|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
DEVELOPMENT AND DISEASE |
1 Institute of Neuroscience, University of Oregon, Eugene, OR 97403, USA
2 Center for Cancer Research, Department of Biology, Massachusetts Institute of
Technology, 40 Ames Street, E17-341, Cambridge, MA 02139, USA
3 MPI für Entwicklungsbiologie, Spemannstr. 35/III, D-72076 Tübingen,
Germany
4 Division of Basic Science, Fred Hutchinson Cancer Research Center, B2-152,
1100 Fairview Ave. N., Seattle, WA 98109-1024, USA
5 Gene Tools, LLC, One Summerton Way, Philomath, OR 97370, USA
6 Institute of Molecular Biology, Academia Sinica, Nankang, Taipei, Taiwan
ROC
* Author for correspondence (e-mail: jpostle{at}oregon.uoregon.edu)
Accepted 12 August 2002
| SUMMARY |
|---|
|
|
|---|
Key words: sox9a, col2a1, titin, Zebrafish, Chondrogenesis, Pharyngeal arches, Campomelic dysplasia, Cartilage
| INTRODUCTION |
|---|
|
|
|---|
Most cartilage replacement bones fail to develop normally in individuals
with campomelic dysplasia (CD), causing macrocephaly, small jaw, cleft palate,
lowset ears and sometimes lack of olfactory bulbs. Individuals with CD often
have underdeveloped sclerotome derivatives, including non-mineralized thoracic
pedicles and 11, rather than 12, pairs of ribs; and they have poorly developed
limbs, including bowed limb bones, hypoplastic scapula and an insufficiently
ossified pelvis (Houston et al.,
1983
; McKusick,
1990
; Mansour et al.,
1995
). In addition, most XY individuals with CD display a variable
female phenotype. The cartilage and sex-reversal phenotypes of CD are both
caused by mutations in the transcription factor gene SOX9
(Foster et al., 1994
;
Wagner et al., 1994
;
Hageman et al., 1998
;
Cameron et al., 1996
;
Huang et al., 1999
;
Vidal et al., 2001
).
Individuals with CD are heterozygous for new mutations in SOX9,
showing that CD is due to a dominant lethal mutation, either from
haploinsufficiency or a dominant-negative effect. Mutations in the coding
region of SOX9 or in presumed regulatory elements can cause CD or a
similar phenotype in mouse (Wagner et al.,
1994
; Foster et al.,
1994
; Kwok et al.,
1995
; Cameron et al.,
1996
; Wunderle et al.,
1998
). Thus, phenotypic analysis of CD shows that SOX9 is
a regulator of chondrogenesis, but because no homozygous tetrapod mutant
animals have been observed, and the affected skeletal elements in lethal
heterozygotes are merely hypoplastic, we do not know the extent of the
function of the gene.
Sox9 belongs to a family of DNA-binding proteins that contain a 79 amino
acid long HMG (high mobility group) domain with at least 50% similarity to
that of SRY, the sex-determining factor on the Y chromosome
(Wright et al., 1993
;
Wegner, 1999
). Sox proteins
bind to a seven base pair sequence in the minor groove of DNA
(Lefebvre et al., 1997
;
Ng et al., 1997
) and bend DNA
(Conner et al., 1994; Werner et al.,
1995
). Sox9 may also participate in transcript splicing
(Ohe et al., 2002
). The SOX9
protein has a C-terminal transcription activation domain
(Südbeck et al., 1996
;
Ng et al., 1997
), suggesting
that it acts by regulating expression of other genes.
Consistent with its role in chondrogenesis, Sox9 is expressed in
the pharyngeal arches and neurocranium, the sclerotomes and the lateral plate
mesoderm (Lefebvre et al.,
1997
; Chiang et al.,
2001
). In these domains, the expression of Sox9 slightly
precedes and directly regulates the expression of Col2a1, which
encodes the major collagen of cartilage
(Wright et al., 1995
;
Bell et al., 1997
;
Lefebvre et al., 1997
;
Ng et al., 1997
;
Zhao et al., 1997
;
Chiang et al., 2001
).
Despite this knowledge of Sox9 activity, we have insufficient understanding
of the morphogenetic roles Sox9 plays in chondrogenesis or the pathogenesis of
CD. Heterozygous Sox9 mutant mice show phenotypes similar to
individuals with CD and die at birth, so permanent lines have not been
established (Bi et al., 2001
).
Delayed or defective pre-cartilaginous condensations are present in
heterozygous Sox9 mutant mouse embryos, but the precise morphogenetic
steps that require Sox9 function remain obscure. Some bones showed
premature mineralization in the heterozygous mouse embryos, suggesting that
Sox9 plays a role in regulating the transition to hypertrophic
chondrocytes in the growth plates. Sox9 is thought to regulate this
transition by mediating the effects of parathyroid hormone related peptide
(PTHrP) (Huang et al.,
2001
).
We have shown that the zebrafish genome contains two duplicate orthologs of
the human SOX9 gene, called sox9a and sox9b, and
that these map on zebrafish chromosomes that are duplicates of much of human
chromosome 17, the location of SOX9
(Chiang et al., 2001
). The two
zebrafish sox9 genes apparently arose in a whole genome duplication
event hypothesized to have taken place near the base of the teleost radiation
(Postlethwait et al., 1998
;
Amores et al., 1998
). The
sox9a and sox9b genes are expressed in partially overlapping
patterns that together approximate the expression pattern of Sox9 in
mouse (Wright et al., 1995
;
Chiang et al., 2001
), as
predicted by the duplication, degeneration, complementation hypothesis
(Force et al., 1999
).
Interestingly, however, in zebrafish the testis expresses sox9a but
the ovary expresses sox9b (Chiang
et al., 2001
), whereas in mammals, only the testis expresses
Sox9 (Morais da Silva et al.,
1996
). We reasoned that a mutation in one of the two zebrafish
genes might not be a dominant lethal mutation as in mammals, and so we
investigated recessive lethal zebrafish mutations with phenotypes similar to
individuals with CD. We show that two alleles of jellyfish
(jef), one resulting from chemical mutagenesis
(jeftw37) (Piotrowski
et al., 1996
; van Eeden et
al., 1996
) and the other from the insertion of a retrovirus
(Amsterdam et al., 1999
),
disrupt sox9a. Confocal microscopy demonstrated that jef
(sox9a) is required not for precartilage condensation formation, but
for overt differentiation of cartilage and for three morphogenetic processes:
stacking, shaping and individuation. The results suggest that sox9a
or its downstream targets, perhaps including extracellular matrix proteins,
play morphogenetic roles in chondrogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Morpholinos
Morpholino antisense oligonucleotides (MO) were obtained from Gene Tools
(Philomath, OR) with the sequences: intron 1 splice donor junction (i1d),
AATGAATTACTCACCTCCAAAGTTT; and intron-2 splice donor junction (i2d),
CGAGTCAAGTTTAGTGTCCCACCTG. Morpholinos were injected as described
(Draper et al., 2001
). In the
i1d MO, the 14th base from the 5' end, a C, pairs with the G immediately
following the splice junction (the one mutated in
jeftw37). In MO i2d, the 4th base from the 3' end, a
C, pairs with the conserved G just after the splice junction.
Mapping
To map jeftw37, we identified a single strand
conformation polymorphism (SSCP) (see
Postlethwait et al., 1998
) in
sox9a [(mapping primers were sox9a.+9 (CTTTCGCAGACACCAGCAGA) and
sox9a -190 (CAGGTAGGGGTCGAGGAGATTCAT)]. Females heterozygous for
jeftw37 were mated to WIK wild-type males, and
the F1 were crossed to make an F2, which were scored for
recombination with microsatellite markers
(Knapik et al., 1998
;
Shimoda et al., 1999
) near
sox9a and sox9b (Chiang
et al., 2001
). The 95% confidence interval around the map distance
between jeftw37 and an SSCP in the 5'
untranslated region of sox9a was calculated according to Crow
(Crow, 1950
). To map the
insertion allele jefhi1134, we used sox9a-RT2
(CTCCTCCACGAAGGGACGCTTTTCCA), t2a (GGCACTGAGAGTTTTCTGCATCTG) and 5'LTR
(AGACCCCACCTGTAGGTTTGGC) (see Fig.
3).
|
Cloning
Genomic clones of sox9a were isolated by amplifying genomic DNA
isolated from Oregon AB wild type, Tübingen AB (TÜ, the genetic
background of jeftw37) or homozygous
jeftw37 embryos. The forward cloning primer binds
in the 5' untranslated region (UTR, sox9a.+11:
TTCGCAGACACCAGCAGACAACAAA) and the reverse primer binds near the end of the
3' UTR (sox9a.-1784: GTCTTTCCCATCATGCACTGAACG). These primers amplified
a 3.6 kb fragment including most of exon 1, intron 1, exon 2 and intron 2, and
nearly all of exon 3. To minimize PCR errors, Platinum Taq DNA polymerase high
fidelity (CAT#11304-029 from Gibco BRL) was used in a touch-down PCR protocol.
A BAC-containing sox9a (clone 174 (I13) was identified by screening
the BAC zebrafish library-8549 from Incyte Genomics with the primers
sox9a.+441 (CCATGCCGGTGAGGGTGAAC) and sox9a.-691
(CTTATAGTCGGGGTGATCTTTCTTGTG). We cloned and sequenced DNA flanking the
pro-viral insert linked to the hi1134 mutant phenotype using inverse
PCR as previously described (Amsterdam et
al., 1999
).
RNA protection assays
Ribonuclease protection assays used the RPA III kit (Ambion, #1414)
according to manufacturer's instructions. For each sample, RNA was extracted
from about 50 embryos, and 10 µg of total RNA was loaded per lane. The
protection probe was a 402 bp long PCR fragment from nucleotide 494 to 896 of
the cDNA, including 110 bp of exon 1, all 252 bp of exon 2 and 40 bp of
exon-3. The antisense RNA probe for sox9a was generated by amplifying
a fragment of the sox9a cDNA using the primers sox9a.f2
(CCGATGAACGCGTTTATGGTGT) and sox9a.r2 (TTTTCGGGGTGGTGGGAGGAG). The PCR product
was cloned into the pCR4-TOP0 vector (Invitrogen; catalog number K4575-J10).
The probe was made using MAXIscript Invitro Transcription T3/T7 Kit (catalog
number 1326). The amount of protected fragment was quantified using a Storm
860 storage phosphor system (Johnson et
al., 1990
) with ImageQuant 4.2 software (Molecular Dynamics,
Sunnyvale, CA). Normalization used the ubiquitously expressed housekeeping
gene ornithine decarboxylase (odc), expressed sequence tag
clone fc54f04; M. Clark and S. Johnson, WUZGR;
http//zfish.wustl.edu)
as an internal control) (see Draper et
al., 2001
).
RT-PCR experiments to amplify the sox9a message from jefhi1134 mutants used the primers sox9a.F (CCATGCCGGTGAGGGTGAAC) and sox9a.R (CGTTCGGCGGGAGGTATTGG).
| RESULTS |
|---|
|
|
|---|
|
A screen for lethal mutations induced by retroviral insertion
(Amsterdam et al., 1999
;
Burgess and Hopkins, 2000
)
identified a mutation (hi1134) giving a phenotype similar to that of
jeftw37 (Fig.
1I-L). To determine whether the hi1134 mutation is
allelic to jeftw37, we mated a male heterozygous
for hi1134 to a female heterozygous for
jeftw37 and observed an approx. Mendelian ratio
of phenotypically mutant offspring (37 wild-type individuals and nine
phenotypically jellyfish individuals;
Fig. 1M-P). Because these
mutations fail to complement, we call the insertion allele
jefhi1134.
Alcian staining demonstrated that all neurocranial cartilage and most cartilage elements of the pharyngeal arches were missing from animals homozygous for jeftw37 or jefhi1134, or animals heterozygous for the two alleles (Fig. 1C,G,K,O). Small regions of Alcian-positive material remained in both jeftw37 and jefhi1134 homozygotes in approximately the position expected for Meckel's cartilage and the ventral region of the ceratohyal cartilage. In addition, cells in the pharyngeal endoderm, possibly mucus secreting cells, were Alcian positive in both wild-type and mutant embryos. In the pectoral girdle, mutant animals lacked the scapulocoracoid cartilage, but the cleithrum bone and endoskeletal disk cartilage appeared normal (Fig. 1D,H,L,P). We conclude that many cartilage elements require jef activity.
Molecular genetic nature of
jeftw37
The jeftw37 mutation
Because the phenotype of jef mutations is similar to the phenotype
of people with CD, we tried to rule out that sox9a or sox9b
is disrupted in jeftw37. Bulked segregant
analysis (Postlethwait et al.,
1994
) of an F2 mapping cross revealed linkage to
microsatellite marker z1176 on the upper arm of LG12 near
sox9a, thus ruling out sox9b on LG3 as a candidate. We
mapped jeftw37 at higher resolution relative to a
polymorphism in sox9a, and uncovered no recombinants between
jeftw37 and sox9a among 491
F2 diploid embryos. This represents 982 meioses, and a distance of
0.1±0.2 cM (centiMorgan) with 95% confidence. Thus, if there are on
average 600 kb per cM (Postlethwait et
al., 1994
), this would be a distance of 60±120 kb. We
conclude that jeftw37 maps very close to or
within the sox9a gene.
To determine whether jeftw37 lesions the sox9a gene, we cloned and sequenced sox9a genomic DNA from homozygous jeftw37 embryos (Accession Number, AY090036) and compared it with genomic DNA cloned from the wild-type stocks AB (Accession Number, AY090034) and TÜ (Accession Number, AY090035). We found differences between the three strains at 49 locations in the 3560 bp consensus sequence. The two wild-type strains differed at 48 positions, and at the remaining position, the two wild-type strains were the same, but the jeftw37 strain was different. All but one of the 48 differences between the two wild strains were in non-translated parts of the gene, the exception being a silent change in codon Ala 406. Eleven of the 49 differences were indels between 1 and 10 bp long; the others were single nucleotide differences. The TÜ and jeftw37 strains differed at only three locations, all of them in introns. In two of those positions, jeftw37 had the same sequence as the AB wild-type strain, but in the other, the two wild-type strains had a G, but jeftw37 had a T (Fig. 2A). The unique change was in the first base after the splice donor site of intron 1 in codon Arg146, which alters an HphI restriction endonuclease site, allowing identification of jeftw37 heterozygotes by PCR.
|
Because nearly all introns have a G immediately after the splice junction
(Mount, 1982
;
Zhang, 1998
), this raised the
possibility that the lesion blocks transcript splicing. Because the lesion
immediately follows the second nucleotide in codon 146 in the middle of the
HMG domain, and an in-frame stop codon follows two codons downstream, a
non-spliced transcript should be translated into a truncated protein
containing only half of the HMG domain. Such a lesion is likely to lead to an
ineffective protein.
The jeftw37 mutation inhibits
splicing
If the G
T transversion in jeftw37 causes
the jef phenotype, then it should disrupt the splicing of
sox9a transcripts. To test this prediction, we made cDNA from
homozygous jeftw37 embryos and their homozygous
wild-type siblings, and amplified various regions of the sox9a gene
(Fig. 2A). A forward primer, f1
in exon 1, and a reverse primer, r1 in intron 1, should fail to amplify a
product from mature wild-type sox9a mRNA because the mature message
lacks intron 1. Unspliced transcripts should give a band of 544 bp. The
results showed that genomic DNA from wild-type animals (a positive control)
gave a band of the size predicted for a fragment that includes the parts of
exon 1 and intron 1, but cDNA from 4-day-old wild-type animals had only a
faint band at this location, consistent with normal splicing. By contrast,
cDNA extracted from 4-day-old homozygous jeftw37
animals behaved like wild-type genomic DNA
(Fig. 2B), as expected if
homozygous jeftw37 embryos accumulated unspliced
transcript.
To learn the extent to which sox9a message is reduced in
jeftw37 homozygotes, we prepared cDNA from
4-day-old mutant and wild-type animals, and then conducted RNase protection
assays using as probe a region of sox9a amplified by primer pair f2
and r2 that includes 110 bp of exon 1, all of exon 2 (251 bp) and 40 bp in
exon 3 (Fig. 2A). The
ubiquitously expressed housekeeping gene, ornithine decarboxylase
(odc) provided an internal standard
(Draper et al., 2001
). The
results revealed that jeftw37 embryos possessed
only 28% of sox9a transcript compared with wild-type animals. We
conclude that the mutation drastically decreases the efficiency of
sox9a transcript splicing.
jeftw37 behaves as an amorphic
mutation
The molecular genetic analysis of jeftw37 did
not rule out the possibility that some message may be spliced normally in
homozygous mutants. Coupled with the remnant bilateral patches of cartilage
(Fig. 1G), the protection
assays made us concerned that jeftw37 might be a
hypomorph rather than a null allele. The classical test for a null allele is
the Müller test: for a null allele, the phenotype of a homozygote equals
that of a heterozygote for one mutant allele and one deletion allele
(Müller, 1932
). To
perform this test, we crossed females heterozygous for
jeftw37 to a male heterozygous for the deletion
Df(LG12)dlx3b380
(Fritz et al., 1996
), which
removes a region of LG12 containing sox9a (data not shown). Fifteen
of 56 offspring examined showed a jellyfish phenotype, and these were
confirmed by PCR to be
jeftw37/Df(LG12)dlx3b380.
Fig. 2D,E show that homozygous
jeftw37/jeftw37
animals and heterozygous
jeftw37/Df(LG12)dlx3b380
had the same severity of skeletal phenotype. We conclude that
jeftw37 behaves as a null allele in the
Müller test.
Molecular genetic nature of the jeftw37
mutation
The jeftw37 mutation
An allele with a molecular lesion that deletes protein function would
strengthen interpretation of the mutant phenotype. We identified
jefhi1134 in an insertional mutagenesis screen
(Amsterdam et al., 1999
;
Burgess and Hopkins, 2000
). The
virus inserted into codon Leu 147, 2 bp from the 5' end of exon 2 inside
the HMG domain (Fig. 3), which
would form a truncated Sox9a protein and probably destroy protein
function.
To confirm that the mutant phenotype of
jefhi1134 homozygotes is due to the viral
insertion in sox9a, we mapped the insertion site with respect to the
mutant phenotype. We mated a female heterozygous for
jefhi1134 to the TAB14 wild-type strain and
crossed the resulting F1 progeny to obtain an F2 mapping
population. We scored 66 F2 individuals for their genotypes by PCR.
The mutant and wild-type alleles were distinguished by the forward primer
5'LTR which binds in the insertion, and the forward primer t2a, which
binds in intron-1 (Fig. 3).
When these are paired with a common reverse primer RT2, which binds in exon-2,
the 5'LTR/RT2 primer pair amplified a band of 628 bp with mutant genomic
DNA but no band with homozygous wild-type DNA. The t2a/RT2 pair gave a 237 bp
fragment with wild-type DNA, and no band with mutant DNA
(Fig. 3C). The results showed
that of 45 phenotypically mutant F2 individuals tested, all showed
only the 628 bp band expected for homozygous insertions. Of 22 phenotypically
wild-type segregants tested, 14 showed both bands expected for heterozygotes
and eight showed only the 237 bp band expected for wild-type genomic DNA.
Thus, among 53 informative individuals, there were no recombinants. This
places the insertion within 1.9±11 cM (95% confidence)
(Crow, 1950
) of the lesion
causing the mutant phenotype. Taken with the failure of
jefhi1134 to complement jef tw37, we
conclude that the viral insertion in sox9a is responsible for the
jellyfish phenotype in jefhi1134
homozygotes.
The jefhi1134 mutation inhibits
production of mature message
If the insertion in jefhi1134 causes the
mutant phenotype, it could block the formation of mature sox9a mRNA
by one of at least two mechanisms. First, because it is so close to the splice
acceptor site, it might cause the splicing machinery to skip exon 2 entirely.
Alternatively, splicing might occur normally, but the message with the insert
would be unstable. If the insertion in jefhi1134
causes skipping of the entire 251 bp exon 2, a primer pair in exon 1 and exon
3 (F/R, Fig. 3) would yield a
transcript 251 bp shorter than wild-type. To test these possibilities, we
prepared cDNA from mutant and wild-type embryos and amplified the cDNAs. The
results showed that in wild type, the predominant band is the 627 bp wild-type
product. In mutant animals, however, the predominant band is the 376 bp
product produced by neatly skipping exon 2. Direct sequencing of wild-type and
mutant PCR products from cDNA confirmed that in
jefhi1134, exon 1 splices directly to exon 3.
Translation of the resulting transcript should add 15 out-of-frame amino acids
derived from exon-3 after Leu 147. As a final test of sox9a
expression in mutant embryos, we performed in situ hybridization experiments
on wild-type and homozygous jefhi1134 embryos.
The experiments showed reduced signal in the mutant embryos (see Figs
6,
7). Because the viral insertion
alters sox9a mRNA in a way that would produce a truncated protein
with a disrupted HMG box, jefhi1134 is highly
likely to be a null mutation.
|
|
Inhibition of sox9a function with morpholinos
Morpholinos against sox9a produce a phenotype similar to
jef
To confirm that reduction in sox9a function results in the
jef phenotype, we injected embryos with morpholino antisense
oligonucleotides targeted to sox9a. Injecting homozygous wild-type
embryos with 5.0 mg/ml of two splice junction MOs (i1d and i2d) greatly
reduced cartilage in the pharyngeal arches
(Fig. 4E). Treating the
offspring of heterozygous jeftw37 males and
females with sox9a MOs gave animals in three phenotypic classes. Some animals
had hypoplastic but recognizable cartilages
(Fig. 4E); others had
rudimentary first and second arch cartilage elements with two rather large
blocks of cartilage remaining at about the location of the ceratohyal
(Fig. 4H); and some animals had
the typical homozygous jeftw37 phenotype, with
two small blocks of Alcian-positive material remaining
(Fig. 4K). Genotyping the
animals for the HphI site polymorphism in
jeftw37 before Alcian staining showed that among
91 animals, the least severely affected class (20 animals, 22%) were all
homozygous wild type; the intermediate class (47 animals, 51%) were all
heterozygotes; and the animals with the severe phenotype were all homozygous
jeftw37 (24 animals, 26%). These genotypes were
found in the ratio of
1:2:1 as expected in the progeny of two
heterozygotes. We conclude that heterozygous jef animals are more
sensitive to sox9a MO than homozygous wild-type animals. The series of
phenotypes found in these experiments suggests that the remnant bilateral
Alcian-positive regions in jef animals may be portions of the
ceratohyal.
|
The pectoral fin skeletons of MO-injected animals showed a similar pattern.
Alcian stained wild-type pectoral fins at 5 dpf (days post-fertilization)
showed a flat endoskeletal disc, the basal scapulocoracoid of the pectoral
girdle, and the cleithrum, a long straight bone
(Fig. 4C) (see
Grandel and Schulte-Merker,
1998
). The scapulocoracoid cartilage was missing in homozygous and
heterozygous jeftw37 animals treated with MO, but
the endoskeletal disk and cleithrum were nearly normal
(Fig. 4I,L). The
scapulocoracoid in the pectoral fins of homozygous wild-type animals injected
with the MOs was reduced to two small patches of six to ten cells
(Fig. 4F).
To determine the efficacy of splice-directed MOs to inhibit transcript splicing, we injected one-cell embryos with MO i1d and i2d. Solutions contained equal quantities of both MOs at final total concentrations of 2.5, 5.0 and 7.5 mg/ml, and we injected about 2 nl into each embryo. We quantified the results in RNase protection assays conducted on RNAs collected from either 28 hpf (hours post-fertilization) embryos or 4-day-old larvae. The odc gene served as an internal control. The results showed that embryos injected with even the lowest dose tested showed levels of spliced sox9a transcript only about 20% of normal at 28 hpf (Fig. 5A). To determine how long in development the morpholino would have an effect, we compared the inhibition of splicing in 28 hpf embryos to that in 4 dpf animals for the intermediate dose of MO. The results showed that by 4 dpf, the amount of normal-sized transcript had increased to about 55% of that found in untreated controls (Fig. 5B). We conclude that these MOs provide a significant inhibition of transcript splicing in the first day of embryonic life, but by day 4, the effects of the MOs on transcript splicing had begun to wane, presumably due to dilution of the MOs associated with cell proliferation.
|
Inhibiting splicing with morpholinos alters the intracellular
distribution of sox9a transcript
In normal wild-type animals, sox9a transcript accumulates in the
cytoplasm (Fig. 5C). Does the
mutation in the splice-donor site or a splice-inhibiting MO hinder the
transport of transcript to the cytoplasm? By the two-somite stage
(Fig. 5C), the cytoplasm of
presumptive cranial placode cells accumulated substantial quantities of
sox9a transcript in wild-type embryos. By contrast, the difference in
transcript amount between the cytoplasm and the nucleus of the corresponding
cells in jeftw37 embryos is rather small
(Fig. 5C). Wild-type animals
treated with the splice junction MOs i1d and i2d showed no apparent
sox9a transcript in the cytoplasm, but accumulated substantial
quantities of transcript in the nucleus. We conclude that MOs directed against
a splice junction can block the transport of transcript from the nucleus to
the cytoplasm. The inappropriate localization of transcript can provide an
assay for MO efficacy in the absence of an antibody to test for the production
of a translated product.
The MO results allow several conclusions. First, the similarity of sox9a MO and jellyfish phenotypes supports the conclusion that jef mutations disrupt the function of sox9a; we therefore call this gene jef (sox9a) according to zebrafish nomenclature guidelines (http://zfin.org/zf_info/nomen.html). Second, the failure of the splice-junction MOs to enhance the phenotype of jeftw37 homozygotes is consistent with the interpretation of jeftw37 as a null allele. Third, the results suggest that both mutant alleles of jef are more effective at knocking down sox9a activity than are the MOs, perhaps because the morpholinos are less effective at blocking a late phenotype. And fourth, the accumulation of transcript in the nucleus with splice-directed morpholinos can provide an assay for morpholino efficacy independent of phenotype.
An essential role for sox9a in chondrogenesis
These results show that jef (sox9a) is essential for the
formation of cartilages in the neurocranium, pharyngeal arches and pectoral
appendages, but do not reveal which step in cartilage formation requires the
gene. If jef (sox9a) is required for the migration of crest
cells, cranial crest, as marked by dlx2 expression
(Akimenko et al., 1994
), should
be aberrant in homozygous jeftw37 embryos. In situ
hybridization experiments showed that dlx2 and sox9a are
expressed in the same groups of cells in 30-somite stage wild-type embryos
(Fig. 6 and data not shown). In
homozygous jeftw37 and jefhi1134
embryos, sox9a transcript is weakly detected at this stage
(Fig. 6C,E), but the expression
pattern of dlx2 is unperturbed
(Fig. 6D,F). These results
suggest that sox9a is not required for the specification of cranial
crest or for the migration of crest cells into the pharyngeal arches.
To determine if postmigratory cranial neural crest is properly specified in
jef mutants, we examined two markers of ventral postmigratory crest,
dhand and epha3 (Miller
et al., 2000
). Expression of these genes at 36 hpf showed no
distinguishable alterations in jef mutants (data not shown). Thus, at
least the ventral postmigratory pharyngeal arch crest in jef mutants
is properly specified with respect to these two markers.
The expression of col2a1 marks differentiating chondrocytes in
zebrafish (Yan et al., 1995
)
and Col2a1 is essential for proper chondrogenesis in mammals
(Vandenberg et al., 1991
). To
determine whether jef (sox9a) is essential for
col2a1 expression in pharyngeal arches, we compared the expression
domains of sox9a and col2a1 in wild-type embryos, and tested
whether the expression of col2a1 was altered in jef
(sox9a) homozygotes. The results show that the neurocranium,
pharyngeal arches and pectoral fins co-express col2a1 and
sox9a in wild-type embryos (Fig.
7A,B,G,H), although col2a1 shows additional expression in
the presumptive precursors of the cartilage capsule of the ear and eye. In
mutant animals, sox9a expression is reduced
(Fig. 7C-F), and
col2a1 expression appears in only small regions of the pharyngeal
arches (Fig. 7I-L). Ventral
groups of cells in the first and second arches retain col2a1
expression. The expression in the second arch may correspond to the remaining
bilateral Alcian-positive patches found later in mutant animals (see
Fig. 1C,G,K,O). These results
show that in much of the pharyngeal arch skeleton, the expression of
col2a1 depends on sox9a activity.
Prechondrogenic condensations form in jef (sox9a)
mutants, but cartilage differentiation and condensation morphogenesis fail to
occur
Because migratory and postmigratory cranial neural crest are present in
jef (sox9a) mutant embryos
(Fig. 6), the severe reduction
of differentiated (Alcian-positive) cranial cartilage seen later in
jef (sox9a) mutant larvae is due either to the failure of
prechondrogenic condensation formation or to the failure of condensation
progression into differentiated cartilage. To distinguish between these
possibilities, we mated heterozygous jef (sox9a) males and
females, and labeled the resulting embryos with the vital fluorescent dye
BODIPY-ceramide. This dye fills extracellular spaces, thus labeling cell
outlines, and has the powerful advantage of allowing histological
identification of nearly every cell type in live preparations
(Cooper and Kimmel, 1998
). We
examined live developing BODIPY-ceramide-stained larvae at multiple time
points from 48 hours, when no pharyngeal cartilage differentiation had
occurred in wild types (Schilling and
Kimmel, 1997
), until 76 hours, when the primary scaffold of the
larval pharyngeal skeleton had chondrified. At 48 hours, wild type and mutants
for both mutant alleles of jef (sox9a) had precartilage
condensations in the first two pharyngeal arches
(Fig. 8A-B' and data not
shown). Although at this stage no differentiated (Alcian-positive) pharyngeal
cartilage was present (Schilling and
Kimmel, 1997
), the primordia of the major cartilages in the first
two arches were readily identifiable in wild type and mutant
(Fig. 8A-B'). For
example, the hyomandibular foramen was present, as was the rudiment of the
symplectic (Fig. 8A-B'). By 54 hours, differentiation had begun in wild type
(Schilling and Kimmel, 1997
),
but had failed to occur in jef (sox9a) mutants (data not
shown). Concomitant with differentiation, in wild-type embryos chondrocytes
organized into orderly stacks (data not shown)
(Kimmel et al., 1998
).
|
By 76 hours, cartilages in the first and second arches of wild-type embryos
were well-formed, whereas jef (sox9a) mutants had failed to
undergo three major morphogenetic processes. First, jef
(sox9a) mutants failed to form stacks of chondrocytes
(Fig. 8C-D' and data not
shown), but cells in wild-type precartilage condensations oriented themselves
with their long axes parallel to each other
(Fig. 8C,C') (Kimmel et al., 1998
). The
only pharyngeal cartilages to differentiate in jef (sox9a)
mutants, the small bilateral nodules of disorderly cartilage that form in the
ventral second arch (see Figs
1,
4) lacked orderly stacks of
chondrocytes. Second, the precartilage condensations in jef
(sox9a) mutants failed to separate into individualized regions. For
example, the prominent dorsal/ventral joint that separates the upper and lower
jaw (palatoquadrate and Meckel's, Fig.
8C-D') in wild-type embryos was undetectable in jef
(sox9a) mutants. Third, jef (sox9a) mutant
precartilage condensations failed to transform into the specific shapes of
their wild-type counterparts. For example, the symplectic region of wild-type
embryos formed a long, orderly rod of cartilage, whereas this region in
jef (sox9a) mutants was deformed into a jumbled region of
mesenchyme (Fig. 8C-D'). For both mutant jef (sox9a) alleles, the phenotypically
wild-type siblings (which should have included both heterozygotes and
wild-type homozygotes) were indistinguishable from one another. Thus, at this
single-cell level of analysis, no evidence for heterozygous phenotype in
either allele was seen, consistent with the lack of a detectable heterozygous
phenotype by Alcian staining.
These data show that jef (sox9a) function is not required for formation of pharyngeal precartilage condensations, but rather for subsequent differentiation of cells within the condensations. Furthermore, jef (sox9a) function is required for three morphogenetic processes: formation of orderly stacks, the individualization of cartilages and the shaping of specific skeletal elements.
Chondrogenesis and muscle patterning
Signals from the cranial neural crest are required to pattern the
mesodermally derived muscles of the pharynx
(Noden, 1983
;
Schilling et al., 1996
).
Cranial neural crest gives rise to muscle connective tissue
(Kontges and Lumsden, 1996
),
which could be one source of this signal. Alternatively, cartilage precursors
or the cartilages themselves might signal muscle patterning. Given the
widespread expression of sox9a in cranial crest and the severe defect
in cartilage differentiation in jef (sox9a) mutants,
jef mutants might have defects in muscle patterning from one of these
sources. To test this possibility, we cloned and mapped a fragment of the
muscle gene titin (GenBank Accession Number AY081167)
(Xu et al., 2002
) to use as a
marker for muscle cells. A single molecule of Titin (the largest protein
known) spans half the length of a sarcomere
(Labeit and Kolmerer, 1995
).
We report here the mapping of the zebrafish ttn gene to LG9 at 109.8
cM on the heat shock panel (Woods et al.,
2000
), a region of conserved synteny with the long arm of human
chromosome 2, the site of the human TTN gene. Expression of
ttn showed a full complement of pharyngeal muscles in jef
animals homozygous for either allele (Fig.
9). Although the positions and shapes of muscles were slightly
distorted, presumably because of the absence of cartilage-derived skeletal
elements for muscle insertions, the pattern-forming process was normal in
jef mutants. We conclude that jef (sox9a) activity
is not required to pattern these anterior pharyngeal muscles.
|
Early bone formation is largely unaffected in jef(sox9a)
mutants
Mice heterozygous for a Sox9 mutation exhibit expanded
ossification centers that prematurely ossify
(Bi et al., 2001
). To learn
whether jef (sox9a) mutants show these phenotypes, we
examined larval bone development in jef (sox9a) mutant
larvae using the fluorescent dye calcein
(Du et al., 2001
) (C. K.,
unpublished). Despite the severe cartilage defects in jef
(sox9a) mutants, most major cranial and pectoral fin bones appeared
on schedule and were only slightly reduced in size in jef
(sox9a) mutants (Fig.
9E, and data not shown). The second arch dermal opercles and
branchiostegal rays appeared on schedule in jef (sox9a)
mutants and were mildly reduced. The blade of the jef
(sox9a) mutant opercular bone was reduced ventrally and displaced
anteriorly towards the eye. The cleithrum in the fin girdle was present
(Fig. 9, see also
Fig. 1D,H,L,P), as were
pharyngeal teeth (Fig. 9). By
contrast, the fifth ceratobranchial bone, which is a cartilage replacement
bone (Cubbage and Mabee,
1996
), was strikingly absent in jef (sox9a)
mutants. Tiny remnants of bone were present adjacent to the teeth of
jef (sox9a) mutants, perhaps the bone of attachment of the
teeth or the severely reduced remnant of the fifth ceratobranchial bone. Small
remnants of bone were also present in jef (sox9a) mutants in
the position of the wild-type dentary, which normally forms in the lower jaw.
Examining jef (sox9a) mutants at earlier time points (days 3
and 4) revealed no evidence for precocious bone development or enlarged
ossification centers (data not shown). The early larval lethality of
jef mutants thwarts analysis of ribs and other later-forming skeletal
structures, as well as frustrating the analysis of gonad morphogenesis.
| DISCUSSION |
|---|
|
|
|---|
Two jef (sox9a) alleles behave as null
mutations
To infer the role of a gene from its mutant phenotype, it is essential to
know whether the alleles investigated lack all function of the gene. This is
relevant here because, first, the mammalian mutants retain one normal
SOX9 allele and, second. because the zebrafish mutants retain a small
patch of Alcian-positive material in the location of the second arch. The
zebrafish phenotype could result either from residual activity of
sox9a from the mutant allele, or from activity of a different gene.
We conclude that the two jef (sox9a) alleles are likely null
alleles because: (1) the viral insertion in jefhi1134
causes the skipping of exon 2, which should result in a truncated protein; (2)
animals heterozygous for jeftw37 over a deletion do not
have a more severe phenotype than jeftw37 homozygotes; (3)
morpholinos that affect wild-type and heterozygous embryos do not make the
jeftw37 phenotype more severe; and (4) the phenotype of
jeftw37/jefhi1134 heterozygotes have the same
phenotype as either homozygote.
Splice-directed morpholinos provide an independent assay for
efficacy
Animals injected with splice-directed morpholinos displayed a weaker
phenotype at day 4 than did homozygous jef(sox9a) mutations,
presumably because of to the rebound of transcript splicing as evidenced by
the RNase protection assays. MO-treated animals accumulated sox9a
transcript in the nuclei of sox9a-expressing cells, apparently
because of a defect in transcript transport. We have also observed this
phenomenon for splice-directed morpholinos against sox9b (Y.-L. Y.,
unpublished). Although it is well known that MOs can inhibit splicing
(Schmajuk et al., 1999
;
Draper et al., 2001
), to our
knowledge this inhibition had not previously been shown to retard the
transport of transcript to the cytoplasm. Our novel finding provides an assay
for MO efficacy independent of any phenotypic change. This assay or the RNase
protection assay, is generally more convenient than an assay for the efficacy
of a translation-inhibiting MO because probes to measure nucleic acid quantity
are much more readily available than probes to measure the quantity of a
specific protein, which often requires a specific antibody. Furthermore, as
pointed out by Draper et al. (Draper et
al., 2001
), splice-directed morpholinos may allow one to
distinguish between the effects of different splice variants, and to
distinguish between the functions of maternal and zygotic transcript.
Evaluating jef (sox9a) mutants as a model for
campomelic dysplasia
People affected with CD are heterozygous for a mutation in SOX9,
and display a syndrome of clinical features that include bowing of the tibia
and femur, hypoplastic scapula, absence of a pair of ribs, cleft palate and a
small jaw (Houston et al.,
1983
; McKusick,
1990
; Foster et al.,
1994
; Wagner et al.,
1994
; Kwok et al.,
1995
; Mansour et al.,
1995
; Cameron et al.,
1996
; Hageman et al.,
1998
). Zebrafish homozygous for jef (sox9a)
mutations mimic at least two of these phenotypes, but show them in more severe
form. In humans and mice (Bi et al.,
1999
; Bi et al.,
2001
) heterozygous for SOX9 mutations, the scapulas and
jaws form, but they are small and thin. By contrast, the corresponding
elements in zebrafish jef (sox9a) mutants, the
scapulocoracoid cartilage and the first and second arch derivatives, are
almost completely gone.
Why is the zebrafish sox9a mutant phenotype more severe in these
aspects than the mammalian SOX9 mutant phenotypes? This question is
significant because we need to know whether SOX9 is essential for
development of these elements or whether it merely facilitates completion of
these cartilages. Many SOX9 mutations in mammals are likely to be
null activity alleles rather than dominant negative mutations, judging from
their predicted effect on the proteins
(Foster et al., 1994
;
Wagner et al., 1994
;
Kwok et al., 1995
;
Mansour et al., 1995
;
Cameron et al., 1996
;
Hageman et al., 1998
;
Bi et al., 1999
;
Bi et al., 2001
). Thus, the
heterozygotes probably have about half the normal amount of SOX9
activity in tissues in which the gene is expressed. Homozygous jef
(sox9a) animals should completely lack sox9 activity in all
cells in which sox9a is expressed in the absence of sox9b.
Before hatching, the time during which the jef (sox9a)
phenotype becomes apparent, sox9a is expressed strongly in the first
and second arches and in the scapulocoracoid, but sox9b is not
expressed in these cells (Chiang et al.,
2001
). We therefore conclude that SOX9 activity is
essential for chondrogenesis of the arches, neurocranium and scapulocoracoid,
and that mammals show a weak phenotype because SOX9 activity is
reduced, but not completely lost, in the mammalian heterozygous genotypes. The
evolution of duplicated zebrafish genes has thus allowed analysis of
null-activity embryos not yet available for the ortholog in mammals.
Many individuals with CD have XY sex reversal
(Houston et al., 1983
;
McKusick, 1990
;
Foster et al., 1994
;
Wagner et al., 1994
;
Kwok et al., 1995
;
Mansour et al., 1995
;
Cameron et al., 1996
;
Hageman et al., 1998
).
Although sox9a is expressed in the zebrafish testis, and
sox9b is expressed in the zebrafish ovary
(Chiang et al., 2001
),
consistent with a role in sex determination, the late determination of sex in
zebrafish has so far precluded the investigation of sex determination in
jef (sox9a) animals. Because both male and female animals
heterozygous for jef (sox9a) become sexually mature adults
of both sexes, jef (sox9a) appears not to have a fully
penetrant dominant effect on sex determination in zebrafish.
Prechondrogenic condensations form in jef (sox9a)
mutants
The formation of prechondrogenic condensations in jef
(sox9a) mutant zebrafish suggests that sox9a is not required
for condensation formation in zebrafish. The opposite conclusion was drawn for
mouse. Because cells homozygous for a Sox9 mutation failed to
contribute to condensations in genetic mosaics, Bi et al.
(Bi et al., 1999
) concluded
that Sox9 was required for formation of condensations. These
differences might reflect: (1) species differences in SOX9 function;
(2) the presence of duplicated sox9 genes in zebrafish; and/or (3)
the difference in experimental paradigms used. Although jef
(sox9a) mutant cells form condensations in the context of a totally
mutant environment, they might not contribute to condensations when
transplanted into a wild-type host, as was found with mouse. Mosaic analyses
in zebrafish could test this possibility.
Support for the idea that differences in experimental paradigms could
explain the contrasting conclusions on the requirement of SOX9 for
condensation formation comes from analysis of the zebrafish valentino
mutant. Embryos that lack val (mafb) activity make hindbrain
tissue between rhombomeres 4 and 7, yet in genetic mosaics, val
(mafb) mutant cells are excluded from this territory in a wild-type
host (Moens et al., 1996
).
Thus, by analogy, homozygous Sox9 mutant mice, like sox9a
mutant zebrafish, might form precartilage condensations even though mutant
cells are excluded from these domains in a mosaic. A mammalian phenotype
analogous to that seen in zebrafish jef (sox9a) mutants
might be the L-Sox5; Sox6 double mutant in mouse, where condensations
form, but no overt cartilage differentiation occurs
(Smits et al., 2001
). A
conditional allele of mouse Sox9 has been made
(Kist et al., 2002
), which
should facilitate phenotypic analysis of skeletal development in homozygous
Sox9 mutant mice.
The simultaneous failure of chondrocyte differentiation and morphogenesis
of condensations in jef (sox9a) mutants suggests that
jef (sox9a) regulates both morphogenesis and
differentiation, and provides another example of specification and
morphogenesis going hand-in-hand (see
Kimmel et al., 2001a
;
Kimmel et al., 2001b
). These
morphogenetic processes are separable from differentiation: the zebrafish
pipetail [ppt (wnt5a)] mutation
(Piotrowski et al., 1996
;
Rauch et al., 1997
;
Hammerschmidt et al., 1996
)
disrupts chondrocyte stacking but not differentiation. Thus, differentiation
does not require stacking. Likewise, individuation of cartilage elements
occurs in ppt (wnt5a) mutants
(Piotrowski et al., 1996
),
suggesting that the jef (sox9a)-dependent morphogenetic
processes are distinct aspects of morphogenesis under regulation of separate
loci.
The failure of differentiation and morphogenesis in jef
(sox9a) mutants correlates in time and space with the col2a1
expression defect, and raises the possibility that col2a1 might be
involved in one or both of these processes. Because COL2A is a major component
of differentiated cartilage matrix
(Vandenberg et al., 1991
),
perhaps zebrafish col2a1 is required for cartilage differentiation,
and the failure to activate col2a1 expression underlies the near
complete absence of cartilage in jef (sox9a) mutants. The
lack of Col2a might also underlie the morphogenetic defects in jef
(sox9a) mutants it is possible that cells require a normal
extracellular matrix in order to exhibit stacking cell behaviors. It would be
interesting to see if exogenously supplied Col2a could rescue either
morphogenesis (e.g. stacking) or differentiation in jef
(sox9a) mutants.
SOX9 regulates not only COL2A1, but other downstream
targets as well. SOX9 positively regulates expression of
CDH2 (Panda et al.,
2001
), which may mediate the jef
(sox9a)-dependent stacking, individuation or shaping of pharyngeal
mesenchymal cells. Comparing expression of cadherin genes, col2a1 and
orthologs of other Sox9 downstream targets in ppt and
jef mutants might suggest which genetic pathways underlie stacking
behavior and which cartilage differentiation. SOX9 also regulates
cell cycle genes (Panda et al.,
2001
), providing another potential mechanism for the
differentiation and morphogenetic defects in jef (sox9a)
mutants. Mitotic activity is enriched at the second arch dorsal/ventral joint,
and was proposed to partially drive the extension of the symplectic cartilage
(Kimmel et al., 1998
). This
region of the second arch condensation never extends in jef
(sox9a) mutants, possibly because mitotic behavior of cells within
the precartilage condensation is defective.
Pharyngeal muscle and bone differentiates in the absence of
differentiated cartilage
Cranial neural crest (CNC) patterns the pharyngeal musculature according to
Noden's experiments transplanting presumptive first arch CNC into the position
of presumptive second arch CNC (Noden,
1983
). Although recently reinterpreted to be due to the organizing
effects of a transplanted isthmus (Trainor
et al., 2002
), the conclusion remains that the transplant
non-autonomously induced host second arch muscles to adopt patterns
appropriate to the first arch muscles. Further evidence for an instructive
role of CNC comes from the zebrafish mutant chinless (chw),
which lacks both differentiated pharyngeal cartilage and muscles
(Schilling et al., 1996
).
Wild-type CNC cells, when transplanted into homozygous chw mutant
hosts, induced local differentiation of pharyngeal muscles
(Schilling et al., 1996
). A
third study revealed severe ventral muscle defects in pharyngeal arches of
suc (edn1) mutants, although mutant cells contributed to
normal ventral muscles when transplanted into a wild-type host
(Miller et al., 2000
). These
results support the idea that signaling from the CNC patterns the pharyngeal
arch mesoderm. The populations of CNC which participate in this signaling,
however, remain unidentified. The CNC-derived muscle connective tissue
(Kontges and Lumsden, 1996
) is
a candidate for this activity. The widespread expression of sox9a
raises the possibility that jef (sox9a) might function in a
CNC-derived connective tissue lineage. The skeletogenic CNC derivatives, some
of which are perturbed in jef (sox9a) mutants, could also
signal to the pharyngeal musculature. The presence of a normal pattern of
differentiated pharyngeal muscles in jef (sox9a) mutants
shows that signals from CNC to the surrounding mesoderm occur independently of
jef (sox9a) function. Muscles in jef
(sox9a) mutants are shorter and thicker that their wild-type
counterparts, suggesting that elongation of the muscles might require stiff,
differentiated cartilage.
The precocious ossification and expanded ossification centers in
heterozygous Sox9 mutant mice motivated the characterization of bone
formation in jef (sox9a) mutants. Our calcein labeling
confirms observations of bone (Piotrowski
et al., 1996
), and further demonstrates that cranial and pectoral
fin bones form relatively normally in jef (sox9a) mutants,
with the exceptions of the dentary and fifth ceratobranchial bone, a cartilage
replacement bone (see Cubbage and Mabee,
1996
) that appears to be surrounded by perichondral bone in
wild-type 5-day-old zebrafish larvae. The absence of the fifth ceratobranchial
bone in jef (sox9a) mutants could be explained if
perichondral ossification requires a cartilage template. The dentary bone, a
dermal bone (see Cubbage and Mabee,
1996
), is intimately associated with Meckel's cartilage in wild
type. Perhaps the reduction of the dentary in jef (sox9a)
mutants is also secondary to the cartilage defect. Weaker alleles of zebrafish
jef (sox9a) might allow analysis of bone development past
the early larval stage of currently available alleles.
Because dermal bones appear without a cartilage template, it might not seem
surprising that most dermal bones form normally in jef
(sox9a) mutants. The widespread expression of sox9a in
postmigratory CNC, however, suggests that CNC osteocyte precursors might
express sox9a. Expression of sox9a, like that of
dlx2 in the zebrafish pharyngeal arches, appears to include the
entire CNC population within each arch. The dlx2-expressing
postmigratory CNC forms a cylinder surrounding the central cores of paraxial
mesoderm (Miller et al., 2000
;
Kimmel et al., 2001a
). This
population presumably includes precursors of both the cartilage and bone
skeleton, based on existing fate maps
(Couly and Le Douarin, 1988
;
Schilling and Kimmel, 1997
;
Kontges and Lumsden, 1996
).
Thus, the absence of a major bone defect suggests that jef
(sox9a) function in the pharyngeal skeleton might actually be
required only in a subset of sox9a-expressing postmigratory CNC
cells, the chondrocyte lineage. Fate-mapping experiments will determine
whether chondrocytes and osteocytes share a lineage in the CNC, and whether
the chondrocyte lineage is uniquely perturbed in jef (sox9a)
mutants.
Sox9 and gene duplication
Xenopus embryos treated with a morpholino antisense
oligonucleotide that inhibits the production of Sox9 protein lack neural crest
progenitors, suggesting that Sox9 is essential for the specification of neural
crest in frogs (Spokony et al.,
2002
). By contrast, neural crest specification is apparently
normal in individuals with CD, because they make cranial crest derivatives,
but just have hypoplastic skeletons, and in the absence of sox9a
function in zebrafish, because the expression of dlx2 is normal, the
cranial crest migrates on schedule, and precartilage condensations form. How
can we understand these differences? We hypothesize that SOX9 may
play multiple essential roles in cranial crest development, and that these may
be revealed by further analysis of the two SOX9 duplicates in
zebrafish. As demonstrated by the work on Xenopus
(Spokony et al., 2002
), Sox9
protein plays an early role in crest specification, and as revealed by our
experiments on zebrafish and work with mouse, sox9 plays a later role
in chondrocyte differentiation that includes the regulation of col2a1
and the morphogenesis that accomplishes stacking. Because the antisense
methodology blocked the early step of crest specification in Xenopus,
it was not possible to determine whether Sox9 is required for the
later morphogenetic roles. Zebrafish has two orthologs of SOX9 that
have diverged in sequence and expression pattern. The sox9b gene is
expressed early in the neural crest of the head and body axis, like the
Xenopus Sox9 gene (Chiang et al.,
2001
; Li, 2002). We predict that sox9b may be necessary
for the neural crest specification function revealed in Xenopus
(Spokony et al., 2002
), and
that sox9a is necessary for the later step, as revealed by the
jef (sox9a) mutations studied here. In the haploinsufficient
mammalian mutants, the level of SOX9 activity is likely to be half
the normal level, and this may be sufficient for the early role in neural
crest specification, and for much, but not all of the later role in cartilage
morphogenesis.
The genome duplication that occurred in the ancestry of zebrafish
(Amores et al., 1998
;
Postlethwait et al., 1998
) was
followed by nonfunctionalization so that zebrafish retains duplicate orthologs
of about 30% of tetrapod genes
(Postlethwait et al., 2000
).
Because subfunctionalization may preserve duplicate genes
(Force et al., 1999
;
Stoltzfus, 1999
), ancestral
functions may assort to different duplicate copies. The expression patterns of
sox9a and sox9b (Chiang
et al., 2001
) show overlapping subsets of the tetrapod
SOX9 expression pattern (Spokony
et al., 2002
; Wright et al.,
1995
), consistent with the hypothesis of subfunctionalization.
Such subfunctionalization can reveal gene functions that are hidden by
analysis of morpholino-injected animals or knock-out mutations in tetrapods
because the absence of an early function in a cell lineage may preclude the
detection of later functions. As has been the case with Nodal genes, where
analysis of zebrafish co-orthologs of Nodal revealed an early
function in the induction of mesoderm, and a previously obscured later
function in neural plate patterning
(Feldman et al., 1998
;
Sampath et al., 1998
;
Rebagliati et al., 1998
;
Blader and Strahle, 1998
;
Nomura and Li, 1998
). Such may
be the case with sox9a and sox9b as well. In particular, the
early expression of sox9b in cranial crest may provide protein that
might persist and partially compensate for the loss of sox9a
function, even though sox9b is not expressed in post-migratory crest.
Further analysis of sox9b can test these possibilities.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Akimenko, M.-A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994). Combinatorial expression of three zebrafish genes related to Distalless: part of a homeobox gene code for the head. J. Neurosci. 14,3475 -3486.[Abstract]
Amores, A., Force, A., Yan, Y.-L., Joly, L., Amemiya, C., Fritz,
A., Ho, R. K., Langeland, J., Prince, V., Wang, Y.-L. et al.
(1998). Zebrafish hox clusters and vertebrate genome
evolution. Science 282,1711
-1714.
Amsterdam, A., Burgess, S., Golling, G., Chen, W. B., Sun, Z.
X., Townsend, K., Farrington, S., Haldi, M. and Hopkins, N.
(1999). A large-scale insertional mutagenesis screen in
zebrafish. Genes Dev.
13,2713
-2724.
Bell, D. M., Leung, K. K., Wheatley, S. C., Ng, L.-J., Zhou, S., Ling, K. W., Sham, M. H., Koopman, P., Tam, P. P. L. and Cheah, K. S. E. (1997). SOX9 directly regulates the type-II collagen gene. Nat. Genet. 16,174 -178.[CrossRef][Medline]
Bi, W., Deng, J. M., Zhang, Z., Behringer, R. R. and de Crombrugghe, B. (1999). Sox9 is required for cartilage formation. Nat. Genet. 22, 85-89.[CrossRef][Medline]
Bi, W., Huang, W., Whitworth, D. J., Deng, J. M., Zhang, Z.,
Behringer, R. R. and de Crombrugghe, B. (2001).
Haploinsufficiency of Sox9 results in defective cartilage primordia
and premature skeletal mineralization. Proc. Natl. Acad. Sci.
USA 98,6698
-6703.
Blader, P. and Strähle, U. (1998). Developmental biology: casting an eye over cyclopia. Nature 395,112 -113.[CrossRef][Medline]
Burgess, S. and Hopkins, N. (2000). Use of pseudotyped retroviruses in zebrafish as genetic tags. Methods Enzymol. 327,145 -161.[Medline]
Cameron, F. J., Hageman, R. M., Cooke- Yarborough, C., Kwok, C.,
Goodwin, L. L., Sillence, D. O. and Sinclair, A. H. (1996). A
novel germ line mutation in SOX9 causes familial campomelic dysplasia and sex
reversal. Hum. Mol. Genet.
5,1625
-1630.
Cancedda, R., Descalzi Cancedda, F. and Castagnola, P. (1995). Chondrocyte differentiation. Int. Rev. Cytol. 159,265 -358.[Medline]
Chiang, E., Pai, C.-I., Wyatt, M., Yan, Y.-L., Postlethwait, J. and Chung, B.-C. (2001). Two sox9 genes on duplicated zebrafish chromosomes: expression of similar transcription activators in distinct sites. Dev. Biol. 229,149 -163.
Childs, S., Weinstein, B. M., Mohideen, M. A. P. K., Donohue, S., Bonkovsky, H. and Fishman, M. C. (2000). Zebrafish dracula encodes ferrochelatase and its mutation provides a model for erythropoietic protoporphyria. Curr. Biol. 10,1001 -1004.[CrossRef][Medline]
Connor, F., Cary, P. D., Read, C. M., Preston, N. S., Driscoll,
P. C., Denny, P., Crane-Robinson, C. and Ashworth, A. (1994).
DNA binding and bending properties of the post-meiotically expressed
Sry-related protein Sox-5. Nucleic Acids Res.
22,3339
-3346.
Cooper, M. S., D'Amico, L. A. and Henry, C. A. (1999). Analyzing morphogenetic cell behaviors in vitally stained zebrafish embryos. Methods Mol. Biol. 122,185 -204.[Medline]
Cooper, M. S. and Kimmel, C. B. (1998). Morphogenetic cell behaviors during early teleost development. In Motion Analysis in Living Cells (ed. D. R. Soll), pp.198 -219. New York: Wiley-Liss.
Couly, G. and le Douarin, N. M. (1988). The fate map of the cephalic neural primordium at the presomitic to the 3-Somite stage in the avian embryo. Development 103,101 -113.
Crow, J. F. (1950). Genetic Notes. Minneapolis: Burgess Publishing.
Cubbage, C. C. and Mabee, P. M. (1996). Development of the cranium and paired fins in the zebrafish, Danio rerio (Ostariophysi, cyprinidae). J. Morphol. 229,121 -160.[CrossRef]
de Crombrugghe, B., Lefebvre, V. and Nakashima, K. (2001). Regulatory mechanisms in the pathways of cartilage and bone formation. Curr. Opin. Cell Biol. 13,721 -727.[CrossRef][Medline]
Draper, B. W., Morcos, P. A. and Kimmel, C. B. (2001). Inhibition of zebrafish fgf8 pre-mRNA splicing with morpholino oligos: A quantifiable method for gene knockdown. Genesis 30,154 -156.[CrossRef][Medline]
Du, S.J., Frenkel, V., Kindschi, G. and Zohar, Y. (2001). Visualizing normal and defective bone development in zebrafish embryos using the fluorescent chromophore calcein. Dev. Biol. 238,239 -246.[CrossRef][Medline]
Feldman, B., Gates, M., Egan, E. S., Dougan, S. T., Rennebeck, G., Sirotkin, H. I., Schier, A. F. and Talbot, W. S. (1998). Zebrafish organizer development and germ-layer formation require nodal-related signals. Nature 395,181 -185.[CrossRef][Medline]
Force, A., Lynch, M., Pickett, F. B., Amores, A., Yan, Y.-L. and
Postlethwait, J. (1999). Preservation of duplicate genes by
complementary, degenerative mutations. Genetics
151,1531
-1545.
Foster, J. W., Dominguez-Steglich, M. A., Guioli, S., Kwock, C., Weller, P. A., Stevanovic, M., Weissenbach, J., Mansour, S., Young, I. D., Goodfellow, P. N. et al. (1994). Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene. Nature 372,525 -530.[CrossRef][Medline]
Freddi, S., Savarirayan, R. and Bateman, J. F. (2000). Molecular diagnosis of Stickler syndrome: a COL2A1 stop codon mutation screening strategy that is not compromised by mutant mRNA instability. Am. J. Med. Genet. 90,398 -406.[CrossRef][Medline]
Fritz, A., Rozowski, M., Walker, C. and Westerfield, M. (1996). Identification of selected gamma-ray induced deficiencies in zebrafish using multiplex polymerase chain reaction. Genetics 144,1735 -1745.[Abstract]
Grandel, H. and Schulte-Merker, S. (1998). The development of the paired fins in the zebrafish (Danio rerio).Mech. Dev. 79,99 -120.[CrossRef][Medline]
Hageman, R. M., Cameron, F. J. and Sinclair, A. H. (1998). Mutation analysis of the SOX9 gene in a patient with campomelic dysplasia. Hum. Mutat. 1,S112 -S113.
Hamerman, D. (1989). The biology of osteoarthritis. New Engl. J. Med. 320,1322 -1330.[Medline]
Hammerschmidt, M., Pelegri, F., Mullins, M. C., Kane, D. A., Brand, M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Haffter, P., Heisenberg, C.-P. et al. (1996). Mutations affecting morphogenesis during gastrulation and tail formation in the zebrafish, Danio rerio. Development 123,143 -151.[Abstract]
Houston, C. S., Opitz, J. M., Spranger, J. W., Macpherson, R. I., Reed, M. H., Gilbert, E. F., Herrmann, J. and Schinzel, A. (1983). The campomelic syndrome: review, report of 17 cases, and follow-up on the currently 17-year-old boy first reported by Maroteaux et al., in 1971. Am. J. Med. Genet. 15, 3-28.[CrossRef][Medline]
Huang, B., Wang, S., Ning, Y., Lamb, A. N. and Bartley, J. (1999). Autosomal XX sex reversal caused by duplication of SOX9. Am. J. Med. Genet. 87,349 -353.[CrossRef][Medline]
Huang, W., Chung, U.-I., Kronenberg, H. M. and de Crombrugghe,
B. (2001). The chondrogenic transcription factor
Sox9 is a target of signaling by the parathyroid hormone-related
peptide in the growth plate of endochondral bones. Proc. Natl.
Acad. Sci. USA 98,160
-165.
Johnson, R. F., Pickett, S. C. and Barker, D. L. (1990). Autoradiography using storage phosphor technology. Electrophoresis 11,355 -360.[CrossRef][Medline]
Jowett, T. and Yan, Y. L. (1996). Double fluorescent in situ hybridization to zebrafish embryos. Trends Genet. 12,387 -389.[CrossRef][Medline]
Kimmel, C. B., Miller, C. T., Kruze, G., Ullmann, B., BreMiller, R. A., Larison, K. D. and Snyder, H. C. (1998). The shaping of pharyngeal cartilages during early development of the zebrafish. Dev. Biol. 203,246 -263.
Kimmel, C. B., Miller, C. T. and Keynes, R. J. (2001a). Neural crest patterning and the evolution of the jaw. J. Anat. 199,105 -120.[CrossRef][Medline]
Kimmel, C. B., Miller, C. T. and Moens, C. B. (2001b). Specification and morphogenesis of the zebrafish larval head skeleton. Dev. Biol. 233,239 -257.[CrossRef][Medline]
Kist, R., Schrewe, H., Balling, R. and Scherer, G. (2002). Conditional inactivation of Sox9: A mouse model for campomelic dysplasia. Genesis 32,121 -123.[CrossRef][Medline]
Knapik, E., Goodman, A., Ekker, M., Chevrette, M., Delgado, J., Neuhauss, S., Shimoda, N., Driever, W., Fishman, M. and Jacob, H. (1998). A microsatellite genetic linkage map for zebrafish (Danio rerio). Nat. Genet. 18,338 -343.[CrossRef][Medline]
Kontges, G. and Lumsden, A. (1996). Rhombencephalic neural crest segmentation is preserved throughout craniofacial ontogeny. Development 122,3229 -3242.[Abstract]
Kreivi, J.-P. and Lamond, A. I. (1996). RNA splicing: unexpected spliceosome diversity. Curr. Biol. 6,802 -805.[CrossRef][Medline]
Kwok, C., Weller, P. A., Guioli, S., Foster, J. W., Mansour, S., Zuffardi, O., Punnett, H. H., Domiguez-Steglich, M. A., Brook, J. D., Young, I. D. et al. (1995). Mutations in SOX9, the gene responsible for Campomelic dysplasia and autosomal sex reversal. Am. J. Hum. Genet. 57,1028 -1036.[Medline]
Labeit, S. and Kolmerer, B. (1995). Titins:
giant proteins in charge of muscle ultrastructure and elasticity.
Science 270,293
-296.
Lefebvre, V., Huang, W., Harley, V. R., Goodfellow, P. N. and de Crombrugghe, B. (1997). SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro alpha1(II) collagen gene. Mol. Cell. Biol. 17,2336 -2346.[Abstract]
Li, M., Zhao, C., Wang, Y., Zhao, Z. and Meng, A. (2002) Zebrafish sox9b is an early neural crest marker. Dev. Genes Evol. 212,203 -206.[CrossRef][Medline]
Lun, K. and Brand, M. (1998). A series of no isthmus (noi) alleles of the zebrafish pax2.1 gene reveals multiple signaling events in development of the midbrain-hindbrain boundary. Development 125,3049 -3062.[Abstract]
Mansour, S., Hall, C. M., Pembrey, M. E. and Young, I. D.
(1995). A clinical and genetic study of campomelic dysplasia.
J. Med. Genet. 32,415
-420.
McKusick, V. A. (1990). Campomelic dwarfism. MIM no. 211970. In Mendelian Inheritance in Man. Baltimore, MD: Johns Hopkins University Press.
Miller, C. T., Schilling, T. F., Lee, K., Parker, J. and Kimmel, C. B. (2000). sucker encodes a zebrafish Endothelin-1 required for ventral pharyngeal arch development. Development 127,3815 -3828.[Abstract]
Moens, C. B., Yan, Y.-L., Appel, B., Force, A. G. and Kimmel, C. B. (1996). valentino: a zebrafish gene required for normal hindbrain segmentation. Development 122,3981 -3990.[Abstract]
Morais da Silva, S., Hacker, A., Harley, V., Goodfellow, P. N., Swain, A. and Lovell-Badge, R. (1996). Sox9 expression during gonadal development implies a conserved role for the gene in testis differentiation in mammals and birds. Nat. Genet. 14,62 -68.[CrossRef][Medline]
Mount, S. (1982). A catalogue of splice
junction sequences. Nucleic Acids Res.
10,459
-472.
Müller, H. J. (1932). Further studies on the nature and causes of gene mutations. Int. Congr. Genet. 6,213 -255.
Ng, L.-J., Wheatley, S., Muscat, G. E. O., Conway-Campbell, J., Bowles, J., Wright, E., Bell, D. M., Tam, P. P. L., Cheah, K. S. E. and Koopman, P. (1997). SOX9 binds DNA, activates transcription, and coexpresses with type II collagen during chondrogenesis in the mouse. Dev. Biol. 183,108 -121.[CrossRef][Medline]
Noden, D. M. (1983). The role of the neural crest in patterning of avian cranial skeletal, connective, and muscle tissues. Dev. Biol. 96,144 -165.[CrossRef][Medline]
Nomura, M. and Li, E. (1998). Smad2 role in mesoderm formation, left-right patterning and craniofacial development. Nature 393,786 -790.[CrossRef][Medline]
Ohe, K., Lalli, E. and Sassone-Corsi, P.
(2002). A direct role of SRY and SOX proteins in pre-mRNA
splicing. Proc. Natl. Acad. Sci. USA
99,1146
-1151.
Panda, D. K., Miao, D., Lefebvre, V., Hendy, G. N. and Goltzman,
D. (2001). The transcription factor SOX9 regulates cell cycle
and differentiation genes in chondrocytic CFK2 cells. J. Biol.
Chem. 276,41229
-41236.
Piotrowski, T., Schilling, T. F., Brand, M., Jiang, Y. J., Heisenberg, C.-P., Beuchle, D., Grandel, H., van Eeden, F. J., Furutani-Seiki, M., Granato, M. et al. (1996). Jaw and branchial arch mutants in zebrafish II: anterior arches and cartilage differentiation. Development 123,345 -356.[Abstract]
Postlethwait, J., Johnson, S., Midson, C. N., Talbot, W. S.,
Gates, M., Ballenger, E. W., Africa, D., Andrews, R., Carl, T., Eisen, J. S.
et al. (1994). A genetic linkage map for the zebrafish.
Science 264,699
-703.
Postlethwait, J. H., Yan, Y.-L., Gates, M., Horne, S., Amores, A., Brownlie, A., Donovan, A., Egan, E., Force, A., Gong, Z. et al. (1998). Vertebrate genome evolution and the zebrafish gene map. Nat. Genet. 18,345 -349.[CrossRef][Medline]
Postlethwait, J. H., Woods, I. G., Ngo-Hazelett, P., Yan, Y.-L.,
Kelly, P. D., Chu, F., Huang, H., Hill-Force, A. and Talbot, W. S.
(2000). Zebrafish comparative genomics and the origins of
vertebrate chromosomes. Genome Res.
10,1890
-1902.
Rauch, G.-J., Hammerschmidt, M., Blader, P., Schauerte, H. E.,
Strähle, U., Ingham, P. W., McMahon, A. P. and Haffter, P.
(1997). WNT5 is required for tail formation in the zebrafish
embryo. Cold Spring Harb. Symp. Quant. Biol.
62,227
-233.
Rebagliati, M. R., Toyama, R., Haffter, P. and Dawid, I. B.
(1998). cyclops encodes a nodal-related factor involved
in midline signaling. Proc. Natl. Acad. Sci. USA
95,9932
-9937.
Sampath, K., Rubinstein, A. L., Cheng, A. M., Liang, J. O., Fekany, K., Solnica-Krezel, L., Korzh, V., Halpern, M. E. and Wright, C. V. (1998). Induction of the zebrafish ventral brain and floorplate requires cyclops/nodal signalling. Nature 395,185 -189.[CrossRef][Medline]
Schilling, T. F. and Kimmel, C. B. (1997). Musculoskeletal patterning in the pharyngeal segments of the zebrafish embryo. Development 124,2945 -2960.[Abstract]
Schilling, T. F., Walker, C. and Kimmel, C. B. (1996). The chinless mutation and neural crest interactions in zebrafish jaw development. Development 122,1417 -1426.[Abstract]
Shimoda, N., Knapik, E. W., Ziniti, J., Sim, C., Yamada, E., Kaplan, S., Jackson, D., de Sauvage, F., Jacob, H. and Fishman, M. C. (1999). Zebrafish genetic map with 2000 microsatellite markers. Genomics 58,219 -232.[CrossRef][Medline]
Schmajuk, G., Sierakowska, H. and Kole, R.
(1999). Antisense oligonucleotides with different backbones:
modification of the splicing pathway and efficacy of uptake. J.
Biol. Chem. 274,21783
-21789.
Smits, P., Li, P., Mandel, J., Zhang, Z., Deng, J. M., Behringer, R. R., de Crombrugghe, B. and Lefebvre, V. (2001). The transcription factors L-Sox5 and Sox6 are essential for cartilage formation. Dev. Cell 1,277 -290.[CrossRef][Medline]
Sironi, M., Corti, S., Locatelli, F., Cagliani, R. and Comi, G. P. (2001). A novel splice site mutation (3157+1G>T) in the dystrophin gene causing total exon skipping and DMD phenotype. Hum. Mutat. 17,239 .[CrossRef][Medline]
Spokony, R., Aoki, Y., Saint-Germain, N., Magner-Fink, E. and
Saint-Jeannet, J. (2002). The transcription factor
Sox9 is required for cranial neural crest development in Xenopus.Development 129,421
-432.
Stoltzfus, A. (1999). On the possibility of constructive neutral evolution. J. Mol. Evol. 49,169 -181.[CrossRef][Medline]
Südbeck, P., Schmitz, M. L., Baeuerle, P. A. and Scherer, G. (1996). Sex reversal by loss of the C-terminal transactivation domain of human SOX9. Nat. Genet. 13,230 -232.[CrossRef][Medline]
Targovnik, H. M., Rivolta, C. M., Mendive, F. M., Moya, C. M., Vono, J. and Medeiros-Neto, G. (2001). Congenital goiter with hypothyroidism caused by a 5' splice site mutation in the thyroglobulin gene. Thyroid 11,685 -690.[CrossRef][Medline]
Trainor, P. A., Ariza-McNaughton, L. and Krumlauf, R.
(2002). Role of the isthmus and FGFs in resolving the
paradox of neural crest plasticity and prepatterning.
Science 295,1288
-1291.
Vandenberg, P., Khillan, J. S., Prockop, D. J., Helminen, H.,
Kontusaari, S. and Ala-Kokko, L. (1991). Expression of a
partially deleted gene of human type II procollagen (COL2A1) in transgenic
mice produces a chondrodysplasia. Proc. Natl. Acad. Sci.
USA 88,7640
-7644.
van Eeden, F. J. M., Granato, M., Schach, U., Brand, M., Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J., Kane, D. A. et al. (1996). Genetic analysis of fin formation in the zebrafish, Danio rerio. Development 123,255 -262.[Abstract]
Vidal, V. P. I., Chaboissier, M. C., de Rooij, D. G. and Schedl, A. (2001). Sox9 induces testis development in XX transgenic mice. Nat. Genet. 28,216 -217.[CrossRef][Medline]
Wagner, T., Wirth, J., Meyer, J., Zabel, B., Held, M., Zimmer, J., Pasantes, J., Bricarelli, F. D., Keutel, J. and Hustert, E. (1994). Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9.Cell 79,111 -1120.
Wegner, M. (1999). From head to toes: the
multiple facets of Sox proteins. Nucleic Acids Res.
27,1409
-1420.
Werner, M. H., Huth, J. R., Gronenborn, A. M. and Clore, G. M. (1995). Molecular basis of human 46X,Y sex reversal revealed from the three-dimensional solution structure of the human SRY-DNA complex. Cell 81,705 -714.[CrossRef][Medline]
Westerfield, M. (2001). The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio rerio). Eugene: University of Oregon Press.
Woods, I. G., Kelly, P. D., Chu, F., Ngo-Hazelett, P., Yan,
Y.-L., Huang, H., Postlethwait, J. H. and Talbot, W. S.
(2000). A comparative map of the zebrafish genome.
Genome Res. 10,1903
-1914.
Wright, E., Hargrave, M. R., Christiansen, J., Cooper, L., Kun, J., Evans, T., Gangadharan, U., Greenfield, A. and Koopman, P. (1995). The SRY-related gene Sox9 is expressed during chondrogenesis in mouse embryos. Nat. Genet. 9, 15-20.[CrossRef][Medline]
Wright, E. M., Snopek, B. and Koopman, P.
(1993). Seven new members of the Sox gene family
expressed during mouse development. Nucleic Acids Res.
21, 744.
Wunderle, V. M., Critcher, R., Hastie, N., Goodfellow, P. N. and
Schedl, A. (1998). Deletion of long-range regulatory elements
upstream of SOX9 causes campomelic dysplasia. Proc. Natl. Acad.
Sci. USA 95,10649
-10654.
Xu, X., Meiler, S. E., Zhong, T. P., Mohideen, M. A., Crossley, D. A., Burggren, W. W. and Fishman, M. C. (2002). Cardiomyopathy in zebrafish due to mutation in an alternatively spliced exon of titin. Nat. Genet. 30,205 -209.[Medline]
Yan, Y.-L., Hatta, K., Riggleman, B. and Postlethwait, J. H. (1995). Expression of a type II collagen gene in the zebrafish embryonic axis. Dev. Dyn. 203,363 -376.[Medline]
Zhang, M. Q. (1998). Statistical features of
human exons and their flanking regions. Hum. Mol.
Genet. 7,919
-932.
Zhao, Q., Eberspaecher, H., Lefebvre, V. and de Crombrugghe, B. (1997). Parallel expression of Sox9 and Col2a1 in cells undergoing chondrogenesis. Dev. Dyn. 209,377 -386.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
K. Dutton, L. Abbas, J. Spencer, C. Brannon, C. Mowbray, M. Nikaido, R. N. Kelsh, and T. T. Whitfield A zebrafish model for Waardenburg syndrome type IV reveals diverse roles for Sox10 in the otic vesicle Dis. Model. Mech., January 1, 2009; 2(1-2): 68 - 83. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Xiong, R. E. Peterson, and W. Heideman Aryl Hydrocarbon Receptor-Mediated Down-Regulation of Sox9b Causes Jaw Malformation in Zebrafish Embryos Mol. Pharmacol., December 1, 2008; 74(6): 1544 - 1553. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. F. Eames and R. A. Schneider The genesis of cartilage size and shape during development and evolution Development, December 1, 2008; 135(23): 3947 - 3958. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Laue, S. Daujat, J. G. Crump, N. Plaster, H. H. Roehl, Tubingen 2000 Screen Consortium, C. B. Kimmel, R. Schneider, and M. Hammerschmidt The multidomain protein Brpf1 binds histones and is required for Hox gene expression and segmental identity Development, June 1, 2008; 135(11): 1935 - 1946. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nair, W. Li, R. Cornell, and T. F. Schilling Requirements for Endothelin type-A receptors and Endothelin-1 signaling in the facial ectoderm for the patterning of skeletogenic neural crest cells in zebrafish Development, January 15, 2007; 134(2): 335 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nowak and M. Hammerschmidt Ubc9 Regulates Mitosis and Cell Survival during Zebrafish Development Mol. Biol. Cell, December 1, 2006; 17(12): 5324 - 5336. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. O'Donnell, C.-S. Hong, X. Huang, R. J. Delnicki, and J.-P. Saint-Jeannet Functional analysis of Sox8 during neural crest development in Xenopus Development, October 1, 2006; 133(19): 3817 - 3826. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Villano and L. A. White The Aryl Hydrocarbon Receptor-Signaling Pathway and Tissue Remodeling: Insights from the Zebrafish (Danio rerio) Model System Toxicol. Sci., July 1, 2006; 92(1): 1 - 4. [Full Text] [PDF] |
||||
![]() |
S. A. Hutchinson and J. S. Eisen Islet1 and Islet2 have equivalent abilities to promote motoneuron formation and to specify motoneuron subtype identity Development, June 1, 2006; 133(11): 2137 - 2147. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zhang, M. M. Miyamoto, and M. J. Cohn Lamprey type II collagen and Sox9 reveal an ancient origin of the vertebrate collagenous skeleton PNAS, February 28, 2006; 103(9): 3180 - 3185. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yan, L. Xu, G. Crawford, Z. Wang, and S. M. Burgess The Forkhead Transcription Factor FoxI1 Remains Bound to Condensed Mitotic Chromosomes and Stably Remodels Chromatin Structure Mol. Cell. Biol., January 1, 2006; 26(1): 155 - 168. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-K. Hong, C. E. Haldin, N. D. Lawson, B. M. Weinstein, I. B. Dawid, and N. A. Hukriede The zebrafish kohtalo/trap230 gene is required for the development of the brain, neural crest, and pronephric kidney PNAS, December 20, 2005; 102(51): 18473 - 18478. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Wada, Y. Javidan, S. Nelson, T. J. Carney, R. N. Kelsh, and T. F. Schilling Hedgehog signaling is required for cranial neural crest morphogenesis and chondrogenesis at the midline in the zebrafish skull Development, September 1, 2005; 132(17): 3977 - 3988. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-L. Yan, J. Willoughby, D. Liu, J. G. Crump, C. Wilson, C. T. Miller, A. Singer, C. Kimmel, M. Westerfield, and J. H. Postlethwait A pair of Sox: distinct and overlapping functions of zebrafish sox9 co-orthologs in craniofacial and pectoral fin development Development, March 1, 2005; 132(5): 1069 - 1083. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Papasani, R. C. Gensure, Y.-L. Yan, Y. Gunes, J. H. Postlethwait, B. Ponugoti, M. R. John, H. Juppner, and D. A. Rubin Identification and Characterization of the Zebrafish and Fugu Genes Encoding Tuberoinfundibular Peptide 39 Endocrinology, November 1, 2004; 145(11): 5294 - 5304. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hans, D. Liu, and M. Westerfield Pax8 and Pax2a function synergistically in otic specification, downstream of the Foxi1 and Dlx3b transcription factors Development, October 15, 2004; 131(20): 5091 - 5102. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Miller, L. Maves, and C. B. Kimmel moz regulates Hox expression and pharyngeal segmental identity in zebrafish Development, May 15, 2004; 131(10): 2443 - 2461. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Barrallo-Gimeno, J. Holzschuh, W. Driever, and E. W. Knapik Neural crest survival and differentiation in zebrafish depends on mont blanc/tfap2a gene function Development, April 1, 2004; 131(7): 1463 - 1477. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Deflorian, N. Tiso, E. Ferretti, D. Meyer, F. Blasi, M. Bortolussi, and F. Argenton Prep1.1 has essential genetic functions in hindbrain development and cranial neural crest cell differentiation Development, February 1, 2004; 131(3): 613 - 627. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schlombs, T. Wagner, and J. Scheel Site-1 protease is required for cartilage development in zebrafish PNAS, November 25, 2003; 100(24): 14024 - 14029. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Liu, H. Chu, L. Maves, Y.-L. Yan, P. A. Morcos, J. H. Postlethwait, and M. Westerfield Fgf3 and Fgf8 dependent and independent transcription factors are required for otic placode specification Development, May 15, 2003; 130(10): 2213 - 2224. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Miller, D. Yelon, D. Y. R. Stainier, and C. B. Kimmel Two endothelin 1 effectors, hand2 and bapx1, pattern ventral pharyngeal cartilage and the jaw joint Development, April 1, 2003; 130(7): 1353 - 1365. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||