spacer gif spacer gif spacer gif spacer gif ARCHIVE ANNOUNCEMENT! spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fuchikami, T.
Right arrow Articles by Akasaka, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fuchikami, T.
Right arrow Articles by Akasaka, K.
Development 129, 5205-5216 (2002)
Copyright © 2002 The Company of Biologists Limited

T-brain homologue (HpTb) is involved in the archenteron induction signals of micromere descendant cells in the sea urchin embryo

Takuya Fuchikami1, Keiko Mitsunaga-Nakatsubo1, Shonan Amemiya2, Toshiya Hosomi1, Takashi Watanabe1, Daisuke Kurokawa1,*, Miho Kataoka1, Yoshito Harada3, Nori Satoh3, Shinichiro Kusunoki4, Kazuko Takata1, Taishin Shimotori1, Takashi Yamamoto1, Naoaki Sakamoto1, Hiraku Shimada1 and Koji Akasaka1,{dagger}

1 Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Higashi-Hiroshima 739-8526, Japan
2 Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Hongo, Bunkyo-ku, Tokyo 113-0033, Japan
3 Department of Zoology, Graduate School of Science, Kyoto University, Sakyo-ku, Kyoto 606-8502, Japan
4 LSL, Nerima-ku, Tokyo 178-0061, Japan
* Present address: Evolutionary Regeneration Biology Group, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan

{dagger} Author for correspondence (e-mail: koji{at}hiroshima-u.ac.jp)

Accepted 30 July 2002


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Signals from micromere descendants play a crucial role in sea urchin development. In this study, we demonstrate that these micromere descendants express HpTb, a T-brain homolog of Hemicentrotus pulcherrimus. HpTb is expressed transiently from the hatched blastula stage through the mesenchyme blastula stage to the gastrula stage. By a combination of embryo microsurgery and antisense morpholino experiments, we show that HpTb is involved in the production of archenteron induction signals. However, HpTb is not involved in the production of signals responsible for the specification of secondary mesenchyme cells, the initial specification of primary mesenchyme cells, or the specification of endoderm. HpTb expression is controlled by nuclear localization of ß-catenin, suggesting that HpTb is in a downstream component of the Wnt signaling cascade. We also propose the possibility that HpTb is involved in the cascade responsible for the production of signals required for the spicule formation as well as signals from the vegetal hemisphere required for the differentiation of aboral ectoderm.

Key words: Archenteron induction signal, T-brain, Sea urchin


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the sea urchin, the fourth cleavage produces a 16-cell stage embryo with eight mesomeres in the animal hemisphere and four macromeres and four micromeres in the vegetal hemisphere. Micromeres are specified autonomously, as isolated micromeres give rise to skeletogenic cells in vitro (Okazaki, 1975Go), and no other fate is ever observed for micromeres when transplanted to ectopic location in the embryo. In addition, micromeres play an important role in axis formation, as shown by deletion of micromeres or their transplantation of micromeres into the animal pole region (Hörstadius, 1973Go; Ransick and Davidson, 1993Go). Removal of micromeres during the period from fourth and fifth cleavage also impairs expression of an endoderm specific gene (Ransick and Davidson, 1995Go). Furthermore, signal(s) emanating from micromere descendants at late blastula stages are important for gastrulation itself (Minokawa and Amemiya, 1999Go; Ishizuka et al., 2001Go).

Recently, progress has been made in identifying molecular mechanisms that underlie the specification and subsequent differentiation of the micromere-primary mesenchyme cell (PMC) lineage (reviewed by Davidson et al., 1998Go; Angerer and Angerer, 2000Go). First, genes encoding proteins involved in the formation of spicule have been identified, including SM50 (Benson et al., 1987Go) and SM30 (George et al., 1991Go). The cis-regulatory systems controlling the expression of SM50 (Makabe et al., 1995Go) and SM30 (Akasaka et al., 1994Go; Frudakis and Wilt, 1995Go; Yamasu and Wilt, 1999Go) were analysed in detail. One of the transcription factors responsible for SM50 and SM30 expression is Ets; HpEts induces the expression of HpSM50 and loss of HpEts function results in the failure of spicule formation (Kurokawa et al., 1999Go). Second, nuclear localization of ß-catenin is essential for the autonomous specification of micromere (Wikramanayake et al., 1998Go; Logan et al., 1999Go; Emily-Fenouil et al., 1998Go). Third, Delta, which is expressed by micromere descendants, plays an essential role in the Notch-dependent specification of SMCs (Sweet et al., 1999Go; McClay et al., 2000Go; Sherwood et al., 2001; Sweet et al., 2002Go).

It has been demonstrated that transcription factors containing a T-domain, the DNA-binding domain homologous to the mouse brachyury (or T) gene product, play important roles in various aspects of animal development (reviewed by Herrmann and Kispert, 1994Go; Smith, 1997Go; Papaioannou and Silver, 1998Go). T-domains fall into a number of subfamilies, such as brachyury, Tbx and T-brain. T-brain-1, which is expressed in the cerebral cortex (leading to the name T-brain) was first isolated from mouse (Bulfone et al., 1995Go). A related T-box gene, referred to as Eomesodermin, isolated from Xenopus laevis is first expressed in the mesoderm and then expressed in the most anterior part of the brain at the tadpole stage (Ryan et al., 1996Go; Ryan et al., 1998Go). Recently, invertebrate homologues of T-Brain-1 have been isolated from a hemichordate acorn worm (Tagawa et al., 2000Go), a starfish (Shoguchi et al., 2000Go) and a sea cucumber (Maruyama, 2000Go).

We report the isolation and characterization of sea urchin homologue of T-brain-1, referred to as HpTb. We suggest that HpTb is involved in the production of signals from micromere progeny responsible for gastrulation. We also propose that HpTb is involved in the cascade responsible for the production of signals required for the spicule formation, and for signals from the vegetal hemisphere required for the differentiation of oral-aboral ectoderm.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Embryo culture
Gametes of the sea urchin (H. pulcherrimus) were obtained by coelomic injection of 0.55 M KCl, and fertilized eggs were cultured in the artificial sea water Jamarin U (Jamarin Lab) at 16°C.

Cloning of cDNA for the sea urchin homologue of the mouse T gene
The amino acid sequences of T domain of the T gene products are highly conserved among mouse (Herrmann et al., 1990Go), Xenopus (Smith et al., 1991Go), zebrafish (Schulte-Merker et al., 1992Go), ascidians (Yasuo and Satoh, 1994Go) and sea urchins (Harada et al., 1995Go). The sense-strand oligonucleotide that corresponds to the amino acid sequence YIHPDSP and the antisense oligonucleotide that corresponds to the amino acid sequence NPFAKG(A)L(F) were synthesized using an automated DNA synthesizer (Applied Biosystems). Using these oligonucleotides as primers, we amplified target fragments from an H. pulcherrimus gastrula cDNA library by means of PCR. Probing with candidate cDNA fragments random-labelled with [32P]-dCTP (Amersham), we screened the library at high stringency (hybridization, 6xSSPE, 0.1% SDS, 1xDenhardt's solution, 50% formamide at 42°C; washing, 2xSSC, 0.1% SDS at 65°C). The isolated clones were subcloned into pBluescriptII SK(+) (Stratagene). The clones were sequenced by dideoxy chain termination (Sanger et al., 1992Go). In order to obtain a cDNA clone that contains entire open reading frame, we re-screened H. pulcherrimus hatched blastula cDNA library with an RNA probe synthesized from the obtained cDNA. The RNA probe was labelled with digoxigenin (DIG)-11-UTP (Roche) using T3 Megascript kit (Ambion) as described in the instruction manual. An antibody against digoxigenin that had been conjugated to alkaline phosphatase was used to probe the membrane (Roche). The chemiluminescent signal produced by enzymatic dephosphorylation of CSPD (TROPIX) by alkaline phosphatase was detected by X-ray film.

Northern blot hybridization
The RNA was extracted from H. pulcherrimus embryos at various developmental stages as described by Chomczynski and Sacchi (Chomczynski and Sacchi, 1987Go). The total RNA (2 µg) was electrophoresed on each lane of a denaturing formaldehyde-1% agarose gel, transferred to a Nytran membrane (Schleicher and Schuell), and hybridized to the antisense RNA of HpTb labelled with DIG-11-UTP. The signal was detected as described above.

Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed as described previously (Kurokawa et al., 1999Go). DIG-labelled antisense RNA probe was prepared with an Ambion's Megascript kit using DIG-11-UTP. Riboprobes were hydrolyzed with alkali to sizes of about 150-400 nucleotides, as described by Cox et al. (Cox et al., 1984Go).

Synthetic mRNA and antisense morpholino microinjection into sea urchin eggs
To generate DNA templates for in vitro RNA synthesis, the plasmids that contain cDNA for HpTb, truncated HpEts-FLAG (Kurokawa et al., 1999Go) and the intracellular domain of sea urchin LvG-cadherin (Logan et al., 1999Go) were linearized with restriction enzymes. 5' capped mRNA was synthesized by using the T7 Megascript kit (Ambion) and Cap Analog [m7G(5')ppp(5')G; Ambion] as described in the instruction manual. Microinjection of sea urchin eggs was done as described by Gan et al. (Gan et al., 1990Go). Morpholino oligonucleotides complementary to sequence containing the translation start site of HpTb AAATTCTTCTCCCATCATGTCTCCT and the control lacZ morpholino were obtained from Gene Tools (Corvallis). Oligonucleotides were dissolved in 40% glycerol at a concentration of 5 pg/pl (3.5x108 molecules/pl). Two picolitres of the solution was injected into each fertilized egg.

Indirect immunostaining
The cDNA fragment coding for the N-terminal region of HpEts protein, corresponding to codons 450 bp to 881 bp, and the N-terminal region of HpTb protein, corresponding to codons 291 bp to 707 bp and 807 bp to 1373 bp, were fused downstream to the malE gene in the pMAL-cRI vector (New England Biolabs), which encodes the E. coli maltose-binding protein (MBP). The fusion proteins, HpEts-MBP and HpTb-MBP, were produced in E. coli, affinity purified using an amylose resin, and used for immunization of rabbits to generate anti-HpEts and anti-HpTb, respectively.

Antibodies were purified using affinity column containing specific antigens (Harlow and Lane, 1988Go). Embryos were fixed and stained with affinity-purified anti-HpEts polyclonal sera or affinity-purified anti-HpTb polyclonal sera as described by Logan et al. (Logan et al., 1999Go). These primary antibodies were detected with Oregon green-conjugated goat anti-rabbit secondary antibodies (Molecular Probes). Embryos were blocked in TBS-T (5 mM Tris-HCl, pH 7.5, 70 mM NaCl, 1.3 mM KCl, 0.5% Tween20) containing 40 mg/ml goat serum. For the staining with the Hpoe antibody (Yoshikawa, 1997Go), embryos were fixed as described by Coffman and McClay (Coffman and McClay, 1990Go) and the primary antibodies were detected with Texas Red-conjugated secondary antibodies (Molecular Probes).

Western analysis
Embryos were dissolved in sample buffer [final concentration: 290 mM Tris-HCl (pH 6.8), 8.3% SDS, 30% glycerol, 0.01% Bromphenol Blue, 4% 2-mercaptoethanol], and boiled for 5 minutes. Proteins were analysed on 8% acrylamide gels by SDS-PAGE and transblotted on to a PVDF membrane (Immobilon Transfer Membranes; Millipore). The membrane was reacted with affinity-purified polyclonal anti-HpTb antibodies, followed by horseradish peroxidase-conjugated goat anti-rabbit secondary antibodies (1:1000000; KPL), followed by detection with Super Signal West Dura Extended Duration Substrate (PIERCE) as an enzymatic substrate. The chemiluminescent signal was detected by X-ray film.

RT-PCR analysis
Total RNA was isolated from 50 control and 50 mRNA-injected embryos or 50 embryos derived from animal cap mesomeres using ISOGEN (Wako). The extracted RNAs were used to synthesize cDNA using RNA PCR kit (AMV) (Takara). An aliquot of the RT reaction was then used for PCR containing 0.2 µM concentrations of appropriate primers. All comparisons were performed in the linear range of amplification. The products were resolved on 2% agarose gels and then transferred to a Nytran membrane (Schleicher and Schuell). To visualize the PCR products, hybridization with appropriate DIG-labelled RNA probes was followed by commercial Fab fragments of antibody to DIG conjugated to alkaline phosphatase (Roche). The chemiluminescent signal produced by enzymatic dephosphorylation of CSPD by alkaline phosphatase was detected by X-ray film.

Construction of mesomere-micromeres chimeras
Micromere and animal cap isolation, and cell transplantations were performed by hand using a glass needles as described by Kurokawa et al. (Kurokawa et al., 1999Go).


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The sea urchin conserves a homologue of the mouse T-brain gene
Using oligonucleotide primers corresponding to a conserved sequence in the T-box gene family, we amplified target fragments from H. pulcherrimus gastrula cDNA by the PCR reaction. Sequencing the amplified 300 bp-long fragments revealed that the sea urchin contains a T-box gene different from HpTa, which we previously reported as a brachyury homologue (Harada et al., 1995Go). Thus, we designated this second T-box gene as HpTb. Screening hatched blastula cDNA library (H. pulcherrimus) with DIG-labelled RNA probe yielded a clone that consisted of 4975 nucleotides. As shown in Fig. 1, the cloned fragment contains a single open reading frame of 2817 nucleotides that encodes a polypeptide of 939 amino acids and a calculated molecular mass of 105 kDa.



View larger version (109K):
[in this window]
[in a new window]
 
Fig. 1. Nucleotide and deduced amino acid sequences of the cDNA clone for the sea urchin T-box gene, HpTb. The T-domain is underlined. The termination codon is shown with an asterisk, and the potential signal sequence for polyadenylation is double underlined. The position of 3' end of cDNAs isolated from cleavage stage embryos is depicted with arrowheads. DDBJ Accession Number for HpTb is AB048760.

 

We performed a molecular phylogenetic analysis using the 136 confidently aligned sites of the T-domain amino acid residues. The resultant phylogenetic tree indicates that HpTb is a T-box gene belongs to the subfamily of T-brain (Fig. 2A).



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 2. Relationships of sea urchin T-domain proteins. (A) A phylogenetic tree of T domains. A molecular phylogenetic tree was constructed using the NJ method by a computer program (Genetyx, Software Development). The branch length is proportional to the number of amino acid substitutions. The number at each branch indicates the values of expected substitution of amino acid residues. (B) Alignment of the amino acid sequences of the T domain of T-brain subfamily members. Asterisks (*) indicate that all of the six T-brain proteins have an identical amino acid.

 

Fig. 2B shows a comparison of the amino acid sequences of the T domain of HpTb with proteins encoded by the human hu-Tbr-1 (Bulfone et al., 1995Go), mouse m-T-brain-1 (Bulfone et al., 1995Go), zebrafish zf-tbr 1 (Yonei-Tamura et al., 1999Go), X-Eomesodermin (Ryan et al., 1996Go) and starfish Ap-Tbr (Shoguchi et al., 2000Go). Although the overall degree of amino acid identity is not very high, in the T domain shown in Fig. 2 the extent of amino acid identity was 61% (sea urchin/mouse), 60% (sea urchin/frog), 60% (sea urchin/zebrafish) and 72% (sea urchin/starfish). The relatively high degree of identity in the T domain between the sea urchin protein and the mouse T-brain-1, X-Eomesodermin, ZF-tbr 1 and Ap-Tbr proteins demonstrates that this cDNA clone corresponds to a sea urchin homologue of the chordate T-brain gene.

Expression of HpTb during sea urchin embryogenesis is transient
Northern blotting analysis revealed that the HpTb transcripts are transiently present during embryogenesis of H. pulcherrimus. The probe produced from the entire cDNA for HpTb hybridized to a 6 kb RNA. Although the length of the cloned HpTb cDNA isolated from gastrula is ~5 kb, 6 kb RNA seems to be actual size mRNA of HpTb. The distinct hybridization signal for HpTb was first detected in blastulae and the level of the signal was almost constant until gastrula stage. Thereafter, the signal diminished rapidly (Fig. 3A).



View larger version (90K):
[in this window]
[in a new window]
 
Fig. 3. HpTb is activated zygotically and is expressed transiently during the blastula and gastrula stages. (A) Developmental northern blot. Two micrograms of total RNA extracted from sea urchin embryos at various developmental stages were run in parallel. The lower panel shows the rRNA bands in the ethidium bromide-stained gel. U, unfertilized egg; 16, 16-cell stage; M, morula; UB, unhatched blastula; HB, hatched blastula; MB, mesenchyme blastula; G, gastrula; Pr, prism; Pl, pluteus. (B-D) Whole-mount in situ hybridization showing spatial expression of HpTb transcript during embryogenesis. (B,C) Hatched blastulae, (B) lateral view and (C) vegetal view. (D) Early mesenchyme blastula, lateral view. PMCs migrating into the blastocoel show a positive signal. Scale bar: 50 µm.

 

The Northern blotting also detected a very weak band of about 4.5 kb in the egg and cleavage stages (Fig. 3A). We isolated the cDNA clones from cleavage stage embryos using the entire HpTb cDNA as a probe. Sequencing of these clones revealed that the mRNAs of the cleavage stage embryos are shorter, being truncated at the C-terminal region (Fig. 1).

HpTb-transcripts localize to differentiating PMCs
We studied which territories or cell types express HpTb by means of in situ hybridization of whole-mount specimens. At the hatched blastula stage, the distinct signal of HpTb was detected in the presumptive PMCs (Fig. 3B), which form a ring around vegetal pole (Fig. 3C). At the mesenchyme blastula stage, these HpTb positive cells migrate into the blastocoel to give rise to PMCs (Fig. 3D). The primary skeletogenic mesenchyme cells are derived from (large) micromeres. No hybridization signals were detected in embryonic cells other than PMCs. After the gastrula stage, the HpTb whole-mount hybridization signal is no longer detectable (data not shown).

HpTb localize to nucleus of PMCs after blastula stage
Western blot analysis, using affinity-purified anti-HpTb antibodies, revealed that HpTb protein is detected as a single band with an estimated molecular weight of 105 kDa. As the shorter, processed HpTb-mRNAs detected in the egg and cleavage stage embryos lack part of the coding region, we would expect the molecular mass of the proteins translated from cleavage stage HpTb-mRNAs to be smaller than the HpTb expressed after the blastula stage. However, no such smaller band was detected, suggesting that the processed HpTb-mRNA is not translated. The full-length HpTb protein is present in the egg and cleavage stage, decreases in abundance before hatching and then increases at the hatched blastula stage. Thereafter the level of protein remains almost constant until the pluteus stage (Fig. 4A). Taken together with the results of northern blots (Fig. 3A), the results indicate that the HpTb protein is accumulated maternally, destroyed before hatching, and then produced zygotically after the blastula stage.



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 4. HpTb protein is accumulated into PMC nucleus after blastula stage. (A) Developmental western blot. Thirty micrograms of protein prepared from embryos at various developmental stages were run in parallel. Detection procedure of HpTb protein is described in text. U, unfertilized egg; 16, 16-cell stage; M, morula; UB, unhatched blastula; HB, hatched blastula; MB, mesenchyme blastula; G, gastrula; Pr, prism; Pl, pluteus. (B,C) Immunostaining of embryos with antibodies to HpTb. (B) Morula; (C) mesenchyme blastula. Scale bar: 50 µm.

 

Immunostaining of the embryos with anti-HpTb antibodies revealed that HpTb is present in the cytoplasm, but is absent from nuclei of all blastomeres in the cleavage stage. This suggests that the maternally stored HpTb does not function as a transcription factor (Fig. 4B). After the hatching blastula stage, the HpTb disappears from blastomeres except for PMCs, and HpTb is accumulated in the nuclei of (presumptive) PMCs (Fig. 4C).

Repression of HpTb causes significant delay of gastrulation
In order to gain the insight into the role of HpTb during development, we designed experiments to perturb the embryo by inhibiting the translation of HpTb by injecting fertilized eggs with HpTb morpholino antisense oligonucleotides. When the control lacZ morpholino (7x108 molecules/egg) or low amounts of HpTb morpholino (1x108 molecules/egg) were injected, most of the injected embryos developed almost normally to the pluteus stage (Fig. 5A,B). The embryos injected with 7x108 molecules of HpTb morpholino seemed to be morphologically normal until hatched blastula stage (data not shown). When control embryos, which were injected with lacZ morpholino, had reached the early gastrula stage (Fig. 5C), embryos injected with HpTb morpholino showed suppressed and delayed gastrulation; however, the ingression of PMCs into blastocoel occurred normally in such embryos (Fig. 5D). When the control embryos reached the prism stage (Fig. 5E), embryos injected with HpTb morpholino showed retarded gastrulation. Furthermore, the differentiation of oral-aboral ectoderm seemed to be repressed, and formation of spicules was also suppressed (Fig. 5F). As judged by cell morphology and their localization in the animal hemisphere, secondary mesenchyme cells (SMCs) were formed in 48 hour prism embryos injected with HpTb morpholino. At 72 hours after fertilization, when the control embryos had reached the pluteus stage, only a limited archenteron and a reduced number of pigment cells (approx. one-third compared with the control embryos) were observed in the embryo injected with HpTb-morpholino (Fig. 5H). Most of the embryos injected with 7x108 molecules (10 pg) of HpTb morpholino (n=256/267) showed this phenotype. We confirmed that the HpTb morpholino antisense oligonucleotides inhibited the translation of HpTb by immunostaining with anti-HpTb antibodies (Fig. 5I,J). These results suggest that the expression of HpTb in (developing) PMCs is required for the gastrulation, spicule formation and the normal development of the oral-aboral axis in sea urchin development. The formation of an archenteron was rescued in more than half of embryos injected with HpTb morpholino by co-injection of HpTb mRNA (n=72/128; Fig. 5K). However the inhibition of skeletogenesis was barely rescued by co-injection of HpTb mRNA. We cannot explain the reason for the inefficient rescue of skeletogenesis at this point.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 5. Effect of injection of HpTb morpholino antisense oligonucleotides on the embryogenesis. (A,C,E,G) Control embryos injected with lacZ morpholino (7x108 molecules/egg). (B) Embryo injected with low amounts of HpTb morpholino (1x108 molecules/egg). (D,F,H-J) Embryos injected with HpTb morpholino (7x108 molecules/egg). The repression of translation of HpTb was confirmed using indirect immunofluorescence with anti-HpTb antibodies on mesenchyme blastula, (I) bright-field view, (J) epifluorescence view. (K) Embryo co-injected with 1.5 pg of HpTb-mRNA and HpTb morpholino (7x108 molecules/egg). Embryos at 28 hours (C,D,I,J), 40 hours (E,F), 48 hours (A,B,K) and 72 hours (G,H). Scale bar: 50 µm.

 

Repression of HpTb causes suppression of Ars and SM30
We performed quantitative RT-PCR to determine the expression level of various cell type-specific genes in the embryos injected with HpTb morpholino. The RNA was isolated from embryos at 28 hours after fertilization, when the control embryos had reached late gastrula stage. As a control, the level of ubiquitin mRNA, which is almost spatially ubiquitous (Nemer et al., 1991Go), was unaffected by injection of the HpTb morpholino.

We previously showed that HpEts, an ets-related transcription factor, is expressed exclusively in micromere descendants after blastula stage, and that HpEts is involved in the differentiation of PMCs (Kurokawa et al., 1999Go). Recently, Sweet et al. (Sweet et al., 2002Go) reported that a sea urchin Delta homolog (LvDelta) is also expressed in micromere descendants at blastula stage, and that LvDelta is responsible for the SMC-inducing activity of micromere descendants. In order to determine the functional relationship of HpTb to HpEts and HpDelta, we examined the expression of HpEts and HpDelta in embryos injected with HpTb morpholino. As shown in Fig. 6, HpEts and HpDelta were unaffected in the injected embryos. This was supported by the observation that PMCs, which ingressed into the blastocoel of embryos injected with HpTb morpholino, were immunologically positive using the anti-HpEts antibodies (Fig. 7B). Furthermore, some pigment cells, which are derived from SMCs, formed in morpholino injected embryos. In addition, the expression of PMC-specific HpSM50 was not affected by the injection with HpTb morpholino (Fig. 6). These results suggest that HpTb is not involved in the specification of PMCs. By contrast, another PMC-specific gene HpSM30 (Kitajima et al., 1996Go) was suppressed in the embryos injected with HpTb morpholino (Fig. 6). It has been reported that expression of SM30 requires signal(s) from non-PMCs (Urry et al., 2000Go). It is possible that HpTb is indirectly involved in the production of signal(s) responsible for the expression of HpSM30.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 6. RT-PCR analysis of various tissue specific genes in control and embryos injected with HpTb morpholino. Total RNA was isolated from 50 control embryos and 50 embryos injected with HpTb morpholino antisense oligonucleotides at 28 hours after fertilization. Southern blotting of RT-PCR products. (-) and (+) indicate uninjected and injected embryos. The genes analysed are discussed in the text.

 


View larger version (71K):
[in this window]
[in a new window]
 
Fig. 7. Localization of PMC specific HpEts and oral ectoderm specific Hpoe with antibodies. (A,C,E) Control embryo and (B,D,F) embryo injected with HpTb morpholino. (A,B) Embryos stained with antibodies to HpEts at 23 hours after fertilization; (C,D) embryos stained with antibodies to Hpoe at 40 hours after fertilization; (E,F) phase image of C,D. Scale bar: 50 µm.

 

Expression of the aboral ectoderm-specific gene HpArs (Akasaka et al., 1990Go) was also suppressed in the embryos injected with HpTb morpholino, whereas Hpoe, which is an oral ectoderm-specific epitope (Yoshikawa, 1997Go), was expressed over almost all the surface of epithelial cells of the injected embryos (Fig. 7D). Wikramanayake et al. have shown that the activation of aboral ectoderm-specific Spec1 in L. pictus requires signals from vegetal hemisphere (Wikramanayake et al., 1995Go). Recent studies also suggest that vegetal signals are involved in the establishment of oral-aboral axis (Wikramanayake and Klein, 1997Go; Li et al., 1999Go; Angerer and Angerer, 2000Go). In order to confirm that the activation of aboral ectoderm-specific Ars also requires interaction with vegetal blastomeres in H. pulcherrimus embryos, we performed quantitative RT-PCR to determine the expression level of Ars in the embryos derived from animal cap mesomeres. The RNA was isolated from control embryos and from embryos derived from animal cap mesomeres at 28 hours after fertilization when the control embryo had reached the late gastrula stage. The expression level of the Ars was significantly lower in the embryo derived solely from animal cap mesomeres, suggesting that signals from vegetal hemisphere are required for the activation of Ars (Fig. 8). These results raise a possibility that HpTb is involved in the production of vegetal signal(s) involved in aboral ectoderm differentiation.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 8. RT-PCR analysis of Ars in embryos derived from animal cap mesomeres and control embryos. The RNA was isolated from 50 embryos derived from animal cap mesomeres at 28 hours after fertilization when the control embryo had reached the late gastrula stage. Southern blotting of RT-PCR products. C, control embryos; AC, embryos derived from animal cap mesomeres.

 

The levels of HpTa (Harada et al., 1995Go) and HpEndo16 (Akasaka et al., 1997Go), both of which are expressed in the vegetal plate at blastula stage, were not affected by the injection of HpTb morpholino at the developmental stage we examined, suggesting that HpTb is not involved in the initial specification of endoderm. It is important to note that the level of expression of HpTb was enhanced by the repression of translation of HpTb (Fig. 6).

Repression of HpTb-translation diminishes the ability to signal to neighbours on PMCs
Micromere-progeny induction signals have been shown to play an important role in the specification of SMCs (McClay et al., 2000Go) and initiation of gastrulation (Minokawa and Amemiya, 1999Go; Ishizuka et al., 2001Go). As repression of HpTb in (presumptive) PMCs leads a significant delay of gastrulation, we predicted that HpTb might be involved in regulating (presumptive) PMC signaling. To test this hypothesis, we prevented the translation of HpTb in micromere descendant cells by injecting HpTb morpholino antisense oligonucleotides. We combined animal cap mesomeres from a normal embryo with a micromere quartet isolated from a 16-cell stage embryo that had developed from a zygote injected with 7x108 molecules of HpTb morpholino (Fig. 9A,B). In order to follow HpTb deficient micromeres, donor embryos were labelled by co-injecting the morpholino with 10 pg of rhodamine-dextran. In all experiments, over 100 injected embryos were also cultured in parallel for 48 hours to confirm that the archenteron formation was suppressed in the donor embryos.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 9. Loss of organizing activity of micromeres by injecting with HpTb morpholino. (A,B) Chimera composed of animal cap mesomeres from normal embryo with the micromere quartet isolated from a 16-cell stage embryo developed from zygotes injected with 7x108 molecules of HpTb morpholino (A, vegetal view; B, lateral view). (C) Control embryo. (D,E) The micromeres were labelled with rhodamine-dextran. Chimera composed of micromere quartet from normal embryo with the animal cap mesomeres isolated from a 16-cell stage embryo developed from zygotes injected with 7x108 molecules of HpTb morpholino (D, lateral view; E, vegetal view). The animal cap mesomeres were labelled with rhodamine-dextran. Left, bright-field views; right, epifluorescence views. Scale bar: 50 µm.

 

When HpTb morpholino-injected donor micromeres were combined with the animal cap mesomeres of uninjected embryo, almost all the transplanted micromere descendant cells ingressed into the blastocoel, but the injected donor micromeres only induced a very limited archenteron, and the micromeres did not form spicules (n=5/5; Fig. 9B). SMCs were either not formed at all, or very small number of SMCs were formed, in the chimaeric embryos. By contrast, when uninjected micromeres were combined with animal cap mesomeres of uninjected embryo, the micromeres ingressed and formed spicules (n=15/15). In addition, the control donor micromeres were able to induce an archenteron, oral-aboral ectoderm and SMCs (n=15/15; Fig. 9C). These data suggest that one of the functions of HpTb is to provide the micromere descendant cells with the ability to produce a signal that induces neighbouring cells to develop archenteron and SMCs. When the animal cap mesomeres derived from zygotes injected with the morpholino antisense oligonucleotides were combined with micromere quartet derived from normal embryos, the mesomeres developed archenteron, SMCs and both oral and aboral ectoderms (n=14/14; 9D,E). The micromere progeny developed spicules in the chimaeric embryos. These data support the hypothesis that HpTb morpholino antisense oligonucleotides do not affect the responsiveness of mesomeres to the signals emanating from micromere progeny.

HpTb expression is regulated by HpEts and Wnt signalling cascade
Recent studies provide convincing evidence that ß-catenin, a molecule of Wnt signaling cascade, plays an essential role in specification of micromere-derived PMCs (Wikramanayake et al., 1998Go; Logan et al., 1999Go). Because HpTb is expressed exclusively in the (presumptive) PMCs, it is probable that the HpTb expression is regulated by nuclear localization of ß-catenin. In order to examine this issue, we performed overexpression of intracellular domains of cadherin ({Delta}LvG-cadherin) to deplete ß-catenin from the nuclei of blastomeres of early embryos. We injected 2 pg of {Delta}LvG-cadherin mRNA; this has been shown to abolish vegetal development of Lytechinus embryo (Logan et al., 1999Go). As shown in Fig. 10, this injection of {Delta}LvG-cadherin mRNA resulted in the suppression of HpTb; the HpTb band is barely detectable in experimental embryos. This is consistent with the idea that HpTb is in a downstream component of a Wnt signalling cascade that functions in the micromere primary mesenchyme lineage of the sea urchin embryo. We examined the expression of HpEts, which is also expressed exclusively in the (presumptive) PMCs after blastula stage, in the embryo injected with {Delta}LvG-cadherin mRNA. The expression of HpEts was also repressed in these injected embryos (Fig. 10). Thus, we might assume that HpTb and HpEts are in the same cascade of gene regulation. We examined the functional relationship of HpTb to HpEts. PMC-specific expression of HpEts was not affected by the injection with HpTb morpholino (Fig. 6, Fig. 7B). Conversely, the overexpression of the dominant negative, {Delta}HpEts, suppressed the expression of HpTb (Fig. 11A). These results suggest that both HpEts and HpTb are downstream components of the Wnt signalling cascade, and that HpTb is regulated by HpEts. The expression of dominant negative {Delta}HpEts also resulted in a significant delay and repression of gastrulation, as well as the suppression of differentiation of PMCs (Fig. 11C).



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 10. RT-PCR analysis of HpTb and HpEts in embryos injected with intracellular domains of cadherin ({Delta}LvG-cadherin) mRNA (+) and control (-) embryos. Total RNA was isolated from 50 control and 50 mRNA-injected embryos at 28 hours after fertilization. Southern blotting of RT-PCR products.

 


View larger version (91K):
[in this window]
[in a new window]
 
Fig. 11. Effect of the ectopic expression of {Delta}HpEts on the expression of HpTb and gastrulation. (A) RT-PCR analysis of HpTb in embryos injected with {Delta}HpEts (+) mRNA and control (-) embryos. Total RNA was isolated from 50 control and 50 mRNA-injected embryos at 28 hours after fertilization. Southern blotting of RT-PCR products. (B) Control embryo and (C) embryo injected with {Delta}HpEts-mRNA at 48 hours after fertilization. Scale bar: 50 µm.

 


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The sea urchin conserves the T-brain gene
As shown in the present study, the T-brain gene is conserved in the sea urchin embryo and its expression is restricted to PMCs. The mouse T-Brain-1 gene (Tbr1 — Mouse Genome Informatics) was initially isolated from a subtracted cDNA library enriched for genes transcribed at higher levels in the stage E14.5 mouse telencephalon than in the adult telencephalon (Bulfone et al., 1995Go). Examination by in situ hybridization of mouse T-Brain-1 gene expression demonstrated that the transcript is first detected around E10.5 in the mantle zone of the telencephalon, and defines molecularly distinct domains within the cerebral cortex (Bulfone et al., 1995Go). Interestingly, molecular phylogenetic analyses based on comparison of the T-domain amino acid sequences suggest that Eomesodermin should be included in the T-Brain subfamily (Fig. 2) (Papaioannou and Silver, 1998Go). Eomesodermin was originally isolated from Xenopus laevis embryos as a novel T-box gene (Ryan et al., 1996Go). The gene is expressed in mesodermal cells in a ventral-to-dorsal gradient of increasing concentration during gastrulation, and it is critical for mesoderm differentiation (Ryan et al., 1996Go), and later it was revealed to be expressed in the forebrain of tadpoles (Ryan et al., 1998Go). Recently, a mouse homologue (Eomes; also known as Tbr2) of eomesodermin was shown to be expressed in the early primitive streak, nascent mesoderm and the anterior visceral endoderm. This early expression disappears at later stages, and a second domain of Eomes expression is observed in the telencephalon around E10.5 (Ciruna and Rossant, 1999Go).

Homologs of the Tbr1 gene have been identified from hemichordates (Tagawa et al., 2000Go), starfish (Shoguchi et al., 2000Go) and sea cucumbers (Maruyama, 2000Go). In these deuterostome embryos, T-brain is first expressed in the region which eventually forms endoderm and mesoderm. The hemichordate T-brain is expressed later in the apical organ or light sensory organ (Tagawa et al., 2000Go). Therefore, it is likely that the T-brain gene has two distinct expression domains: in the mesoendoderm of early embryos and in the nervous system of later embryos. The sea urchin HpTb expression in the micromere may correspond to the first expression domain of this family, and analogous to Eomesodermin, HpTb is likely to be critical for endoderm and mesoderm differentiation.

Developmental roles of the HpTb in sea urchin embryogenesis
Inhibition of translation of specific gene products with morpholine-substituted antisense oligonucleotides is a useful way to gain insight into the function of the gene (Howard et al., 2001Go). HpTb is expressed specifically in (presumptive) PMCs during blastula and mesenchyme blastula stage. The expression pattern of HpTb, and suppression of archenteron formation caused by inhibition of the HpTb translation in (presumptive) PMCs are both consistent with what is known of the importance of presumptive PMCs in development (Minokawa and Amemiya, 1999Go; Ishizuka et al., 2001Go). Not only do micromeres provide cells for the skeleton, but it is known micromere descendants are an important source of developmental signals that affect other tissues. Removal of micromeres during the period from forth and fifth cleavage impairs expression of the endoderm specific Endo16 and results in significant delay of archenteron formation (Ransick and Davidson, 1995Go). Recently, it has been shown that signal(s) emanating from micromere-descendants at late blastula stages are important for gastrulation itself (Minokawa and Amemiya, 1999Go; Ishizuka et al., 2001Go). Interference with (presumptive) PMC function by inhibiting translation of HpTb with HpTb morpholino oligonucleotides led to significant delay of gastrulation, as we report here. This is consistent with the known important role of micromere-descendants in these processes.

The repression of HpTb did not cause the inhibition of HpEndo16 expression. This is also consistent with the previous report that the expression of Endo16 is induced by micromere-descendant cells during forth to sixth cleavage stages (Ransick and Davidson, 1995Go). It seems likely that at least three distinct signals are provided by micromere descendant cells. The first signal(s) is produced during forth to sixth cleavage stages, as Ransick and Davidson reported (Ransick and Davidson, 1995Go); the second signal is Delta which is responsible for the SMC specification (McClay et al., 2000Go; Sweet et al., 2002Go) and the third signal(s) which is produced at blastula stage when the HpTb is expressed (Minokawa and Amemiya, 1999Go; Ishizuka et al., 2001Go). The present data favour the idea that HpTb is involved in gastrulation itself, but not in the initial specification of the vegetal plate.

The development of embryos from aggregates between mesomeres and micromeres (Hörstadius, 1973Go; Amemiya, 1996Go) demonstrates the organizing activity of micromeres. Normally, the mesomeres isolated from the 16-cell stage embryo form thin an epithelial ball (Hörstadius, 1973Go; Henry et al., 1989Go). Chimeras composed of animal cap mesomeres and micromere quartet from normal embryo developed almost normal embryos containing an archenteron, PMCs and SMCs. Conversely, HpTb morpholino-injected donor micromere quartet combined with the animal cap mesomeres of uninjected embryo induced only partially invaginated archenteron, and no or few SMCs (although the donor micromere descendant cells ingressed into blastocoel) (Fig. 9A,B). These results strongly support the idea that HpTb is involved in the regulation of signal(s) from (presumptive) PMCs. Although the chimeras composed of animal cap mesomeres and micromere quartet derived from zygotes injected with HpTb morpholino formed no or few SMCs, the embryos injected with HpTb morpholino formed SMCs (Fig. 5F,H) and expressed HpDelta (Fig. 6), suggesting that HpTb is not substantially involved in the specification of SMCs in normal development. Injection of HpTb morpholino resulted in the decreased number (approx. one third) of pigment cells. This raises the possibility that HpTb is involved in the differentiation of pigment cells indirectly.

Croce et al. have reported that the T-brain homolog referred to as ske-T is expressed in P. lividus embryos (Croce et al., 2001Go). They showed that transcripts hybridized with probes that detect ske-T exist ubiquitously in egg and the early cleavage stage embryos. They also showed that the transcripts appear after blastula stage, as we have shown in the present study. As Croce et al. pointed out, the early transcripts are smaller than the ske-T cDNA fragment they isolated (Croce et al., 2001Go). In our present work, we barely detected the small transcript in the eggs and cleavage stage embryos of H. pulcherrimus. We have also shown that the early transcripts are not translated (Fig. 4A) and that the maternally stored HpTb protein is not present in the nucleus, suggesting that the HpTb does not function as a transcription factor during clevage stage (Fig. 4B). Furthermore, injection of HpTb morpholino antisense oligo into embryos of H. pulcherrimus did not affect early development.

When the animal cap mesomeres derived from zygotes injected with the morpholino antisense oligo were combined with a micromere quartet isolated from normal embryos, the mesomeres developed an archenteron, oral and aboral ectoderm and SMCs. Hence, even if low level of processed T-brain transcripts exist in the embryonic cells other than progeny of micromeres, they are not involved in the archenteron inducing activity, they are probably not responsible for the differentiation of oral-aboral ectoderm in H. pulcherrimus. It is also possible, of course, that differences exist between H. pulcherrimus and P. lividus.

Wikramanayake et al. (Wikramanayake et al., 1995Go) have shown that the aboral ectoderm specific genes were not expressed in animal hemisphere explants from L. pictus, suggesting that the ectoderm differentiation in L. pictus embryos requires interaction with vegetal blastomeres. Using H. pulcherrimus embryos, we also demonstrated that the embryos derived from the animal cap mesomeres did not express aboral ectoderm specific Ars (Fig. 8). The repression of translation of HpTb in (presumptive) PMCs resulted in the disturbances of patterning of oral and aboral ectoderm (overexpression of Hpoe epitope, reduction of Ars expression). It is possible that HpTb is involved in the production of the vegetal signals responsible (at least in part) for patterning oral and aboral ectoderm, although we do not know if the HpTb functions in this process directly or not.

HpTb morpholino oligonucleotides did not suppress the expression of HpSM50, HpDelta and HpEts, suggesting that HpTb is not involved in the specification of PMCs. In the previous paper, we have demonstrated that ectopic expression of HpEts altered the fate of many cells, transforming them into migrating PMCs. However, the transformed PMCs did not form spicules without addition of serum (Kurokawa et al., 1999Go). The expression of HpEts is necessary for the spicule formation, but it is not sufficient for the spicule formation of PMCs. It has been reported that another PMC-specific protein, SM30, requires signals produced by non-PMC cells (Urry et al., 2000Go). The repression of HpSM30 after injection with HpTb morpholino (Fig. 6) supports the idea that the differentiation of vegetal regions, which are induced by a signal(s) emanated from (presumptive) PMCs, is required for the production of signal(s) responsible for the spicule formation.

Cascade of the HpTb expression
We have shown that both HpEts and HpTb are downstream components of the Wnt signalling cascade. The injection of HpTb morpholino antisense oligonucleotides did not affect the expression of HpEts. Conversely, the overexpression of dominant negative {Delta}HpEts repressed the expression of HpTb, the gastrulation and the differentiation of oral-aboral ectoderm, suggesting that HpEts regulates HpTb. The injection of the HpTb morpholino also did not affect the expression of HpDelta, suggesting that HpDelta is not a downstream component of HpTb.

The repression of translation of HpTb caused enhancement of HpTb expression. There is experimental evidence that midcleavage stage blastomeres have an extensive capacity to change their states of specification in response to cell interactions (reviewed by Davidson, 1989Go). It has been thought that micromere descendant cells repress the capacity of neighbouring macromeres to change their cell fate into micromere progeny. It is possible that the expression of HpTb in (presumptive) PMCs downregulates the expression of HpTb in neighbouring cells.


    ACKNOWLEDGMENTS
 
The authors express their thanks to Dr Fred Wilt for his advice in preparation and critical reading of the manuscript, to Dr D. McClay (Duke University) for the kind gift of cDNA for {Delta}LvG-cadherin, to Dr C. Ettensohn (Carnegie Mellon University) for the kind gift of cDNA for LvDelta, and to Dr S. Yoshikawa for the kind gift of monoclonal antibody to Hpoe. The authors also thank Dr H. Katow (Asamushi Marine Biological Station) for supplying live sea urchins. Part of this work was carried out in the Center for Gene Research of Hiroshima University. We thank the Cryogenic Center, Hiroshima University for supplying liquid nitrogen. This work was supported in part by Grants-in-Aid for Scientific Research (C2) (number 11680724) and for Scientific Research on Priority Areas (number 11152227) to K. A. and (B1) (number 12145101) to Y. T.; and by (A1) (number 13044001) to S. N. from the Ministry of Education, Science, Sports and Culture, Japan, and the Program for Promotion of Basic Research Activities for Innovative Biosciences.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Akasaka, K., Ueda, T., Higashinakagawa, T., Yamada, K. and Shimada, H. (1990). Spatial pattern of arylsulfatase mRNA expression in sea urchin embryo. Dev. Growth Differ. 32, 9-1.[Medline]

Akasaka, K., Frudakis, T. N., Killian, C. E., George, N. C., Yamasu, K., Khaner, O. and Wilt, F. H. (1994). Genomic organization of a gene encoding the spicule matrix protein SM30 in the sea urchin Strongylocentrotus purpuratus. J. Biol. Chem. 269,20592 -20598.[Abstract/Free Full Text]

Akasaka, K., Uemoto, H., Wilt, F., Mitsunaga-Nakatsubo, K. and Shimada, H. (1997). Oral-aboral ectoderm differentiation of the sea urchin embryos is disrupted in response to calcium ionophore. Dev. Growth Differ. 39,373 -379.[CrossRef][Medline]

Amemiya, S. (1996). Complete regulation of development throughout metamorphosis of sea urchin embryos devoid of macromeres. Dev. Growth Differ. 38,465 -476.[CrossRef]

Angerer, L. M. and Angerer, R. C. (2000). Animal-vegetal axis patterning mechanisms in the early sea urchin embryo. Dev. Biol. 218,1 -12.[CrossRef][Medline]

Benson, S., Sucov, H., Stephens, L., Davidson, E. and Wilt, F. (1987). A lineage-specific gene encoding a major matrix protein of the sea urchin embryo spicule. I. Authentication of the cloned gene and its developmental expression. Dev. Biol. 120,499 -506.[CrossRef][Medline]

Bulfone, A., Smiga, S. M., Shimamura, K., Peterson, A., Puelles, L. and Rubenstein, J. L. R. (1995). T-Brain-1: A homolog of Brachyury whose expression defines molecularly distinct domains within the cerebral cortex. Neuron 15, 63-78.[CrossRef][Medline]

Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156 -159.[Medline]

Ciruna, B. G. and Rossant, J. (1999). Expression of the T-box gene Eomesodermin during early mouse development. Mech. Dev. 81,199 -203.[CrossRef][Medline]

Coffman, J. A. and McClay, D. R. (1990). A hyaline layer protein that becomes localized to the oral ectoderm and foregut of sea urchin embryos. Dev. Biol. 140,93 -104.[CrossRef][Medline]

Cox, K. H., DeLeon, D. V., Angerer, L. M. and Angerer, R. C. (1984). Detection of mRNAs in sea urchin embryos by in situ hybridization using asymmetric RNA probes. Dev. Biol. 101,485 -502.[CrossRef][Medline]

Croce, J., Lhomond, G., Lozano, J. and Gache, C. (2001) ske-T, a T-box gene expressed in the skeletogenic mesenchyme lineage of the sea urchin embryo. Mech. Dev. 107,159 -162.[CrossRef][Medline]

Davidson, E. H. (1989). Lineage-specific gene expression and the regulative capacities of the sea urchin embryo: a proposed mechanism. Development 105,421 -445.[Abstract/Free Full Text]

Davidson, E. H., Cameron, R. A. and Ransick, A. (1998). Specification of cell fate in the sea urchin embryo: summary and some proposed mechanisms. Development 125,3269 -3290.[Abstract]

Emily-Fenouil, F., Ghiglione, C., Lhomond, G., Lepage, T. and Gache, C. (1998). GSK3ß/shaggy mediates patterning along the animal-vegetal axis of the sea urchin embryo. Development 125,2489 -2498.[Abstract]

Frudakis, T. N. and Wilt, F. (1995). Two cis elements collaborate to spatially repress transcription from a sea urchin promoter. Dev. Biol. 172,230 -241.[CrossRef][Medline]

Gan, L., Wessel, G. M. and Klein, W. H. (1990). Regulatory elements from the related Spec genes of Strongylocentrotus purpuratus yield different spatial patterns with a lacZ reporter gene. Dev. Biol. 142,346 -359.[CrossRef][Medline]

George, N. C., Killian, C. E. and Wilt, F. H. (1991). Characterization and expression of a gene encoding a 30.6-kDa Strongylocentrotus purpuratus spicule matrix protein. Dev. Biol. 147,334 -342.[CrossRef][Medline]

Harada, Y., Yasuo, H. and Satoh, N. (1995). A sea urchin homologue of the chordate Brachyury (T) gene is expressed in the secondary mesenchyme founder cells. Development 121,2747 -2754.[Abstract]

Harlow, E. and Lane, D. (1988). Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press.

Henry, J. J., Amemiya, S., Wray, G. A. and Raff, R. A. (1989). Early inductive interactions are involved in restricting cell fates of mesomeres in sea urchin embryos. Dev. Biol. 136,140 -153.[CrossRef][Medline]

Herrmann, B. G. and Kispert, A. (1994). The T genes in embryogenesis. Trends. Genet. 10,280 -286.[CrossRef][Medline]

Herrmann, B. G., Labeit, S., Poustka, A., King, T. R. and Lehrach, H. (1990). Cloning of the T gene required in mesoderm formation in the mouse. Nature 343,617 -622.[CrossRef][Medline]

Hörstadius, S. (1973). Experimental Embryology of Echinoderms. Clarendon Press, Oxford.

Howard, E. W., Newman, L. A., Oleksyn, D. W., Angerer, R. C. and Angerer, L. M. (2001). SpKrl: a direct target of ß-catenin regulation required for endoderm differentiation is sea urchin embryos. Development 128,365 -375.[Abstract]

Ishizuka, Y., Minokawa, T. and Amemiya, S. (2001). Micromere-descendants at the blastula stage are involved in normal archenteron formation in sea urchin embryos. Dev. Genes Evol. 211,83 -88.[CrossRef][Medline]

Kitajima, T., Tomita, M., Killian, C. E., Akasaka, K. and Wilt, F. H. (1996). Expression of spicule matrix protein gene SM30 in embryonic and adult mineralized tissues of sea urchin Hemicentrotus pulcherrimus. Dev. Growth Differ. 38,687 -695.[CrossRef][Medline]

Kurokawa, D., Kitajima, T., Mitsunaga-Nakatsubo, K., Amemiya, S., Shimada, H. and Akasaka, K. (1999). HpEts, an ets-related transcription factor implicated in primary mesenchyme cell differentiation in the sea urchin embryo. Mech. Dev. 80, 41-52.[CrossRef][Medline]

Li, X., Wikramanayake, A. H. and Klein, W. H. (1999). Requirement of SpOtx in cell fate decisions in the sea urchin embryo and possible role as a mediator of ß-catenin signaling. Development 212,425 -439.

Logan, C. Y., Mille, J. R., Ferkowicz, M. J. and McClay, D. R. (1999). Nuclear ß-catenin is required to specify vegetal cell fates in the sea urchin embryo. Development 126,345 -357.[Abstract]

Makabe, K. W., Carmen, K. V., Britten, R. J. and Davidson, E. H. (1995). Cis-regulatory control of the SM50 gene. an early marker of skeletogenic lineage specification in the sea urchin embryo. Development 121,1957 -1970.[Abstract]

Maruyama, Y. K. (2000). A sea cucumber homolog of the mouse T-brain-1 is expressed in the invaginated cells of the early gastrula in Holothuria leucospilota. Zool. Sci. 17,383 -387.[Medline]

McClay, D. R., Peterson, R. E., Range, R. C., Winter-Vann, A. M. and Ferkowicz, M. J. (2000). A micromere induction signal is activated by ß-catenin and acts through notch to initiate specification of secondary mesenchyme cells in the sea urchin embryo. Development 127,5113 -5122.[Abstract]

Minokawa, T. and Amemiya, S. (1999). Timing of the potential of micromere- descendants in echinoid embryos to induce endoderm differentiation of mesomere-descendants. Dev. Growth Differ. 41,535 -547.[CrossRef][Medline]

Nemer, M., Rondinelli, E., Infante, D. and Infante, A. A. (1991). Polyubiquitin RNA characteristics and conditional induction in sea urchin embryos. Dev. Biol. 145,255 -265.[CrossRef][Medline]

Okazaki, K. (1975). Spicule formation by isolated micromeres of the sea urchin embryo. Am. Zool. 15,567 -581.

Papaioannou, V. E. and Silver, L. M. (1998). The T-box gene family. BioEssays. 20, 9-19.[CrossRef][Medline]

Ransick, A. and Davidson, E. H. (1993). A complete second gut induced by transplanted micromeres in the sea urchin embryo. Science 259,1134 -1138.[Abstract/Free Full Text]

Ransick, A. and Davidson, E. H. (1995). Micromeres are required for normal vegetal plate specification in sea urchin embryos. Development 121,3215 -3222.[Abstract]

Ryan, K., Garrett, N., Mitchell, A. and Gurdon, J. B. (1996). Eomesodermin, a key early gene in Xenopus mesoderm differentiation. Cell 87,989 -1000.[CrossRef][Medline]

Ryan, K., Butler, K., Bellefroid, E. and Gurdon, J. B. (1998). Xenopus eomesodermin is expressed in neural differentiation. Mech. Dev. 75,155 -158.[CrossRef][Medline]

Sanger, F., Nicklen, S. and Coulson, A. R. (1992). DNA sequencing with chain terminating inhibitors. Biotechnology 24,104 -108.[Medline]

Schulte-Merker, S., Ho, R. K., Herrmann, B. G. and Nusslein-Volhard, C. (1992). The protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of the early embryo. Development 116,1021 -1032.[Abstract]

Sherwood, D. R. and McClay, D. R. (2001). LvNotch signaling plays a dual role in regulating the position of the ectoderm-endoderm boundary in the sea urchin embryo. Development 128,2221 -3222.[Medline]

Shoguchi, E., Satoh, N. and Maruyama, Y. K. (2000). A starfish homolog of mouse T-brain-1 is expressed in the archenteron of Asterina pectinifera embryos: Possible involvement of two T-box genes in starfish gastrulation. Dev. Growth Differ. 42,61 -68.[CrossRef][Medline]

Smith, J. C., Price, B. M. J., Green, J. B. A., Weigel, D. and Herrmann, B. G. (1991). Expression of a Xenopus homolog of Brachyury (T) is an immediate-early response to mesoderm induction. Cell 67, 79-87.[CrossRef][Medline]

Smith, J. (1997). Brachyury and the T-box genes. Curr. Opin. Genet. Dev. 7, 474-480.[CrossRef][Medline]

Sweet, H. C., Gehring, M. and Ettensohn, C. A. (2002). LvDelta is a mesoderm-inducing signal in the sea urchin embryo and can endow blastomeres with organizer-like properties. Development 129,1945 -1955.[Medline]

Sweet, H. C., Hodor, P. G. and Ettensohn, C. A. (1999). The role of micromere signaling in Notch activation and mesoderm specification during sea urchin embryogenesis. Development 126,5255 -5265.[Abstract]

Tagawa, K., Humphreys, T. and Satoh, N. (2000). T-Brain expression in the apical organ of hemichordate tornaria larvae suggests its evolutionary link to the vertebrate forebrain. Mol. Dev. Evol. 288,23 -31.[CrossRef]

Urry, L. A., Hamilton, P. C., Killian, C. E. and Wilt, F. H. (2000). Expression of spicule matrix proteins in the sea urchin embryo during normal and experimentally altered spiculogenesis. Dev. Biol. 225,201 -213.[CrossRef][Medline]

Wikramanayake, A. H. and Klein, W. H. (1997). Multiple signaling events specify ectoderm and pattern the oral-aboral axis in the sea urchin embryo. Development 124, 13-20.[Abstract]

Wikramanayake, A. H., Brandhorst, B. P. and Klein, W. H. (1995). Autonomous and non-autonomous differentiation of ectoderm in different sea urchin species. Development 121,1497 -1505.[Abstract]

Wikramanayake, A. H., Huang, L. and Klein, W. H. (1998). ß-Catenin is essential for patterning the maternally specified animal-vegetal axis in the sea urchin embryo. Proc. Natl. Acad. Sci. USA 95,9343 -9348.[Abstract/Free Full Text]

Yamasu, K. and Wilt, F. H. (1999). Functional organization of DNA elements regulating SM30, a spicule matrix gene of sea urchin embryos. Dev. Growth Differ. 41, 81-91.