|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||

1 Department of Mathematical and Life Sciences, Graduate School of Science,
Hiroshima University, Higashi-Hiroshima 739-8526, Japan
2 Department of Integrated Biosciences, Graduate School of Frontier Sciences,
University of Tokyo, Hongo, Bunkyo-ku, Tokyo 113-0033, Japan
3 Department of Zoology, Graduate School of Science, Kyoto University, Sakyo-ku,
Kyoto 606-8502, Japan
4 LSL, Nerima-ku, Tokyo 178-0061, Japan
* Present address: Evolutionary Regeneration Biology Group, RIKEN Center for
Developmental Biology, Kobe 650-0047, Japan
Author for correspondence (e-mail:
koji{at}hiroshima-u.ac.jp)
Accepted 30 July 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Archenteron induction signal, T-brain, Sea urchin
| INTRODUCTION |
|---|
|
|
|---|
Recently, progress has been made in identifying molecular mechanisms that
underlie the specification and subsequent differentiation of the
micromere-primary mesenchyme cell (PMC) lineage (reviewed by
Davidson et al., 1998
;
Angerer and Angerer, 2000
).
First, genes encoding proteins involved in the formation of spicule have been
identified, including SM50 (Benson
et al., 1987
) and SM30
(George et al., 1991
). The
cis-regulatory systems controlling the expression of SM50
(Makabe et al., 1995
) and
SM30 (Akasaka et al.,
1994
; Frudakis and Wilt,
1995
; Yamasu and Wilt,
1999
) were analysed in detail. One of the transcription factors
responsible for SM50 and SM30 expression is Ets;
HpEts induces the expression of HpSM50 and loss of
HpEts function results in the failure of spicule formation
(Kurokawa et al., 1999
).
Second, nuclear localization of ß-catenin is essential for the autonomous
specification of micromere (Wikramanayake
et al., 1998
; Logan et al.,
1999
; Emily-Fenouil et al.,
1998
). Third, Delta, which is expressed by micromere descendants,
plays an essential role in the Notch-dependent specification of SMCs
(Sweet et al., 1999
;
McClay et al., 2000
; Sherwood
et al., 2001; Sweet et al.,
2002
).
It has been demonstrated that transcription factors containing a T-domain,
the DNA-binding domain homologous to the mouse brachyury (or
T) gene product, play important roles in various aspects of animal
development (reviewed by Herrmann and
Kispert, 1994
; Smith,
1997
; Papaioannou and Silver,
1998
). T-domains fall into a number of subfamilies, such as
brachyury, Tbx and T-brain. T-brain-1, which is expressed in
the cerebral cortex (leading to the name T-brain) was first isolated from
mouse (Bulfone et al., 1995
). A
related T-box gene, referred to as Eomesodermin, isolated from
Xenopus laevis is first expressed in the mesoderm and then expressed
in the most anterior part of the brain at the tadpole stage
(Ryan et al., 1996
;
Ryan et al., 1998
). Recently,
invertebrate homologues of T-Brain-1 have been isolated from a
hemichordate acorn worm (Tagawa et al.,
2000
), a starfish (Shoguchi et
al., 2000
) and a sea cucumber
(Maruyama, 2000
).
We report the isolation and characterization of sea urchin homologue of T-brain-1, referred to as HpTb. We suggest that HpTb is involved in the production of signals from micromere progeny responsible for gastrulation. We also propose that HpTb is involved in the cascade responsible for the production of signals required for the spicule formation, and for signals from the vegetal hemisphere required for the differentiation of oral-aboral ectoderm.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning of cDNA for the sea urchin homologue of the mouse T
gene
The amino acid sequences of T domain of the T gene products are
highly conserved among mouse (Herrmann et
al., 1990
), Xenopus
(Smith et al., 1991
),
zebrafish (Schulte-Merker et al.,
1992
), ascidians (Yasuo and
Satoh, 1994
) and sea urchins
(Harada et al., 1995
). The
sense-strand oligonucleotide that corresponds to the amino acid sequence
YIHPDSP and the antisense oligonucleotide that corresponds to the amino acid
sequence NPFAKG(A)L(F) were synthesized using an automated DNA synthesizer
(Applied Biosystems). Using these oligonucleotides as primers, we amplified
target fragments from an H. pulcherrimus gastrula cDNA library by
means of PCR. Probing with candidate cDNA fragments random-labelled with
[32P]-dCTP (Amersham), we screened the library at high stringency
(hybridization, 6xSSPE, 0.1% SDS, 1xDenhardt's solution, 50%
formamide at 42°C; washing, 2xSSC, 0.1% SDS at 65°C). The
isolated clones were subcloned into pBluescriptII SK(+) (Stratagene). The
clones were sequenced by dideoxy chain termination
(Sanger et al., 1992
). In
order to obtain a cDNA clone that contains entire open reading frame, we
re-screened H. pulcherrimus hatched blastula cDNA library with an RNA
probe synthesized from the obtained cDNA. The RNA probe was labelled with
digoxigenin (DIG)-11-UTP (Roche) using T3 Megascript kit (Ambion) as described
in the instruction manual. An antibody against digoxigenin that had been
conjugated to alkaline phosphatase was used to probe the membrane (Roche). The
chemiluminescent signal produced by enzymatic dephosphorylation of CSPD
(TROPIX) by alkaline phosphatase was detected by X-ray film.
Northern blot hybridization
The RNA was extracted from H. pulcherrimus embryos at various
developmental stages as described by Chomczynski and Sacchi
(Chomczynski and Sacchi, 1987
).
The total RNA (2 µg) was electrophoresed on each lane of a denaturing
formaldehyde-1% agarose gel, transferred to a Nytran membrane (Schleicher and
Schuell), and hybridized to the antisense RNA of HpTb labelled with
DIG-11-UTP. The signal was detected as described above.
Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed as described previously
(Kurokawa et al., 1999
).
DIG-labelled antisense RNA probe was prepared with an Ambion's Megascript kit
using DIG-11-UTP. Riboprobes were hydrolyzed with alkali to sizes of about
150-400 nucleotides, as described by Cox et al.
(Cox et al., 1984
).
Synthetic mRNA and antisense morpholino microinjection into sea
urchin eggs
To generate DNA templates for in vitro RNA synthesis, the plasmids that
contain cDNA for HpTb, truncated HpEts-FLAG
(Kurokawa et al., 1999
) and
the intracellular domain of sea urchin LvG-cadherin
(Logan et al., 1999
) were
linearized with restriction enzymes. 5' capped mRNA was synthesized by
using the T7 Megascript kit (Ambion) and Cap Analog
[m7G(5')ppp(5')G; Ambion] as described in the instruction manual.
Microinjection of sea urchin eggs was done as described by Gan et al.
(Gan et al., 1990
). Morpholino
oligonucleotides complementary to sequence containing the translation start
site of HpTb AAATTCTTCTCCCATCATGTCTCCT and the control lacZ
morpholino were obtained from Gene Tools (Corvallis). Oligonucleotides were
dissolved in 40% glycerol at a concentration of 5 pg/pl
(3.5x108 molecules/pl). Two picolitres of the solution was
injected into each fertilized egg.
Indirect immunostaining
The cDNA fragment coding for the N-terminal region of HpEts protein,
corresponding to codons 450 bp to 881 bp, and the N-terminal region of HpTb
protein, corresponding to codons 291 bp to 707 bp and 807 bp to 1373 bp, were
fused downstream to the malE gene in the pMAL-cRI vector (New England
Biolabs), which encodes the E. coli maltose-binding protein (MBP).
The fusion proteins, HpEts-MBP and HpTb-MBP, were produced in E.
coli, affinity purified using an amylose resin, and used for immunization
of rabbits to generate anti-HpEts and anti-HpTb, respectively.
Antibodies were purified using affinity column containing specific antigens
(Harlow and Lane, 1988
).
Embryos were fixed and stained with affinity-purified anti-HpEts polyclonal
sera or affinity-purified anti-HpTb polyclonal sera as described by Logan et
al. (Logan et al., 1999
).
These primary antibodies were detected with Oregon green-conjugated goat
anti-rabbit secondary antibodies (Molecular Probes). Embryos were blocked in
TBS-T (5 mM Tris-HCl, pH 7.5, 70 mM NaCl, 1.3 mM KCl, 0.5% Tween20) containing
40 mg/ml goat serum. For the staining with the Hpoe antibody
(Yoshikawa, 1997
), embryos
were fixed as described by Coffman and McClay
(Coffman and McClay, 1990
) and
the primary antibodies were detected with Texas Red-conjugated secondary
antibodies (Molecular Probes).
Western analysis
Embryos were dissolved in sample buffer [final concentration: 290 mM
Tris-HCl (pH 6.8), 8.3% SDS, 30% glycerol, 0.01% Bromphenol Blue, 4%
2-mercaptoethanol], and boiled for 5 minutes. Proteins were analysed on 8%
acrylamide gels by SDS-PAGE and transblotted on to a PVDF membrane (Immobilon
Transfer Membranes; Millipore). The membrane was reacted with
affinity-purified polyclonal anti-HpTb antibodies, followed by horseradish
peroxidase-conjugated goat anti-rabbit secondary antibodies (1:1000000; KPL),
followed by detection with Super Signal West Dura Extended Duration Substrate
(PIERCE) as an enzymatic substrate. The chemiluminescent signal was detected
by X-ray film.
RT-PCR analysis
Total RNA was isolated from 50 control and 50 mRNA-injected embryos or 50
embryos derived from animal cap mesomeres using ISOGEN (Wako). The extracted
RNAs were used to synthesize cDNA using RNA PCR kit (AMV) (Takara). An aliquot
of the RT reaction was then used for PCR containing 0.2 µM concentrations
of appropriate primers. All comparisons were performed in the linear range of
amplification. The products were resolved on 2% agarose gels and then
transferred to a Nytran membrane (Schleicher and Schuell). To visualize the
PCR products, hybridization with appropriate DIG-labelled RNA probes was
followed by commercial Fab fragments of antibody to DIG conjugated to alkaline
phosphatase (Roche). The chemiluminescent signal produced by enzymatic
dephosphorylation of CSPD by alkaline phosphatase was detected by X-ray
film.
Construction of mesomere-micromeres chimeras
Micromere and animal cap isolation, and cell transplantations were
performed by hand using a glass needles as described by Kurokawa et al.
(Kurokawa et al., 1999
).
| RESULTS |
|---|
|
|
|---|
|
We performed a molecular phylogenetic analysis using the 136 confidently aligned sites of the T-domain amino acid residues. The resultant phylogenetic tree indicates that HpTb is a T-box gene belongs to the subfamily of T-brain (Fig. 2A).
|
Fig. 2B shows a comparison
of the amino acid sequences of the T domain of HpTb with proteins encoded by
the human hu-Tbr-1 (Bulfone et
al., 1995
), mouse m-T-brain-1
(Bulfone et al., 1995
),
zebrafish zf-tbr 1 (Yonei-Tamura
et al., 1999
), X-Eomesodermin
(Ryan et al., 1996
) and
starfish Ap-Tbr (Shoguchi et al.,
2000
). Although the overall degree of amino acid identity is not
very high, in the T domain shown in Fig.
2 the extent of amino acid identity was 61% (sea urchin/mouse),
60% (sea urchin/frog), 60% (sea urchin/zebrafish) and 72% (sea
urchin/starfish). The relatively high degree of identity in the T domain
between the sea urchin protein and the mouse T-brain-1, X-Eomesodermin,
ZF-tbr 1 and Ap-Tbr proteins demonstrates that this cDNA clone
corresponds to a sea urchin homologue of the chordate T-brain
gene.
Expression of HpTb during sea urchin embryogenesis is
transient
Northern blotting analysis revealed that the HpTb transcripts are
transiently present during embryogenesis of H. pulcherrimus. The
probe produced from the entire cDNA for HpTb hybridized to a 6 kb
RNA. Although the length of the cloned HpTb cDNA isolated from
gastrula is
5 kb, 6 kb RNA seems to be actual size mRNA of HpTb.
The distinct hybridization signal for HpTb was first detected in
blastulae and the level of the signal was almost constant until gastrula
stage. Thereafter, the signal diminished rapidly
(Fig. 3A).
|
The Northern blotting also detected a very weak band of about 4.5 kb in the egg and cleavage stages (Fig. 3A). We isolated the cDNA clones from cleavage stage embryos using the entire HpTb cDNA as a probe. Sequencing of these clones revealed that the mRNAs of the cleavage stage embryos are shorter, being truncated at the C-terminal region (Fig. 1).
HpTb-transcripts localize to differentiating PMCs
We studied which territories or cell types express HpTb by means
of in situ hybridization of whole-mount specimens. At the hatched blastula
stage, the distinct signal of HpTb was detected in the presumptive
PMCs (Fig. 3B), which form a
ring around vegetal pole (Fig.
3C). At the mesenchyme blastula stage, these HpTb
positive cells migrate into the blastocoel to give rise to PMCs
(Fig. 3D). The primary
skeletogenic mesenchyme cells are derived from (large) micromeres. No
hybridization signals were detected in embryonic cells other than PMCs. After
the gastrula stage, the HpTb whole-mount hybridization signal is no
longer detectable (data not shown).
HpTb localize to nucleus of PMCs after blastula stage
Western blot analysis, using affinity-purified anti-HpTb antibodies,
revealed that HpTb protein is detected as a single band with an estimated
molecular weight of 105 kDa. As the shorter, processed HpTb-mRNAs detected in
the egg and cleavage stage embryos lack part of the coding region, we would
expect the molecular mass of the proteins translated from cleavage stage
HpTb-mRNAs to be smaller than the HpTb expressed after the blastula stage.
However, no such smaller band was detected, suggesting that the processed
HpTb-mRNA is not translated. The full-length HpTb protein is present in the
egg and cleavage stage, decreases in abundance before hatching and then
increases at the hatched blastula stage. Thereafter the level of protein
remains almost constant until the pluteus stage
(Fig. 4A). Taken together with
the results of northern blots (Fig.
3A), the results indicate that the HpTb protein is accumulated
maternally, destroyed before hatching, and then produced zygotically after the
blastula stage.
|
Immunostaining of the embryos with anti-HpTb antibodies revealed that HpTb is present in the cytoplasm, but is absent from nuclei of all blastomeres in the cleavage stage. This suggests that the maternally stored HpTb does not function as a transcription factor (Fig. 4B). After the hatching blastula stage, the HpTb disappears from blastomeres except for PMCs, and HpTb is accumulated in the nuclei of (presumptive) PMCs (Fig. 4C).
Repression of HpTb causes significant delay of
gastrulation
In order to gain the insight into the role of HpTb during
development, we designed experiments to perturb the embryo by inhibiting the
translation of HpTb by injecting fertilized eggs with HpTb morpholino
antisense oligonucleotides. When the control lacZ morpholino
(7x108 molecules/egg) or low amounts of HpTb
morpholino (1x108 molecules/egg) were injected, most of the
injected embryos developed almost normally to the pluteus stage
(Fig. 5A,B). The embryos
injected with 7x108 molecules of HpTb morpholino
seemed to be morphologically normal until hatched blastula stage (data not
shown). When control embryos, which were injected with lacZ
morpholino, had reached the early gastrula stage
(Fig. 5C), embryos injected
with HpTb morpholino showed suppressed and delayed gastrulation;
however, the ingression of PMCs into blastocoel occurred normally in such
embryos (Fig. 5D). When the
control embryos reached the prism stage
(Fig. 5E), embryos injected
with HpTb morpholino showed retarded gastrulation. Furthermore, the
differentiation of oral-aboral ectoderm seemed to be repressed, and formation
of spicules was also suppressed (Fig.
5F). As judged by cell morphology and their localization in the
animal hemisphere, secondary mesenchyme cells (SMCs) were formed in 48 hour
prism embryos injected with HpTb morpholino. At 72 hours after
fertilization, when the control embryos had reached the pluteus stage, only a
limited archenteron and a reduced number of pigment cells (approx. one-third
compared with the control embryos) were observed in the embryo injected with
HpTb-morpholino (Fig.
5H). Most of the embryos injected with 7x108
molecules (10 pg) of HpTb morpholino (n=256/267) showed this
phenotype. We confirmed that the HpTb morpholino antisense
oligonucleotides inhibited the translation of HpTb by immunostaining with
anti-HpTb antibodies (Fig.
5I,J). These results suggest that the expression of HpTb
in (developing) PMCs is required for the gastrulation, spicule formation and
the normal development of the oral-aboral axis in sea urchin development. The
formation of an archenteron was rescued in more than half of embryos injected
with HpTb morpholino by co-injection of HpTb mRNA
(n=72/128; Fig. 5K).
However the inhibition of skeletogenesis was barely rescued by co-injection of
HpTb mRNA. We cannot explain the reason for the inefficient rescue of
skeletogenesis at this point.
|
Repression of HpTb causes suppression of Ars and
SM30
We performed quantitative RT-PCR to determine the expression level of
various cell type-specific genes in the embryos injected with HpTb
morpholino. The RNA was isolated from embryos at 28 hours after fertilization,
when the control embryos had reached late gastrula stage. As a control, the
level of ubiquitin mRNA, which is almost spatially ubiquitous
(Nemer et al., 1991
), was
unaffected by injection of the HpTb morpholino.
We previously showed that HpEts, an ets-related transcription
factor, is expressed exclusively in micromere descendants after blastula
stage, and that HpEts is involved in the differentiation of PMCs
(Kurokawa et al., 1999
).
Recently, Sweet et al. (Sweet et al.,
2002
) reported that a sea urchin Delta homolog
(LvDelta) is also expressed in micromere descendants at blastula
stage, and that LvDelta is responsible for the SMC-inducing activity
of micromere descendants. In order to determine the functional relationship of
HpTb to HpEts and HpDelta, we examined the
expression of HpEts and HpDelta in embryos injected with
HpTb morpholino. As shown in Fig.
6, HpEts and HpDelta were unaffected in the
injected embryos. This was supported by the observation that PMCs, which
ingressed into the blastocoel of embryos injected with HpTb
morpholino, were immunologically positive using the anti-HpEts antibodies
(Fig. 7B). Furthermore, some
pigment cells, which are derived from SMCs, formed in morpholino injected
embryos. In addition, the expression of PMC-specific HpSM50 was not
affected by the injection with HpTb morpholino
(Fig. 6). These results suggest
that HpTb is not involved in the specification of PMCs. By contrast,
another PMC-specific gene HpSM30
(Kitajima et al., 1996
) was
suppressed in the embryos injected with HpTb morpholino
(Fig. 6). It has been reported
that expression of SM30 requires signal(s) from non-PMCs
(Urry et al., 2000
). It is
possible that HpTb is indirectly involved in the production of signal(s)
responsible for the expression of HpSM30.
|
|
Expression of the aboral ectoderm-specific gene HpArs
(Akasaka et al., 1990
) was also
suppressed in the embryos injected with HpTb morpholino, whereas
Hpoe, which is an oral ectoderm-specific epitope
(Yoshikawa, 1997
), was
expressed over almost all the surface of epithelial cells of the injected
embryos (Fig. 7D).
Wikramanayake et al. have shown that the activation of aboral
ectoderm-specific Spec1 in L. pictus requires signals from
vegetal hemisphere (Wikramanayake et al.,
1995
). Recent studies also suggest that vegetal signals are
involved in the establishment of oral-aboral axis
(Wikramanayake and Klein,
1997
; Li et al.,
1999
; Angerer and Angerer,
2000
). In order to confirm that the activation of aboral
ectoderm-specific Ars also requires interaction with vegetal
blastomeres in H. pulcherrimus embryos, we performed quantitative
RT-PCR to determine the expression level of Ars in the embryos
derived from animal cap mesomeres. The RNA was isolated from control embryos
and from embryos derived from animal cap mesomeres at 28 hours after
fertilization when the control embryo had reached the late gastrula stage. The
expression level of the Ars was significantly lower in the embryo
derived solely from animal cap mesomeres, suggesting that signals from vegetal
hemisphere are required for the activation of Ars
(Fig. 8). These results raise a
possibility that HpTb is involved in the production of vegetal signal(s)
involved in aboral ectoderm differentiation.
|
The levels of HpTa (Harada et
al., 1995
) and HpEndo16
(Akasaka et al., 1997
), both of
which are expressed in the vegetal plate at blastula stage, were not affected
by the injection of HpTb morpholino at the developmental stage we
examined, suggesting that HpTb is not involved in the initial specification of
endoderm. It is important to note that the level of expression of
HpTb was enhanced by the repression of translation of HpTb
(Fig. 6).
Repression of HpTb-translation diminishes the ability to signal to
neighbours on PMCs
Micromere-progeny induction signals have been shown to play an important
role in the specification of SMCs (McClay
et al., 2000
) and initiation of gastrulation
(Minokawa and Amemiya, 1999
;
Ishizuka et al., 2001
). As
repression of HpTb in (presumptive) PMCs leads a significant delay of
gastrulation, we predicted that HpTb might be involved in regulating
(presumptive) PMC signaling. To test this hypothesis, we prevented the
translation of HpTb in micromere descendant cells by injecting HpTb
morpholino antisense oligonucleotides. We combined animal cap mesomeres from a
normal embryo with a micromere quartet isolated from a 16-cell stage embryo
that had developed from a zygote injected with 7x108
molecules of HpTb morpholino (Fig.
9A,B). In order to follow HpTb deficient micromeres, donor embryos
were labelled by co-injecting the morpholino with 10 pg of rhodamine-dextran.
In all experiments, over 100 injected embryos were also cultured in parallel
for 48 hours to confirm that the archenteron formation was suppressed in the
donor embryos.
|
When HpTb morpholino-injected donor micromeres were combined with the animal cap mesomeres of uninjected embryo, almost all the transplanted micromere descendant cells ingressed into the blastocoel, but the injected donor micromeres only induced a very limited archenteron, and the micromeres did not form spicules (n=5/5; Fig. 9B). SMCs were either not formed at all, or very small number of SMCs were formed, in the chimaeric embryos. By contrast, when uninjected micromeres were combined with animal cap mesomeres of uninjected embryo, the micromeres ingressed and formed spicules (n=15/15). In addition, the control donor micromeres were able to induce an archenteron, oral-aboral ectoderm and SMCs (n=15/15; Fig. 9C). These data suggest that one of the functions of HpTb is to provide the micromere descendant cells with the ability to produce a signal that induces neighbouring cells to develop archenteron and SMCs. When the animal cap mesomeres derived from zygotes injected with the morpholino antisense oligonucleotides were combined with micromere quartet derived from normal embryos, the mesomeres developed archenteron, SMCs and both oral and aboral ectoderms (n=14/14; 9D,E). The micromere progeny developed spicules in the chimaeric embryos. These data support the hypothesis that HpTb morpholino antisense oligonucleotides do not affect the responsiveness of mesomeres to the signals emanating from micromere progeny.
HpTb expression is regulated by HpEts and Wnt
signalling cascade
Recent studies provide convincing evidence that ß-catenin, a molecule
of Wnt signaling cascade, plays an essential role in specification of
micromere-derived PMCs (Wikramanayake et
al., 1998
; Logan et al.,
1999
). Because HpTb is expressed exclusively in the
(presumptive) PMCs, it is probable that the HpTb expression is
regulated by nuclear localization of ß-catenin. In order to examine this
issue, we performed overexpression of intracellular domains of cadherin
(
LvG-cadherin) to deplete ß-catenin from the nuclei of blastomeres
of early embryos. We injected 2 pg of
LvG-cadherin mRNA; this
has been shown to abolish vegetal development of Lytechinus embryo
(Logan et al., 1999
). As shown
in Fig. 10, this injection of
LvG-cadherin mRNA resulted in the suppression of
HpTb; the HpTb band is barely detectable in experimental
embryos. This is consistent with the idea that HpTb is in a
downstream component of a Wnt signalling cascade that functions in the
micromere primary mesenchyme lineage of the sea urchin embryo. We examined the
expression of HpEts, which is also expressed exclusively in the
(presumptive) PMCs after blastula stage, in the embryo injected with
LvG-cadherin mRNA. The expression of HpEts was also repressed
in these injected embryos (Fig.
10). Thus, we might assume that HpTb and HpEts
are in the same cascade of gene regulation. We examined the functional
relationship of HpTb to HpEts. PMC-specific expression of
HpEts was not affected by the injection with HpTb morpholino
(Fig. 6,
Fig. 7B). Conversely, the
overexpression of the dominant negative,
HpEts, suppressed the
expression of HpTb (Fig.
11A). These results suggest that both HpEts and
HpTb are downstream components of the Wnt signalling cascade, and
that HpTb is regulated by HpEts. The expression of dominant
negative
HpEts also resulted in a significant delay and repression of
gastrulation, as well as the suppression of differentiation of PMCs
(Fig. 11C).
|
|
| DISCUSSION |
|---|
|
|
|---|
Homologs of the Tbr1 gene have been identified from hemichordates
(Tagawa et al., 2000
),
starfish (Shoguchi et al.,
2000
) and sea cucumbers
(Maruyama, 2000
). In these
deuterostome embryos, T-brain is first expressed in the region which
eventually forms endoderm and mesoderm. The hemichordate T-brain is
expressed later in the apical organ or light sensory organ
(Tagawa et al., 2000
).
Therefore, it is likely that the T-brain gene has two distinct
expression domains: in the mesoendoderm of early embryos and in the nervous
system of later embryos. The sea urchin HpTb expression in the
micromere may correspond to the first expression domain of this family, and
analogous to Eomesodermin, HpTb is likely to be critical for endoderm
and mesoderm differentiation.
Developmental roles of the HpTb in sea urchin
embryogenesis
Inhibition of translation of specific gene products with
morpholine-substituted antisense oligonucleotides is a useful way to gain
insight into the function of the gene
(Howard et al., 2001
).
HpTb is expressed specifically in (presumptive) PMCs during blastula
and mesenchyme blastula stage. The expression pattern of HpTb, and
suppression of archenteron formation caused by inhibition of the HpTb
translation in (presumptive) PMCs are both consistent with what is known of
the importance of presumptive PMCs in development
(Minokawa and Amemiya, 1999
;
Ishizuka et al., 2001
). Not
only do micromeres provide cells for the skeleton, but it is known micromere
descendants are an important source of developmental signals that affect other
tissues. Removal of micromeres during the period from forth and fifth cleavage
impairs expression of the endoderm specific Endo16 and results in
significant delay of archenteron formation
(Ransick and Davidson, 1995
).
Recently, it has been shown that signal(s) emanating from
micromere-descendants at late blastula stages are important for gastrulation
itself (Minokawa and Amemiya,
1999
; Ishizuka et al.,
2001
). Interference with (presumptive) PMC function by inhibiting
translation of HpTb with HpTb morpholino oligonucleotides led to
significant delay of gastrulation, as we report here. This is consistent with
the known important role of micromere-descendants in these processes.
The repression of HpTb did not cause the inhibition of
HpEndo16 expression. This is also consistent with the previous report
that the expression of Endo16 is induced by micromere-descendant
cells during forth to sixth cleavage stages
(Ransick and Davidson, 1995
).
It seems likely that at least three distinct signals are provided by micromere
descendant cells. The first signal(s) is produced during forth to sixth
cleavage stages, as Ransick and Davidson reported
(Ransick and Davidson, 1995
);
the second signal is Delta which is responsible for the SMC specification
(McClay et al., 2000
;
Sweet et al., 2002
) and the
third signal(s) which is produced at blastula stage when the HpTb is
expressed (Minokawa and Amemiya,
1999
; Ishizuka et al.,
2001
). The present data favour the idea that HpTb is
involved in gastrulation itself, but not in the initial specification of the
vegetal plate.
The development of embryos from aggregates between mesomeres and micromeres
(Hörstadius, 1973
;
Amemiya, 1996
) demonstrates the
organizing activity of micromeres. Normally, the mesomeres isolated from the
16-cell stage embryo form thin an epithelial ball
(Hörstadius, 1973
;
Henry et al., 1989
). Chimeras
composed of animal cap mesomeres and micromere quartet from normal embryo
developed almost normal embryos containing an archenteron, PMCs and SMCs.
Conversely, HpTb morpholino-injected donor micromere quartet combined
with the animal cap mesomeres of uninjected embryo induced only partially
invaginated archenteron, and no or few SMCs (although the donor micromere
descendant cells ingressed into blastocoel)
(Fig. 9A,B). These results
strongly support the idea that HpTb is involved in the regulation of
signal(s) from (presumptive) PMCs. Although the chimeras composed of animal
cap mesomeres and micromere quartet derived from zygotes injected with
HpTb morpholino formed no or few SMCs, the embryos injected with
HpTb morpholino formed SMCs (Fig.
5F,H) and expressed HpDelta
(Fig. 6), suggesting that
HpTb is not substantially involved in the specification of SMCs in
normal development. Injection of HpTb morpholino resulted in the
decreased number (approx. one third) of pigment cells. This raises the
possibility that HpTb is involved in the differentiation of pigment
cells indirectly.
Croce et al. have reported that the T-brain homolog referred to as
ske-T is expressed in P. lividus embryos
(Croce et al., 2001
). They
showed that transcripts hybridized with probes that detect ske-T
exist ubiquitously in egg and the early cleavage stage embryos. They also
showed that the transcripts appear after blastula stage, as we have shown in
the present study. As Croce et al. pointed out, the early transcripts are
smaller than the ske-T cDNA fragment they isolated
(Croce et al., 2001
). In our
present work, we barely detected the small transcript in the eggs and cleavage
stage embryos of H. pulcherrimus. We have also shown that the early
transcripts are not translated (Fig.
4A) and that the maternally stored HpTb protein is not present in
the nucleus, suggesting that the HpTb does not function as a transcription
factor during clevage stage (Fig.
4B). Furthermore, injection of HpTb morpholino antisense
oligo into embryos of H. pulcherrimus did not affect early
development.
When the animal cap mesomeres derived from zygotes injected with the morpholino antisense oligo were combined with a micromere quartet isolated from normal embryos, the mesomeres developed an archenteron, oral and aboral ectoderm and SMCs. Hence, even if low level of processed T-brain transcripts exist in the embryonic cells other than progeny of micromeres, they are not involved in the archenteron inducing activity, they are probably not responsible for the differentiation of oral-aboral ectoderm in H. pulcherrimus. It is also possible, of course, that differences exist between H. pulcherrimus and P. lividus.
Wikramanayake et al. (Wikramanayake et
al., 1995
) have shown that the aboral ectoderm specific genes were
not expressed in animal hemisphere explants from L. pictus,
suggesting that the ectoderm differentiation in L. pictus embryos
requires interaction with vegetal blastomeres. Using H. pulcherrimus
embryos, we also demonstrated that the embryos derived from the animal cap
mesomeres did not express aboral ectoderm specific Ars
(Fig. 8). The repression of
translation of HpTb in (presumptive) PMCs resulted in the disturbances of
patterning of oral and aboral ectoderm (overexpression of Hpoe epitope,
reduction of Ars expression). It is possible that HpTb is
involved in the production of the vegetal signals responsible (at least in
part) for patterning oral and aboral ectoderm, although we do not know if the
HpTb functions in this process directly or not.
HpTb morpholino oligonucleotides did not suppress the expression
of HpSM50, HpDelta and HpEts, suggesting that HpTb
is not involved in the specification of PMCs. In the previous paper, we have
demonstrated that ectopic expression of HpEts altered the fate of
many cells, transforming them into migrating PMCs. However, the transformed
PMCs did not form spicules without addition of serum
(Kurokawa et al., 1999
). The
expression of HpEts is necessary for the spicule formation, but it is
not sufficient for the spicule formation of PMCs. It has been reported that
another PMC-specific protein, SM30, requires signals produced by
non-PMC cells (Urry et al.,
2000
). The repression of HpSM30 after injection with
HpTb morpholino (Fig.
6) supports the idea that the differentiation of vegetal regions,
which are induced by a signal(s) emanated from (presumptive) PMCs, is required
for the production of signal(s) responsible for the spicule formation.
Cascade of the HpTb expression
We have shown that both HpEts and HpTb are downstream
components of the Wnt signalling cascade. The injection of HpTb
morpholino antisense oligonucleotides did not affect the expression of
HpEts. Conversely, the overexpression of dominant negative
HpEts repressed the expression of HpTb, the gastrulation and
the differentiation of oral-aboral ectoderm, suggesting that HpEts
regulates HpTb. The injection of the HpTb morpholino also
did not affect the expression of HpDelta, suggesting that
HpDelta is not a downstream component of HpTb.
The repression of translation of HpTb caused enhancement of HpTb
expression. There is experimental evidence that midcleavage stage blastomeres
have an extensive capacity to change their states of specification in response
to cell interactions (reviewed by
Davidson, 1989
). It has been
thought that micromere descendant cells repress the capacity of neighbouring
macromeres to change their cell fate into micromere progeny. It is possible
that the expression of HpTb in (presumptive) PMCs downregulates the
expression of HpTb in neighbouring cells.
| ACKNOWLEDGMENTS |
|---|
LvG-cadherin, to Dr C.
Ettensohn (Carnegie Mellon University) for the kind gift of cDNA for LvDelta,
and to Dr S. Yoshikawa for the kind gift of monoclonal antibody to Hpoe. The
authors also thank Dr H. Katow (Asamushi Marine Biological Station) for
supplying live sea urchins. Part of this work was carried out in the Center
for Gene Research of Hiroshima University. We thank the Cryogenic Center,
Hiroshima University for supplying liquid nitrogen. This work was supported in
part by Grants-in-Aid for Scientific Research (C2) (number 11680724) and for
Scientific Research on Priority Areas (number 11152227) to K. A. and (B1)
(number 12145101) to Y. T.; and by (A1) (number 13044001) to S. N. from the
Ministry of Education, Science, Sports and Culture, Japan, and the Program for
Promotion of Basic Research Activities for Innovative Biosciences. | REFERENCES |
|---|
|
|
|---|
Akasaka, K., Ueda, T., Higashinakagawa, T., Yamada, K. and
Shimada, H. (1990). Spatial pattern of arylsulfatase mRNA
expression in sea urchin embryo. Dev. Growth Differ.
32, 9-1.[Medline]
Akasaka, K., Frudakis, T. N., Killian, C. E., George, N. C.,
Yamasu, K., Khaner, O. and Wilt, F. H. (1994). Genomic
organization of a gene encoding the spicule matrix protein SM30 in the sea
urchin Strongylocentrotus purpuratus. J. Biol. Chem.
269,20592
-20598.
Akasaka, K., Uemoto, H., Wilt, F., Mitsunaga-Nakatsubo, K. and
Shimada, H. (1997). Oral-aboral ectoderm differentiation of
the sea urchin embryos is disrupted in response to calcium ionophore.
Dev. Growth Differ. 39,373
-379.[CrossRef][Medline]
Amemiya, S. (1996). Complete regulation of
development throughout metamorphosis of sea urchin embryos devoid of
macromeres. Dev. Growth Differ.
38,465
-476.[CrossRef]
Angerer, L. M. and Angerer, R. C. (2000).
Animal-vegetal axis patterning mechanisms in the early sea urchin embryo.
Dev. Biol. 218,1
-12.[CrossRef][Medline]
Benson, S., Sucov, H., Stephens, L., Davidson, E. and Wilt,
F. (1987). A lineage-specific gene encoding a major matrix
protein of the sea urchin embryo spicule. I. Authentication of the cloned gene
and its developmental expression. Dev. Biol.
120,499
-506.[CrossRef][Medline]
Bulfone, A., Smiga, S. M., Shimamura, K., Peterson, A., Puelles,
L. and Rubenstein, J. L. R. (1995). T-Brain-1: A
homolog of Brachyury whose expression defines molecularly distinct
domains within the cerebral cortex. Neuron
15, 63-78.[CrossRef][Medline]
Chomczynski, P. and Sacchi, N. (1987).
Single-step method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction. Anal.
Biochem. 162,156
-159.[Medline]
Ciruna, B. G. and Rossant, J. (1999).
Expression of the T-box gene Eomesodermin during early mouse
development. Mech. Dev.
81,199
-203.[CrossRef][Medline]
Coffman, J. A. and McClay, D. R. (1990). A
hyaline layer protein that becomes localized to the oral ectoderm and foregut
of sea urchin embryos. Dev. Biol.
140,93
-104.[CrossRef][Medline]
Cox, K. H., DeLeon, D. V., Angerer, L. M. and Angerer, R. C.
(1984). Detection of mRNAs in sea urchin embryos by in situ
hybridization using asymmetric RNA probes. Dev. Biol.
101,485
-502.[CrossRef][Medline]
Croce, J., Lhomond, G., Lozano, J. and Gache, C.
(2001) ske-T, a T-box gene expressed in the skeletogenic
mesenchyme lineage of the sea urchin embryo. Mech.
Dev. 107,159
-162.[CrossRef][Medline]
Davidson, E. H. (1989). Lineage-specific gene
expression and the regulative capacities of the sea urchin embryo: a proposed
mechanism. Development
105,421
-445.
Davidson, E. H., Cameron, R. A. and Ransick, A.
(1998). Specification of cell fate in the sea urchin embryo:
summary and some proposed mechanisms. Development
125,3269
-3290.[Abstract]
Emily-Fenouil, F., Ghiglione, C., Lhomond, G., Lepage, T. and
Gache, C. (1998). GSK3ß/shaggy mediates patterning along
the animal-vegetal axis of the sea urchin embryo.
Development 125,2489
-2498.[Abstract]
Frudakis, T. N. and Wilt, F. (1995). Two cis
elements collaborate to spatially repress transcription from a sea urchin
promoter. Dev. Biol.
172,230
-241.[CrossRef][Medline]
Gan, L., Wessel, G. M. and Klein, W. H. (1990).
Regulatory elements from the related Spec genes of
Strongylocentrotus purpuratus yield different spatial patterns with a
lacZ reporter gene. Dev. Biol.
142,346
-359.[CrossRef][Medline]
George, N. C., Killian, C. E. and Wilt, F. H.
(1991). Characterization and expression of a gene encoding a
30.6-kDa Strongylocentrotus purpuratus spicule matrix protein.
Dev. Biol. 147,334
-342.[CrossRef][Medline]
Harada, Y., Yasuo, H. and Satoh, N. (1995). A
sea urchin homologue of the chordate Brachyury (T) gene is
expressed in the secondary mesenchyme founder cells.
Development 121,2747
-2754.[Abstract]
Harlow, E. and Lane, D. (1988).
Antibodies: A Laboratory Manual. Cold Spring Harbor
Laboratory Press.
Henry, J. J., Amemiya, S., Wray, G. A. and Raff, R. A.
(1989). Early inductive interactions are involved in restricting
cell fates of mesomeres in sea urchin embryos. Dev.
Biol. 136,140
-153.[CrossRef][Medline]
Herrmann, B. G. and Kispert, A. (1994). The T
genes in embryogenesis. Trends. Genet.
10,280
-286.[CrossRef][Medline]
Herrmann, B. G., Labeit, S., Poustka, A., King, T. R. and
Lehrach, H. (1990). Cloning of the T gene required in
mesoderm formation in the mouse. Nature
343,617
-622.[CrossRef][Medline]
Hörstadius, S. (1973).
Experimental Embryology of Echinoderms. Clarendon
Press, Oxford.
Howard, E. W., Newman, L. A., Oleksyn, D. W., Angerer, R. C. and
Angerer, L. M. (2001). SpKrl: a direct target of
ß-catenin regulation required for endoderm differentiation is sea urchin
embryos. Development
128,365
-375.[Abstract]
Ishizuka, Y., Minokawa, T. and Amemiya, S.
(2001). Micromere-descendants at the blastula stage are involved
in normal archenteron formation in sea urchin embryos. Dev. Genes
Evol. 211,83
-88.[CrossRef][Medline]
Kitajima, T., Tomita, M., Killian, C. E., Akasaka, K. and Wilt,
F. H. (1996). Expression of spicule matrix protein gene
SM30 in embryonic and adult mineralized tissues of sea urchin
Hemicentrotus pulcherrimus. Dev. Growth Differ.
38,687
-695.[CrossRef][Medline]
Kurokawa, D., Kitajima, T., Mitsunaga-Nakatsubo, K., Amemiya,
S., Shimada, H. and Akasaka, K. (1999). HpEts, an
ets-related transcription factor implicated in primary mesenchyme cell
differentiation in the sea urchin embryo. Mech. Dev.
80, 41-52.[CrossRef][Medline]
Li, X., Wikramanayake, A. H. and Klein, W. H.
(1999). Requirement of SpOtx in cell fate decisions in the sea
urchin embryo and possible role as a mediator of ß-catenin signaling.
Development 212,425
-439.
Logan, C. Y., Mille, J. R., Ferkowicz, M. J. and McClay, D.
R. (1999). Nuclear ß-catenin is required to specify
vegetal cell fates in the sea urchin embryo.
Development 126,345
-357.[Abstract]
Makabe, K. W., Carmen, K. V., Britten, R. J. and Davidson, E.
H. (1995). Cis-regulatory control of the SM50 gene.
an early marker of skeletogenic lineage specification in the sea urchin
embryo. Development 121,1957
-1970.[Abstract]
Maruyama, Y. K. (2000). A sea cucumber homolog
of the mouse T-brain-1 is expressed in the invaginated cells of the
early gastrula in Holothuria leucospilota. Zool. Sci.
17,383
-387.[Medline]
McClay, D. R., Peterson, R. E., Range, R. C., Winter-Vann, A. M.
and Ferkowicz, M. J. (2000). A micromere induction signal is
activated by ß-catenin and acts through notch to initiate specification
of secondary mesenchyme cells in the sea urchin embryo.
Development 127,5113
-5122.[Abstract]
Minokawa, T. and Amemiya, S. (1999). Timing of
the potential of micromere- descendants in echinoid embryos to induce endoderm
differentiation of mesomere-descendants. Dev. Growth
Differ. 41,535
-547.[CrossRef][Medline]
Nemer, M., Rondinelli, E., Infante, D. and Infante, A. A.
(1991). Polyubiquitin RNA characteristics and conditional
induction in sea urchin embryos. Dev. Biol.
145,255
-265.[CrossRef][Medline]
Okazaki, K. (1975). Spicule formation by
isolated micromeres of the sea urchin embryo. Am.
Zool. 15,567
-581.
Papaioannou, V. E. and Silver, L. M. (1998).
The T-box gene family. BioEssays.
20, 9-19.[CrossRef][Medline]
Ransick, A. and Davidson, E. H. (1993). A
complete second gut induced by transplanted micromeres in the sea urchin
embryo. Science 259,1134
-1138.
Ransick, A. and Davidson, E. H. (1995).
Micromeres are required for normal vegetal plate specification in sea urchin
embryos. Development
121,3215
-3222.[Abstract]
Ryan, K., Garrett, N., Mitchell, A. and Gurdon, J. B.
(1996). Eomesodermin, a key early gene in
Xenopus mesoderm differentiation. Cell
87,989
-1000.[CrossRef][Medline]
Ryan, K., Butler, K., Bellefroid, E. and Gurdon, J. B.
(1998). Xenopus eomesodermin is expressed in neural
differentiation. Mech. Dev.
75,155
-158.[CrossRef][Medline]
Sanger, F., Nicklen, S. and Coulson, A. R.
(1992). DNA sequencing with chain terminating inhibitors.
Biotechnology 24,104
-108.[Medline]
Schulte-Merker, S., Ho, R. K., Herrmann, B. G. and
Nusslein-Volhard, C. (1992). The protein product of the
zebrafish homologue of the mouse T gene is expressed in nuclei of the
germ ring and the notochord of the early embryo.
Development 116,1021
-1032.[Abstract]
Sherwood, D. R. and McClay, D. R. (2001).
LvNotch signaling plays a dual role in regulating the position of the
ectoderm-endoderm boundary in the sea urchin embryo.
Development 128,2221
-3222.[Medline]
Shoguchi, E., Satoh, N. and Maruyama, Y. K.
(2000). A starfish homolog of mouse T-brain-1 is
expressed in the archenteron of Asterina pectinifera embryos: Possible
involvement of two T-box genes in starfish gastrulation. Dev.
Growth Differ. 42,61
-68.[CrossRef][Medline]
Smith, J. C., Price, B. M. J., Green, J. B. A., Weigel, D. and
Herrmann, B. G. (1991). Expression of a Xenopus
homolog of Brachyury (T) is an immediate-early response to
mesoderm induction. Cell
67, 79-87.[CrossRef][Medline]
Smith, J. (1997). Brachyury and the
T-box genes. Curr. Opin. Genet. Dev.
7, 474-480.[CrossRef][Medline]
Sweet, H. C., Gehring, M. and Ettensohn, C. A.
(2002). LvDelta is a mesoderm-inducing signal in the sea urchin
embryo and can endow blastomeres with organizer-like properties.
Development 129,1945
-1955.[Medline]
Sweet, H. C., Hodor, P. G. and Ettensohn, C. A.
(1999). The role of micromere signaling in Notch activation and
mesoderm specification during sea urchin embryogenesis.
Development 126,5255
-5265.[Abstract]
Tagawa, K., Humphreys, T. and Satoh, N. (2000).
T-Brain expression in the apical organ of hemichordate tornaria
larvae suggests its evolutionary link to the vertebrate forebrain.
Mol. Dev. Evol. 288,23
-31.[CrossRef]
Urry, L. A., Hamilton, P. C., Killian, C. E. and Wilt, F. H.
(2000). Expression of spicule matrix proteins in the sea urchin
embryo during normal and experimentally altered spiculogenesis.
Dev. Biol. 225,201
-213.[CrossRef][Medline]
Wikramanayake, A. H. and Klein, W. H. (1997).
Multiple signaling events specify ectoderm and pattern the oral-aboral axis in
the sea urchin embryo. Development
124, 13-20.[Abstract]
Wikramanayake, A. H., Brandhorst, B. P. and Klein, W. H.
(1995). Autonomous and non-autonomous differentiation of ectoderm
in different sea urchin species. Development
121,1497
-1505.[Abstract]
Wikramanayake, A. H., Huang, L. and Klein, W. H.
(1998). ß-Catenin is essential for patterning the maternally
specified animal-vegetal axis in the sea urchin embryo. Proc. Natl.
Acad. Sci. USA 95,9343
-9348.
Yamasu, K. and Wilt, F. H. (1999). Functional
organization of DNA elements regulating SM30, a spicule matrix gene
of sea urchin embryos. Dev. Growth Differ.
41, 81-91.[CrossRef][Medline]
Yasuo, H. and Satoh, N. (1994). An ascidian
homolog of the mouse Brachyury (T) gene is expressed
exclusively in notochord cells at the fate restricted stage. Dev.
Growth Differ. 36,9
-18.[CrossRef]
Yonei-Tamura, S., Tamura, K., Tsukui, T. and Izpisua Belmonte,
J. C. (1999). Spatially and temporally-restricted expression
of two T-box genes during zebrafish embryogenesis. Mech.
Dev. 80,219
-221.[CrossRef][Medline]
Yoshikawa, S. I. (1997). Oral/aboral ectoderm
differentiation of the sea urchin embryo depends on a planar or secretory
signal from the vegetal hemisphere. Dev. Growth
Differ. 39,319
-327.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||