression was unaltered by making the animals homozygous for
mec-8(u74).
|
|
In mec-8(+) embryos containing either of the nonsense
mutant unc-52 minigenes driven by the hypodermal-specific promoter,
Pdpy-7::unc-52(e669)::gfp or Pdpy-7::unc-52(e444)::gfp, we
saw very high hypodermal GFP expression, comparable with that seen from the
wild-type minigene constructs. By contrast, GFP expression from these
constructs was virtually abolished in mec-8 mutant embryos
(Fig. 3E,F and data not shown).
We presume that the mec-8(+)-dependent GFP expression of
these constructs requires the skipping of exon 17 or exon 18 of the minigene
and that such skipping requires mec-8(+) function, as it
does for the endogenous unc-52 gene
(Lundquist et al., 1996
). We
performed a reversetranscription (RT) PCR experiment using forward and reverse
primers in unc-52 exon 16 and gfp, respectively, to
determine whether the unc-52 exon 16-19 splice form made by the
Pdpy-7::unc-52(+)::gfp minigene on mnIs61 was
mec-8-dependent. RT-PCR on a population of wild-type embryos carrying
mnIs61 amplified primarily a product that was the expected size for
the 16-19 splice form (data not shown). The same RT-PCR experiment on a
population of mec-8(u74) embryos carrying mnIs61 amplified
primarily a product that was the expected size of the 16-17-18-19 isoform;
only low levels of the 16-19 isoform were seen (data not shown). These results
suggest that the splicing of the Pdpy-7::unc-52::gfp minigene
transcripts accurately mimicked mec-8-dependent splicing of
unc-52 transcripts.
Larvae carrying either of the hypodermally driven mutant unc-52 minigenes expressed hypodermal GFP, but the levels of expression were lower than that seen from the wild-type unc-52 minigene. The larval expression was reduced further in a mec-8 background.
Both of the nonsense-bearing minigenes driven by the muscle-specific promoter, Pmyo-3::unc-52(e669)::gfp and Pmyo-3::unc-52(e444)::gfp, showed rather weak embryonic expression (Fig. 3G and data not shown). This expression was mec-8 dependent (Fig. 3H) until late embryogenesis, but not in subsequent stages of development, as if a factor other than MEC-8 were able to promote exon skipping in muscle at the later stages.
We detected additional differences among the minigene constructs in their expression patterns. For example, mec-8 embryos carrying the Pmyo-3::unc-52(e669)::gfp construct expressed GFP in one to two cells at the anterior tip of each body-wall muscle quadrant (Fig. 3H). This was not seen in mec-8 embryos carrying the equivalent e444 minigene (data not shown). We also observed that the mec-8(+) larvae carrying the e444 or e669 minigenes driven by dpy-7 had higher levels of GFP in some head hypodermal cells than in hyp7, whereas larvae carrying the equivalent unc-52(+) minigene had comparable levels of expression in these cells. We suggest that these differences may be due to complex developmental regulation of unc-52 alternative splicing (see Discussion).
Expression of MEC-8 in embryonic muscle cells but not in hypodermis
stimulates alternative splicing of transcripts from a muscle-specific
unc-52 minigene
To test the idea that MEC-8 promotes alternative splicing of
unc-52 transcripts cell autonomously, we put extrachromosomal arrays
containing tissue-specific mec-8(+) expression constructs into
strains homozygous both for a mec-8 mutation and an integrated array,
mnIs25, that carries the muscle-specific minigene
Pmyo-3::unc-52(e444)::gfp (on its own, the particular array
mnIs25 gave very low GFP expression until close to hatching even in a
mec-8(+) background). The hlh-1 promoter was used to produce
full-length MEC-8 in muscle cell precursors and in differentiated muscle cells
throughout development and into adulthood
(Krause et al., 1990
;
Krause et al., 1994
), and the
dpy-7 promoter was used to produce MEC-8 in hypodermis. Each
extrachromosomal array also carried unc-36(+), and the animals were
otherwise homozygous mutant for unc-36. Antibody staining confirmed
that MEC-8 was expressed appropriately by the tissue-specific
mec-8(+) expression constructs. mec-8(u314) embryos carrying
either Pdpy-7::mec-8(+) or Phlh-1::mec-8(+) in a transgenic
array were stained with anti-MEC-8 serum and either with DM5.6, a monoclonal
antibody that recognizes the body-wall muscle myosin heavy chain A (MHC-A)
protein (Miller et al., 1983
;
Miller et al., 1986
), or with
MH2, a monoclonal antibody that recognizes UNC-52 isoforms found between
muscle cells and the hypodermis (Francis
and Waterston, 1991
; Rogalski
et al., 1993
). MEC-8 was detected in muscle cells but not
hypodermis of embryos carrying Phlh-1::mec-8(+)
(Fig. 4A-C) and in hypodermal
cells but not muscle cells of embryos carrying Pdpy-7::mec-8(+)
(Fig. 4D-F). Staining was
predominantly nuclear in both tissues, although weaker cytoplasmic staining
was often seen in cells with intense nuclear staining. The progeny of parents
carrying these constructs as well as
mnIs25[Pmyo-3::unc-52(e444)::gfp] were examined for GFP expression as
morphogenesis-stage embryos (comma to 2.5-fold elongation). Hermaphrodites
carrying the muscle-specific construct Phlh-1::mec-8(+) on an
extrachromosomal array segregated many embryos with clear expression of GFP in
muscle (compare Fig. 4H with
4G). The proportion of GFP-expressing embryos (0.41;
n=118) was comparable with the proportion of embryos that inherited
the extrachromosomal array (0.44; n=433), as ascertained by counting
non-Unc-36 animals segregated by the same strain. However, hermaphrodites
carrying the hypodermis-specific construct Pdpy-7::mec-8(+) on an
extrachromosomal array did not segregate any GFP-expressing embryos
(n=123); the ability of the hypodermis-specific construct to function
will be demonstrated in the next section. These data indicate that MEC-8
produced by embryonic muscle but not by embryonic hypodermis can regulate
alternative splicing of unc-52 minigene transcripts produced by
embryonic muscle.
|
Expression of MEC-8 in hypodermis but not in muscle suppresses
mec-8; unc-52(viable) synthetic lethality
mec-8; unc-52(e669) embryos arrest morphogenesis at the twofold
stage of elongation and have diminished levels of UNC-52
(Lundquist and Herman, 1994
;
Mullen et al., 1999
). These
observations indicate that MEC-8 regulates alternative splicing of
unc-52 transcripts prior to the twofold stage. To determine whether
MEC-8 is required in embryonic muscle or hypodermis, we tested the ability of
the tissue-specific mec-8 expression constructs described in the
previous section to rescue mec-8; unc-52(e669) synthetic lethality.
We were unable to recover viable mec-8; unc-52(e669) larvae carrying
the muscle-specific construct Phlh-1::mec-8(+), as segregants from
mec-8; unc-52(e669)/+; mnEx113 hermaphrodite parents
(Table 1, and Materials and
Methods), but mec-8; unc-52(e669) larvae carrying the
hypodermis-specific construct Pdpy-7::mec-8(+) were viable and
fertile (Table 1). These
results suggest that MEC-8 functions in the hypodermis to regulate alternative
splicing of unc-52 in embryos.
|
Overexpression of MEC-8 in hypodermis but not muscle suppresses
unc-52 uncoordination
mec-8 function is required to generate unc-52 transcripts
that lack exons 17 and 18 (the exon 15-19 and 16-19 splice forms)
(Lundquist et al., 1996
). We
hypothesized that higher-than-wild-type levels of MEC-8 might increase the
levels of these splice forms and thereby increase the amount of full-length
UNC-52 protein in animals carrying nonsense mutations in exon 17 or exon 18 of
unc-52. An increase in full-length UNC-52 protein should delay or
suppress the late-larval onset of paralysis exhibited by these
unc-52(viable) animals. We found that an extrachromosomal array
(mnEx52) containing multiple copies of an 8.5 kb genomic clone that
rescues all mec-8 phenotypes
(Lundquist et al., 1996
)
suppressed the paralysis conferred by unc-52(e669)
(Table 1). unc-52(e669);
mnEx52 egg-laying adults were only weakly paralyzed compared with
unc-52(e669) animals, which become paralyzed prior to the adult stage
(Gilchrist and Moerman,
1992
).
We tested whether or not MEC-8 overexpression in either muscle or
hypodermis would suppress the late-onset paralysis conferred by
unc-52(e669). Extrachromosomal arrays carrying
Phlh-1::mec-8(+) had no effect on the phenotypes of
unc-52(e669) or unc-52(su250e669ts) animals
(Table 1 and Materials and
Methods). The latter allele was tested because it is more sensitive to weak
suppression (Spike et al.,
2001
). By contrast, hypodermal expression of MEC-8 strongly
suppressed the paralysis caused by unc-52(e669). All three
extrachromosomal arrays containing the Pdpy-7::mec-8(+) construct
completely suppressed unc-52(e669)
(Table 1). One of the arrays,
mnEx136, was tested for its ability to suppress unc-52(e444)
and was also found to be a good suppressor of this allele. Mullen et al.
(Mullen et al., 1999
) showed
that the unc-52(e444) mutation leads to a great reduction after the
L4 stage in the UNC-52 protein associated with body wall muscles. We have
confirmed this using the UNC-52 antibody MH2, and we have shown that
mnEx136[Pdpy-7::mec-8(+) unc-36(+)] is an excellent suppressor of
this phenotype: hermaphrodites of genotype unc-52(e444); unc-36;
mnEx136[Pdpy-7::mec-8(+) unc-36(+)] segregated adult Unc-52 Unc-36
progeny that gave very little staining of UNC-52 in the matrix between
hypodermis and body wall muscle, and also segregated wild-type progeny that
stained well for UNC-52 (data not shown). The MH2 antibody recognizes UNC-52
isoforms that carry an exon 19-encoded epitope
(Rogalski et al., 1993
). These
UNC-52 proteins can only be generated in unc-52(e444) animals by
unc-52 mRNA isoforms that skip exon 18. These results therefore
support the idea that MEC-8 overexpression in larval hypodermis leads to an
increase in UNC-52 protein isoforms generated by alternative splicing.
Many animals carrying Pdpy-7::mec-8(+) were left-handed rollers as adults. Some animals carrying this construct in the arrays mnEx137 or mnEx138 became rollers even earlier during development, at the L4 stage; animals containing the mnEx136 array did not roll until adulthood. We suggest that this novel roller phenotype, like the suppression of unc-52(e669) and unc-52(e444) late-onset paralysis, is caused by high levels of MEC-8 in hypodermis. Our Pdpy-7::unc-52(+)::gfp minigene experiments reported above indicated that Pdpy-7 promoted strong hypodermal GFP expression in both embryos and L1-L4 larvae.
unc-52(+) is not required in larval or adult muscle cells
for wild-type development
The mec-8 overexpression experiments suggest that most, if not
all, unc-52 pre-mRNAs capable of undergoing nec-8-dependent
alternative splicing are produced by the hypodermis in both embryos and
larvae. We therefore expected that the focus of unc-52 action for
muscle development in both embryos and larvae would be in hypodermis, not
muscle; that is, unc-52 should affect muscle development and function
cell non-autonomously. To test this prediction, we analyzed unc-52
genetic mosaics. Our first set of mosaics made use of the viable mutation
unc-52(e669), which causes the onset of muscle paralysis in L4
larvae.
The first C. elegans embryonic division generates the daughter
cells AB and P1 (Sulston et al.,
1983
). All but one of the 95 body-wall muscle cells descend from
P1; cells contributing to the hypodermis descend from both P1 and AB. These
and other relevant details of the cell lineage are shown in
Fig. 5. To determine the
phenotype of animals lacking unc-52(+) in 94 of 95 muscle
cells, we looked among the progeny of unc-52(e669); unc-36;
mnEx126[unc-52(+) unc-36(+) sur-5::gfp] hermaphrodites
for animals in which mnEx126 was absent in all P1-derived cells. The
inclusion of sur-5::gfp in the array provided a useful cell
autonomous marker for tracking cell-by-cell inheritance of the array
(Yochem et al., 1998
). We
found that six out of seven animals with array loss at P1 did not become
paralyzed either as larvae or as adults
(Fig. 5). We suspect that the
one exceptional animal either had suffered an additional loss of the array or
was defective for unc-52(+) expression in the AB lineage. We
occasionally found apparently non-mosaic animals that were Unc-52. However,
animals that failed to inherit the array were invariably Unc-52. Animals with
losses by the cell EMS were also non-Unc-52. One of these animals had a
slow-moving Unc-36-like phenotype but no muscle paralysis. We found that this
animal had a second loss in cells derived from the AB blastomere
(Fig. 5), consistent with the
observation that unc-36(+) is required in the neurons that
descend from ABp (Kenyon,
1986
). We looked for other Unc-36 non-Unc-52 animals and found one
with a loss at AB and four with losses at ABp
(Fig. 5). We conclude that
unc-52(+) is not required in muscle cells to prevent the
larval paralysis caused by unc-52(e669) and that the most likely
focus of action is in the hypodermis, as unc-52(+)
expression by either AB or P1 descendants is sufficient to prevent the onset
of the uncoordination conferred by unc-52(e669).
|
unc-52(+) is not required in body-wall muscles for embryonic
viability
To examine where unc-52 function is required in embryos, we
performed mosaic analysis using the null allele unc-52(st549).
Embryos homozygous for unc-52(st549) arrest at the twofold stage of
elongation with paralyzed body wall muscles lacking a myofilament lattice
(Williams and Waterston,
1994
). We screened the progeny of unc-52(st549);
mnEx133[unc-52(+) sur-5::gfp] hermaphrodites for genetic
mosaics, again using the cell autonomous GFP expression conferred by
sur-5::gfp to track array loss in the cell lineage. We found eight
viable but abnormal animals with losses at P1 [referred to as P1(-) mosaics]
and seven wild-type animals with losses at EMS
(Fig. 6). The P1(-) mosaics
were small and dumpy, tended to roll or twist while moving and had a dorsal
bump opposite the vulva. Adult P1(-) mosaic animals were fertile, although
their progeny were all arrested embryos, as expected, as the germline descends
from P1. The unc-52(st549); mnEx133 P1(-) mosaics, which lack
unc-52(+) in 94 of 95 body wall muscle cells, were not
paralyzed. We stained two adult P1(-) mosaics with the myosin heavy chain A
antibody (Miller et al., 1983
;
Miller et al., 1986
). Muscle
cells throughout the bodies of both animals had formed myofilament lattices.
We conclude that unc-52(+) is not required in body-wall
muscles for embryo viability or myofilament lattice assembly.
|
unc-52(st549); mnEx133 animals that resembled mosaics with losses
at P1 were found that had extrachromosomal array losses at P2 and C
(Fig. 6). These mosaics suggest
that the body shape defects seen in P1(-) mosaics were caused by a partial
requirement for unc-52(+) function in C-derived hypodermis
during embryogenesis (see Discussion). Additional abnormalities were also
observed in specific unc-52(st549); mnEx133 mosaic animals. Four
P1(-) mosaics were allowed to develop into older egg-laying adults; two of
these animals were bloated with arrested embryos, and the other two discharged
gonadal and intestinal cells through the vulva. Differential interference
contrast microscopy also suggested that mosaics with losses at P1 or C had
misplaced seam cells. Seam cells in larvae are found in two lateral rows, one
row per side. Just before the adult stage, neighboring seam cells fuse and
form longitudinal cuticular structures called alae
(Singh and Sulston, 1978
).
Alae were branched in the mid-body region of the adult P1(-) and C(-) mosaics,
but not the EMS(-) mosaics.
| DISCUSSION |
|---|
|
|
|---|
Evidence that unc-52(+) is required in hypodermal cells
Our mosaic analysis has shown that unc-52 function is not required
in muscle cells for embryo viability or wild-type larval development and
suggests that hypodermis is the focus of unc-52 function in both
embryos and larvae. Hypodermis is the only tissue with substantial
contributions from both AB and P1, and the defects seen in
unc-52(e669) larvae were rescued by unc-52(+)
expression in either AB or P1 descendants. Although unc-52 function
is not required in the descendants of P1 for embryonic viability or
myofilament lattice assembly, unc-52(st549) larvae lacking
unc-52(+) in all descendants of P1 were abnormal: they were
dumpy and twisted with branched alae. If these abnormalities were caused by a
partial requirement for unc-52(+) in body-wall muscle cells,
we would have expected the phenotypes of EMS(-) and C(-) mosaics to be similar
to each other and less severe than the phenotypes of P1(-) mosaics (EMS, C and
P1 generate 42, 32 and 94 body wall muscle cells, respectively), but we found
that C(-) mosaics were just as abnormal as P1(-) mosaics, and EMS(-) mosaics
were wild type. These observations are consistent with a partial requirement
for unc-52(+) in C-derived hypodermis; C is the only founder
cell descended from P1 that contributes to hypodermis.
UNC-52 accumulation in the basement membrane between muscle and hypodermis
has been first visualized at the beginning of morphogenesis
(Hresko et al., 1994
). The
C-derived hypodermal cells form the posterior half of the dorsal hypodermis in
pre-morphogenesis stage embryos (Sulston
et al., 1983
). At about the 1.5-fold stage of embryonic
elongation, the C-derived and AB-derived hypodermal cells fuse to form the
large hypodermal syncytium hyp7
(Podbilewicz and White, 1994
).
Thus, after hypodermal fusion, hyp7 in P1(-) and C(-) mosaics will have
unc-52(+) function contributed by the AB lineage. This may
explain why myofilament lattice formation seems to be relatively unaffected in
these mosaics. However, the stage prior to fusion, when C-derived hypodermal
cells fail to produce UNC-52, may be crucial for proper positioning of
hypodermal seam cells and elongation of hypodermis.
Body-wall muscles may recruit UNC-52
Previous experiments, in which UNC-52 could be visualized faintly in muscle
cells but not in hypodermal cells of early elongation-stage embryos by several
UNC-52-specific antibodies (Mullen et al.,
1999
), suggested that UNC-52 found in embryonic basement membranes
between body-wall muscle and hypodermis was produced exclusively by muscle
cells (Moerman et al., 1996
;
Mullen et al., 1999
), but our
experiments indicate that if UNC-52 is produced by body muscle, it is not
crucial for embryonic development. Why was UNC-52 not detected in hypodermal
cells? Possibly UNC-52 produced in hypodermis is exported more rapidly or is
less accessible to antibodies than UNC-52 produced in muscle cells.
Alternatively, it is possible that muscle cells produce little if any UNC-52
but accumulate it by endocytosis, which could be part of a process of UNC-52
signal reception by muscle. There is growing evidence that muscle and
hypodermis communicate during myofilament lattice assembly and elongation
(Chin-Sang and Chisholm, 2000
).
Laser ablation of muscle cell precursors caused gaps in the distribution of
extracellular UNC-52 in the regions corresponding to the missing muscles
(Moerman et al., 1996
).
Assuming that much of the missing UNC-52 would normally have been produced by
hypodermis, we suggest that the muscle is needed to bind and concentrate
UNC-52 produced by adjacent hypodermis. Similar cell ablation experiments have
indicated that myotactin, another C. elegans protein produced by the
hypodermis, is recruited to the hypodermal membrane near muscle cells by the
adjacent muscle cells (Hresko et al.,
1999
). Myotactin is a transmembrane protein with a large
extracellular domain and has a localization pattern similar to that of UNC-52
at certain stages of embryonic development
(Hresko et al., 1994
).
Spatial regulation of unc-52 alternative splicing
Antibodies specific for an UNC-52 epitope encoded by exon 19
(Rogalski et al., 1993
) did
not stain mec-8; unc-52(e444) embryos
(Lundquist et al., 1996
) but
did stain a region between the anterior-most body-wall muscle cells and
hypodermis of mec-8; unc-52(e669) embryos
(Mullen et al., 1999
). These
results suggest that certain anterior-most embryonic cells produce a
mec-8-independent unc-52 transcript that skips exon 17 (and
hence e669) but not exon 18 (and e444). We found that
mec-8 embryos carrying a muscle-specific unc-52(e669)
minigene but not a muscle-specific unc-52(e444) minigene accumulated
GFP in the nuclei of the one or two anterior-most muscle cells per quadrant
(Fig. 3H). These cells could be
the source of UNC-52 in mec-8; unc-52(e669) embryos. UNC-52-specific
antibodies have also been shown to stain unc-52(e444) and
unc-52(e669) adults (Mullen et
al., 1999
) in the head but not in the main body region. The
pattern of GFP accumulation we observed in wild-type animals carrying
hypodermally expressed unc-52(e444) and unc-52(e669)
minigenes suggests that UNC-52 in these animals could come from head
hypodermal cells.
MEC-8 regulates unc-52 alternative splicing primarily in
embryos
RT-PCR experiments have indicated that the unc-52 mRNA isoform
containing exons 16-17-18-19 is more abundant in larvae than the
mec-8-dependent 16-19 isoform
(Spike et al., 2001
) (and data
not shown). Similar experiments have indicated that the 16-19 isoform is most
abundant in embryos (G. Mullen, personal communication; C. Spike, data not
shown), suggesting that endogenous MEC-8 may promote unc-52
alternative splicing primarily in embryos. This is consistent with the
developmental expression pattern of MEC-8 in hypodermal and muscle cells, and
with the reduction of GFP in hyp7 after embryogenesis in animals carrying
hypodermal unc-52(e444) or unc-52(e669) minigenes. It seems
likely that GFP levels decrease, at least in part, because there are reduced
levels of MEC-8 in the main hypodermal syncytium of larvae.
let-2, which encodes a type IV collagen, and nid-1, which
encodes nidogen, also produce different protein isoforms in embryos and larvae
(Kang and Kramer, 2000
;
Sibley et al., 1993
). These
proteins (along with UNC-52) are components of basement membranes in C.
elegans, including the basement membrane between muscle and hypodermis
(Graham et al., 1997
;
Kang and Kramer, 2000
). C.
elegans larvae and embryos are subject to different mechanical stresses
and may therefore require substantially different basement membranes.
MEC-8 regulates unc-52 alternative splicing primarily in the
hypodermis
The properties of our hypodermis-expressing mec-8(+)
constructs, as well as the embryonic MEC-8 expression pattern, suggest that
MEC-8 regulates the alternative splicing of unc-52 transcripts in the
hypodermis. We did see that muscle-expressing unc-52(e444) and
unc-52(e669) minigenes exhibited mec-8-dependent GFP
accumulation in early morphogenesis-stage embryos, but GFP expression was very
low and was increased by enhancing expression of MEC-8 in muscle; embryos
carrying the wild-type versions of these minigenes expressed GFP abundantly at
the same stage. We suggest that MEC-8 is present at low levels in embryonic
muscle cells and that only a fraction of the unc-52 minigene
pre-mRNAs underwent mec-8-dependent alternative splicing. By
contrast, the amount of embryonic GFP produced by the hypodermis-expressing
unc-52(e444) and unc-52(e669) minigenes was comparable with
that expressed by the wild-type versions of these minigenes. Consistent with
the larval expression pattern of MEC-8, unc-52(e444) and
unc-52(e669) minigenes expressed in hypodermis, but not muscle, were
mec-8-dependent in larvae.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Arikawa-Hirasawa, E., Watanabe, H., Takami, H., Hassell, J. R. and Yamada, Y. (1999). Perlecan is essential for cartilage and cephalic development. Nat. Genet. 23,354 -358.[CrossRef][Medline]
Arikawa-Hirasawa, E., Wilcox, W. R., Le, A. H., Silverman, N., Govindraj, P., Hassell, J. R. and Yamada, Y. (2001). Dyssegmental dysplasia, Silverman-Handmaker type, is caused by functional null mutations of the perlecan gene. Nat. Genet. 27,431 -434.[CrossRef][Medline]
Bar-Peled, M. and Raikhel, N. V. (1996). A method for isolation and purification of specific antibodies to a protein fused to the GST. Anal. Biochem. 241,140 -142.[CrossRef][Medline]
Bowerman, B., Draper, B. W., Mello, C. C. and Priess, J. R. (1993). The maternal gene skn-1 encodes a protein that is distributed unequally in early C. elegans embryos. Cell 74,443 -452.[CrossRef][Medline]
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Chin-Sang, I. D. and Chisholm, A. D. (2000). Form of the worm: genetics of epidermal morphogenesis in C. elegans.Trends Genet. 16,544 -551.[CrossRef][Medline]
Costell, M., Gustafsson, E., Aszodi, A., Morgelin, M., Bloch,
W., Hunziker, E., Addicks, K., Timpl, R. and Fassler, R.
(1999). Perlecan maintains the integrity of cartilage and some
basement membranes. J. Cell Biol.
147,1109
-1122.
Davies, A. G., Spike, C. A., Shaw, J. E. and Herman, R. K.
(1999). Functional overlap between the mec-8 gene and
five sym genes in Caenorhabditis elegans.Genetics 153,117
-134.
Finney, M. and Ruvkun, G. (1990). The unc-86 gene product couples cell lineage and cell identity in C. elegans. Cell 63,895 -905.[CrossRef][Medline]
Francis, R. and Waterston, R. H. (1991). Muscle
cell attachment in Caenorhabditis elegans. J. Cell
Biol. 114,465
-479.
Gilchrist, E. J. and Moerman, D. G. (1992). Mutations in the sup-38 gene of Caenorhabditis elegans suppress muscle-attachment defects in unc-52 mutants. Genetics 132,431 -442.[Abstract]
Gilleard, J. S., Barry, J. D. and Johnstone, I. L. (1997). cis regulatory requirements for hypodermal cell-specific expression of the Caenorhabditis elegans cuticle collagen gene dpy-7. Mol. Cell Biol. 17,2301 -2311.[Abstract]
Graham, P. L., Johnson, J. J., Wang, S., Sibley, M. H., Gupta,
M. C. and Kramer, J. M. (1997). Type IV collagen is
detectable in most, but not all, basement membranes of Caenorhabditis
elegans and assembles on tissues that do not express it. J.
Cell Biol. 137,1171
-1183.
Hodgkin, J. (1997). Genetics. In C. elegans II (ed. D. L. Riddle, T. Blumenthal, B. J. Meyer and J. R. Priess), pp. 881-1047. Plainview, NY: Cold Spring Harbor Laboratory Press.
Hresko, M. C., Williams, B. D. and Waterston, R. H.
(1994). Assembly of body wall muscle and muscle cell attachment
structures in Caenorhabditis elegans. J. Cell Biol.
124,491
-506.
Hresko, M. C., Schriefer, L. A., Shrimankar, P. and Waterston,
R. H. (1999). Myotactin, a novel hypodermal protein involved
in muscle-cell adhesion in Caenorhabditis elegans. J. Cell
Biol. 146,659
-672.
Kang, S. H. and Kramer, J. M. (2000). Nidogen
is nonessential and not required for normal type IV collagen localization in
Caenorhabditis elegans. Mol. Biol. Cell
11,3911
-3923.
Kenyon, C. (1986). A gene involved in the development of the posterior body region of C. elegans.Cell 46,477 -487.[CrossRef][Medline]
Kondo, K., Makovec, B., Waterston, R. H. and Hodgkin, J. (1990). Genetic and molecular analysis of eight tRNATRP amber suppressors in Caenorhabditis elegans. J. Mol. Biol. 215,7 -19.[CrossRef][Medline]
Krause, M., Fire, A., Harrison, S. W., Priess, J. and Weintraub, H. (1990). CeMyoD accumulation defines the body wall muscle cell fate during C. elegans embryogenesis. Cell 63,907 -919.[CrossRef][Medline]
Krause, M., Harrison, S. W., Xu, S. Q., Chen, L. and Fire, A. (1994). Elements regulating cell- and stage-specific expression of the C. elegans MyoD family homolog hlh-1.Dev. Biol. 166,133 -148.[CrossRef][Medline]
Labouesse, M., Hartwieg, E. and Horvitz, H. R. (1996). The Caenorhabditis elegans LIN-26 protein is required to specify and/or maintain all non-neuronal ectodermal cell fates. Development 122,2579 -2588.[Abstract]
Lopez, A. J. (1998). Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation. Annu. Rev. Genet. 32,279 -305.[CrossRef][Medline]
Lundquist, E. A. and Herman, R. K. (1994). The mec-8 gene of Caenorhabditis elegans affects muscle and sensory neuron function and interacts with three other genes: unc-52, smu-1 and smu-2. Genetics 138,83 -101.[Abstract]
Lundquist, E. A., Herman, R. K., Rogalski, T. M., Mullen, G. P., Moerman, D. G. and Shaw, J. E. (1996). The mec-8 gene of C. elegans encodes a protein with two RNA recognition motifs and regulates alternative splicing of unc-52 transcripts. Development 122,1601 -1610.[Abstract]
Mello, C. and Fire, A. (1995). DNA transformation. In Caenorhabditis elegans: Modern Biological Analysis of an Organism, Vol. 48 (ed. H. F. Epstein and D. C. Shakes), pp. 451-482. San Diego, CA: Academic Press.
Miller, D. M., 3rd, Ortiz, I., Berliner, G. C. and Epstein, H. F. (1983). Differential localization of two myosins within nematode thick filaments. Cell 34,477 -490.[CrossRef][Medline]
Miller, D. M., Stockdale, F. E. and Karn, J.
(1986). Immunological identification of the genes encoding the
four myosin heavy chain isoforms of Caenorhabditis elegans. Proc.
Natl. Acad. Sci. USA 83,2305
-2309.
Moerman, D. G., Hutter, H., Mullen, G. P. and Schnabel, R. (1996). Cell autonomous expression of perlecan and plasticity of cell shape in embryonic muscle of Caenorhabditis elegans. Dev. Biol. 173,228 -242.[CrossRef][Medline]
Mullen, G. P., Rogalski, T. M., Bush, J. A., Gorji, P. R. and
Moerman, D. G. (1999). Complex patterns of alternative
splicing mediate the spatial and temporal distribution of perlecan/UNC-52 in
Caenorhabditis elegans. Mol. Biol. Cell
10,3205
-3221.
Nicole, S., Davoine, C. S., Topaloglu, H., Cattolico, L., Barral, D., Beighton, P., Hamida, C. B., Hammouda, H., Cruaud, C., White, P. S. et al. (2000). Perlecan, the major proteoglycan of basement membranes, is altered in patients with Schwartz-Jampel syndrome (chondrodystrophic myotonia). Nat. Genet. 26,480 -483.[CrossRef][Medline]
Noonan, D. M. and Hassell, J. R. (1993). Perlecan, the large low-density proteoglycan of basement membranes: structure and variant forms. Kidney Int. 43, 53-60.[Medline]
Podbilewicz, B. and White, J. G. (1994). Cell fusions in the developing epithelia of C. elegans. Dev. Biol. 161,408 -424.[CrossRef][Medline]
Rogalski, T. M., Williams, B. D., Mullen, G. P. and Moerman, D.
G. (1993). Products of the unc-52 gene in
Caenorhabditis elegans are homologous to the core protein of the
mammalian basement membrane heparan sulfate proteoglycan. Genes
Dev. 7,1471
-1484.
Rogalski, T. M., Gilchrist, E. J., Mullen, G. P. and Moerman, D. G. (1995). Mutations in the unc-52 gene responsible for body wall muscle defects in adult Caenorhabditis elegans are located in alternatively spliced exons. Genetics 139,159 -169.[Abstract]
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Sibley, M. H., Johnson, J. J., Mello, C. C. and Kramer, J.
M. (1993). Genetic identification, sequence, and alternative
splicing of the Caenorhabditis elegans alpha 2(IV) collagen gene.
J. Cell Biol. 123,255
-264.
Singh, R. N. and Sulston, J. E. (1978). Some observations on moulting in Caenorhabditis elegans.Nematologica 24,63 -71.
Spike, C. A., Shaw, J. E. and Herman, R. K.
(2001). Analysis of smu-1, a gene that regulates the
alternative splicing of unc-52 pre-mRNA in Caenorhabditis
elegans. Mol. Cell Biol. 21,4985
-4995.
Sulston, J. E., Schierenberg, E., White, J. G. and Thomson, J. N. (1983). The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev. Biol. 100,64 -119.[CrossRef][Medline]
Williams, B. D. and Waterston, R. H. (1994).
Genes critical for muscle development and function in Caenorhabditis
elegans identified through lethal mutations. J. Cell
Biol. 124,475
-490.
Yochem, J., Gu, T. and Han, M. (1998). A new
marker for mosaic analysis in Caenorhabditis elegans indicates a
fusion between hyp6 and hyp7, two major components of the hypodermis.
Genetics 149,1323
-1334.
This article has been cited by other articles:
![]() |
M. C Farach-Carson and D. D Carson Perlecan a multifunctional extracellular proteoglycan scaffold Glycobiology, September 1, 2007; 17(9): 897 - 905. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sugaya, E. Hongo, Y. Ishihara, and H. Tsuji The conserved role of Smu1 in splicing is characterized in its mammalian temperature-sensitive mutant J. Cell Sci., December 1, 2006; 119(23): 4944 - 4951. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Suzuki and M. Han Genetic redundancy masks diverse functions of the tumor suppressor gene PTEN during C. elegans development. Genes & Dev., February 15, 2006; 20(4): 423 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Anyanful, K. Ono, R. C. Johnsen, H. Ly, V. Jensen, D. L. Baillie, and S. Ono The RNA-binding protein SUP-12 controls muscle-specific splicing of the ADF/cofilin pre-mRNA in C. elegans J. Cell Biol., November 22, 2004; 167(4): 639 - 647. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yochem, L. R. Bell, and R. K. Herman The Identities of sym-2, sym-3 and sym-4, Three Genes That Are Synthetically Lethal With mec-8 in Caenorhabditis elegans Genetics, November 1, 2004; 168(3): 1293 - 1306. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Spartz, R. K. Herman, and J. E. Shaw SMU-2 and SMU-1, Caenorhabditis elegans Homologs of Mammalian Spliceosome-Associated Proteins RED and fSAP57, Work Together To Affect Splice Site Choice Mol. Cell. Biol., August 1, 2004; 24(15): 6811 - 6823. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Jiang and J. R. Couchman Perlecan and Tumor Angiogenesis J. Histochem. Cytochem., November 1, 2003; 51(11): 1393 - 1410. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yochem and R. K. Herman Investigating C. elegans development through mosaic analysis Development, October 15, 2003; 130(20): 4761 - 4768. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-c. Huang, D. H. Hall, E. M. Hedgecock, G. Kao, V. Karantza, B. E. Vogel, H. Hutter, A. D. Chisholm, P. D. Yurchenco, and W. G. Wadsworth Laminin {alpha} subunits and their role in C. elegans development Development, July 15, 2003; 130(14): 3343 - 3358. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||