|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||



1 Department of Molecular, Cellular and Developmental Biology, University of
Colorado, Boulder, CO 80309-0347, USA
2 Department of Genetics, University of Pennsylvania School of Medicine,
Philadelphia, PA 19104-6145, USA
* Present address: Department of Pediatrics, UCHSC, 4200 E. 9th Avenue, Denver,
CO 80262, USA
Present address: Array BioPharma, 3200 Walnut St., Boulder, CO 80301,
USA
Present address: EMBL Heidelberg, Meyerhofstrasse 1, Heidelberg D-69117,
Germany
Present address: Dharmacon Research, 1376 Miners Drive, Lafayette, CO 80026,
USA
¶ Author for correspondence (e-mail: wood{at}stripe.colorado.edu)
Accepted 30 July 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Embryonic patterning, Hox proteins, Meis family, PBC family, Transcription factors
| INTRODUCTION |
|---|
|
|
|---|
In the PBC family, Exd can associate with and increase the binding
specificity of the medial-group Hox proteins Ultrabithorax and AbdA, but not
the posterior-group protein AbdB (Chan et
al., 1994
; van Dijk and Murre,
1994
). Likewise, the homologous vertebrate Pbx proteins can
increase the binding specificity of the first 10 Hox paralog proteins,
including the posterior-group Hox9 and Hox10 proteins, but not that of the
posterior-group Hox11-Hox13 proteins (Shen
et al., 1997b
). In the Meis family, the vertebrate Meis/Prep
proteins associate with and increase the binding specificity in vitro of
Hox9-Hox13 proteins (Shen et al.,
1997a
).
The PBC- and Meis-family Hox co-factors in turn appear to be co-regulated
through subcellular localization (Pai et
al., 1998
). Exd, which includes both nuclear localization and
nuclear export signals in its sequence
(Rieckhof et al., 1997
), is
retained in the cytoplasm after synthesis. Complexing with Hth, however,
inactivates the export signal, and the complex becomes localized to the
nucleus where it can interact with Hox proteins
(Abu-Shaar et al., 1999
;
Ryoo et al., 1999
;
Affolter et al., 1999
).
Analogous studies in vertebrates have demonstrated similar interactions
between the Pbx and Meis/Prep proteins
(Berthelsen et al., 1999
;
Ryoo et al., 1999
), suggesting
that this may be a well-conserved mechanism for regulating Hox gene
function.
C. elegans has six Hox genes, three of which have known patterning
roles during larval development (Chisholm,
1991
; Clark et al.,
1993
; Wang et al.,
1993
). However, relatively little is so far known about earlier
Hox gene functions during embryonic development. In contrast to the situation
in Drosophila and vertebrates, only anterior- and posterior-group Hox
paralogs, ceh-13 (Brunschwig et
al., 1999
) and nob-1/php-3
(Van Auken et al., 2000
),
respectively, are essential for embryonic patterning and viability. Neither
the medial-group homologs mab-5 and lin-39, nor the
posterior-group homolog egl-5 are required for embryonic survival
(Chisholm, 1991
;
Clark et al., 1993
;
Wang et al., 1993
); even
embryos lacking function of all three of these genes develop into larvae that
exhibit patterning defects but nevertheless survive to become fertile adults
(Wrischnik and Kenyon,
1997
).
In screens for C. elegans embryonic lethal patterning mutants
(Edgar et al., 2001
), we found
a loss-of-function maternal-effect mutation in the unc-62 gene that
causes severe posterior defects (Nob phenotype) superficially similar to those
of nob-1/php-3 embryos (Van Auken
et al., 2000
) and embryos lacking zygotic function of the
caudal homolog pal-1
(Edgar et al., 2001
). We show
here that unc-62 is the C. elegans ortholog of
Drosophila hth (previously known as ceh-25)
(Burglin, 1997
), and that its
transcripts include four splice variants predicted to encode proteins with two
alternative homeodomains and strong similarity to the Meis family of Hox
co-factors. We have molecularly characterized six unc-62 alleles and
have analyzed the resulting phenotypes, which range from the originally
reported uncoordinated (Unc) phenotype
(Brenner, 1974
) through larval
defects and lethality to early embryonic arrest. Our results suggest multiple
functions for unc-62 gene products.
We have also shown that both of the two C. elegans PBC-family members, ceh-20 and ceh-40, interact genetically with unc-62. Although embryos lacking either ceh-20 or ceh-40 alone are viable, loss of both functions causes embryonic lethality that is strongly enhanced by a hypomorphic unc-62 allele, suggesting overlapping roles for these three genes during embryogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Genes and alleles referred to are as follows, by linkage group (LG).
The eT1 (III;V) reciprocal translocation was used as a balancer chromosome for unc-62 alleles. The duplication svDp1, derived from sDp3 by fusion with a sur-5::GFP reporter construct (S. Tuck, personal communication), was used to balance ceh-20 alleles.
The canonical unc-62(e644) was originally described by Brenner
(Brenner, 1974
). Previously
undescribed alleles, characterized by failure to complement e644,
were obtained as follows: ct344 from our mutant screens
(Edgar et al., 2001
),
ku234 in a screen for defects in vulval morphogenesis (M. S. and M.
Han, unpublished), and e917, s472
(Rosenbluth et al., 1988
) and
t2012 as gifts from A. Chisolm, D. Baillie, and R. Schnabel,
respectively.
All unc-62 mutations were outcrossed at least three times; s472 was outcrossed ten times prior to phenotypic analysis. Homozygous lethal mutations were balanced over eT1 (III;V) or over LGV doubly marked with unc-60 and dpy-11. The s472 deletion mutation was maintained as unc-62(s472) unc-46(e177)/unc-60(m35) dpy-11(e224); presence of the s472 deletion was verified by PCR.
To determine whether the strong ceh-20 allele ay38
(kindly supplied by M. Stern) is likely to be a null mutation, we used direct
PCR sequencing to show that it is a C
T transition predicted to cause
premature termination of translation (Q102
stop, as also found by E. Chen
and M. Stern, personal communication) near the start of the PBC-B domain.
Genetic tests in an unc-62(e644) background showed that homozygous
ceh-20(ay38) results in higher lethality than either
ceh-20(RNAi) or the hemizygous mutant ceh-20(ay38)/nDf16.
Moreover, heterozygous ay38/+ caused a dominant enhancement of
lethality, and ay38/ay38/+ caused a more severe dominant enhancement.
These results indicate that ay38 exhibits antimorphic character in
this background and, therefore, is not a null allele (data available on
request).
Viability assays
Embryonic and larval lethality were scored by allowing hermaphrodites to
lay eggs for 24 hours (20°C) and then transferring the parents to a new
plate daily for the next 3-4 days. Twenty-four hours after the hermaphrodite
was removed from a plate, all progeny were scored for viability by counting
unhatched embryos and living larvae. To assess lethality at later larval
stages, surviving animals were followed until they died or became fertile
adults.
Microscopy and lineage analysis
Phenotypic analyses and immunofluorescence microscopy were carried out as
described (Edgar et al., 2001
)
using a Leitz microscope equipped with Nomarski optics and UV
epi-illumination. Antibodies to LIN-26 and MHC-A were kindly provided by M.
Labouesse and R. Waterston, respectively; an integrated jam-1::GFP
reporter construct was obtained from M. Han; the ceh-20::GFP reporter
construct pHK110, including 2.2 kb of ceh-20 promoter sequence and
encoding full-length CEH-20 fused at the C terminus with GFP, was kindly
provided by H. Kagoshima and T. Burglin. Lineage analysis was performed with a
multi-focal-plane time-lapse video recording system
(Thomas et al., 1996
); embryos
were typically recorded for 5-6 hours post-fertilization at 22°C.
Identification of unc-62 lesions
Genomic DNA fragments were amplified using suitable PCR primers across a
27 kb region containing unc-62. All unc-62 lesions were
identified and confirmed by direct PCR sequencing. For s472, the
proximal and distal endpoints are located in the sequences
TAAGTTGTCCTTAGTCTTATTAAAA and GCTTTGTGTGTGTGTGAACAGTTAT,
respectively (underlined bases are deleted). For ct344, the proximal
and distal endpoints are located in the sequences
ACTTCAAACGATCAAATAATGATTT and CGGGTTTACAGCCCTGAATAGGTT,
respectively. The e917 molecular lesion was identified as a probable
inversion by inverse PCR sequencing of religated Sau3AI fragments of
e917 genomic DNA; inversion was confirmed by direct PCR sequencing
across the break points. One break point was located in the unc-62
region of LGVL (cosmid T08H10), 8.25 kb upstream of the exon 1a start codon
(see Fig. 6); the other was
found on the right arm of V (included in YAC Y40H4A). For additional
characterization of this rearrangement, see supplemental data at
http://dev.biologists.org/supplemental/.
|
RNA interference, RNA blots and quantitative PCR
RNAi was performed essentially as described
(Montgomery et al., 1998
;
Tabara et al., 1998
). cDNA
templates were either obtained from Y. Kohara (unc-62 and
ceh-20) or generated by RT-PCR from C. elegans embryonic
total RNA, and were transcribed using standard methods prior to annealing to
produce double-stranded (ds) RNA. dsRNA was used either for injection
(Montgomery et al., 1998
) or
soaking
(http://nematode.lab.nig.ac.jp/db/rnai_s/RNAiBySoaking.htm)
(spermidine and gelatin were omitted from the soaking mix) at concentrations
of 0.2-1.0 mg/ml. Progeny embryos scored for viability and subsequent larval
defects were collected during a 24-96 hour period after injection or a 48-96
hour period after soaking.
For RNA blots total RNAs from the populations described below were
isolated, run on formaldehyde gels and blotted onto Hybond-N membranes
(Amersham) as described previously (Streit
et al., 1999
).
For quantitative PCR RNA samples were reverse transcribed with an
unc-62 gene-specific primer using SuperScript IITM (Invitrogen)
under conditions described by the manufacturer. PCR assays with primer pairs
recognizing common sequences near the 3' and 5' ends of the mRNAs
showed that full-length cDNAs had been generated. Each cDNA sample was then
amplified in triplicate with four transcript-specific primer pairs as well as
a reference primer pair common to all four transcripts. Amplification
reactions were carried out simultaneously in an ABI Prism 7700 Sequence
Detection System, using SYBR® Green PCR Master Mix (Applied Biosystems) to
allow the course of each reaction to be followed. Using the mean values from
each set of three reactions, ratios of each individual transcript to total
unc-62 mRNA were determined. The relative ratios were calculated by
the 2
CT method
(Livak and Schmittgen, 2001
),
using the common reference primer pair as the internal control and the EE
sample as the calibrator for each primer pair.
GenBank Accession Numbers
Accession numbers for the four unc-62 transcripts 1a-7a, 1a-7b,
1b-7a and 1b-7b are AF427474, AF427475, AF427476 and AF427477,
respectively.
| RESULTS |
|---|
|
|
|---|
|
Sequencing of five unc-62 cDNA clones from the C. elegans
EST collection, as well as RT-PCR and 5'-RACE products confirmed the
general gene structure predicted by Burglin
(Burglin, 1997
). However, our
analysis revealed a second start exon 5' to that predicted originally,
and also showed that the 5' end of exon 7a is 249 bp downstream of the
originally predicted position (Fig.
1B). The 12 exons of unc-62 are distributed over about 15
kb of DNA. The sequencing revealed four alternative transcripts that differ in
choice of the first exon (1a or 1b) and the seventh exon (7a or 7b).
5'-RACE analysis showed no evidence for any further upstream exons, but
demonstrated that exon 1a is trans-spliced to the splice leader SL1, while
exon 1b is not. Exons 7a and 7b encode alternative polypeptide sequences that
include the most N-terminal region of the homeodomain. Of the two, the
7a-encoded sequence is more similar to the Drosophila Hth and murine
Meis homeodomains. Three of the five cDNA clones sequenced were full length;
two of these contained exon 1a and one contained exon 1b. However, all five
cDNAs contained exon 7b; transcripts containing exon 7a were detected only by
RT-PCR. No transcripts were detected that contained both 7a and 7b. The four
alternative transcripts will be referred to subsequently as 1a-7a, 1a-7b,
1b-7a and 1b-7b, respectively (see Materials and Methods for GenBank Accession
Numbers).
Differential accumulation of unc-62 transcripts
RNA blot analysis of stage-specific total RNA with transcript-specific
probes showed different accumulation patterns for the four unc-62
mRNAs (Fig. 2A). The
1a-containing mRNAs were more abundant than the 1b-containing mRNAs, but their
temporal patterns of accumulation appeared similar. Both were present in adult
germline, pregastrulation embryos, later embryos and adult soma. The 7a
signals were too weak to assess relative abundances at different stages. The
7b-containing mRNAs appeared much more abundant than the 7a RNAs in both
embryos and adults
|
Non-uniformity of sample loading made quantitation from RNA blots difficult
(Fig. 2A). Further evidence for
differential accumulation was obtained using quantitative real-time PCR
analysis (QPCR) with appropriate transcript-specific primers
(Giulietti et al., 2001
;
Livak and Schmittgen, 2001
).
These experiments allowed us to compare the ratio of each transcript to total
unc-62 mRNA at later stages relative to this ratio in early embryos.
The results, summarized in Fig.
2B, are consistent with the RNA blot results, but also show that
the levels of the rare 7a transcripts increase over 100-fold from early
embryos to adulthood. In addition, the QPCR results show that the levels of 7b
mRNAs (unclear from the RNA blot because of non-uniform loading) are
approximately the same in adult soma and complete adults, indicating that both
7b and 7a mRNAs are present in adult soma. The lower relative levels of 7a
mRNAs in complete adults compared with adult soma raises the possibility that
7a mRNAs are not present in the hermaphrodite germline.
Functional tests for differential transcript requirements during
development were attempted using RNAi with four transcript-specific dsRNAs,
prior to the publication of evidence for spreading of RNAi that makes such
experiments unlikely to be informative
(Lipardi et al., 2001
). The
dsRNAs used had to be small in order to be transcript specific, and did not
cause significant phenotypic defects (data not shown).
Molecular lesions in unc-62 mutants
The six mutants analyzed phenotypically (see following section) included a
severe zygotic embryonic lethal (s472), two mutants with weaker
zygotic effects (e644, ku234) and three primarily maternal-effect
lethal mutants of different severities. Sequencing of unc-62 from
mutant strains revealed molecular lesions corresponding to all six of these
alleles. Three of the mutations affect coding sequence, and two affect
upstream putative regulatory sequences
(Fig. 1B).
The severe zygotic allele s472 is a 6.3 kb deletion that removes
1.6 kb of upstream sequence, both alternative first exons 1a and 1b, and exons
2, 3 and 4, which encode most of the HM domain. This allele seems likely to be
a molecular null. The weaker zygotic allele e644 is a single base
transition that changes the Trp410 (TGG) codon to a stop (TAG) codon in the
alternatively spliced exon 7b, corresponding to the 19th residue of the
homeodomain (Fig. 1D). The
resulting transcript should be degraded by the smg system for
nonsense-mediated decay (Pulak and
Anderson, 1993
). A test for effects of inactivating the
smg system on phenotypes resulting from the e644 mutation
showed a substantial increase in viability, from 29% (n=968) in the
original smg(+) strain to 69% (n=932) in a
smg-1 mutant background. Therefore, e644 is acting as a
hypomorphic rather than an antimorphic allele. The weakest zygotic allele
ku234 is a single base transition that changes the predicted initial
Met (ATG) codon in exon 1b to an Ile (ATA) codon. The next predicted Met codon
does not occur until the 39th codon of the 1b transcript, 16 codons before the
start of the HM-domain coding region in exon 2
(Fig. 1C).
The most severe of the maternal-effect lethal mutations, t2012, is
a single base transition that changes the first possible translational start
in exon 1a from a Met (ATG) to an Ile (ATA) codon. The next predicted Met
codon is in exon 2 as indicated above; this is codon 73 of the exon 1a
transcript. The less severe maternal-effect lethal mutation ct344 is
a 7.2 kb deletion, beginning 7.2 kb upstream of exon 1a. The deletion removes
3.6 kb of potential unc-62 regulatory sequence, as well as a
putative upstream gene (T08H10.1), which is predicted to encode the enzyme
aldose reductase. In RNAi experiments, injection of N2 hermaphrodites with
dsRNA made using a 0.9 kb cDNA for this gene caused increases of only 5%
embryonic and 4% subsequent larval lethality over controls (n=1193
progeny), suggesting that loss of T08H10.1 function in ct344 does not
contribute significantly to the resulting phenotype. The third maternal-effect
lethal mutation, e917, is a complex chromosomal rearrangement (see
Materials and Methods; see supplemental data at
http://dev.biologists.org/supplemental/).
One inversion breakpoint occurs 8.25 kb upstream of exon 1a, within the region
deleted by the ct344 mutation, while the other is on the right arm of
LGV.
unc-62 mutations result in a variety of phenotypes
The deletion allele s472 causes 100% zygotic lethality among the
homozygous progeny of heterozygous hermaphrodites. Of these, 84% die as
unhatched embryos, some of which fail to enclose completely and rupture at
elongation [Table 1;
Fig. 3A; supplemental Fig. S2
(at
http://dev.biologists.org/supplemental/)].
The remaining 16% survive to hatching but display a variety of morphological
defects consistent with failures of hypodermal and muscle patterning and
differentiation. Lineage analysis (n=3) showed misaligned cleavages
and mispositioning of the C (dorsal) and V (lateral seam cell) precursors as
early as the 100-cell stage, resulting in V cells in dorsal positions and C
cells more lateral and posterior than in wild-type embryos, as described below
for the two strong maternal-effect alleles
(Fig. 4B). C muscle precursors
were also mispositioned (n=1). Ventral cleft closure, the last stage
of gastrulation (at
300 cells), was incomplete at the posterior in two
out of three embryos lineaged. In three out of three, subsequent hypodermal
enclosure was delayed and a few cells were extruded [supplemental Fig. S2 at
(http://dev.biologists.org/supplemental/)].
These embryos failed to elongate. Mutant s472 embryos expressing a
JAM-1::GFP reporter, which localizes to the tight junctions between hypodermal
cells, showed variable hypodermal cell defects: seam cells could be reduced in
number, not touching or grouped in patches
(Fig. 4G,H). In contrast to
nob-1 embryos (Van Auken et al.,
2000
), the gut (E) lineage appeared normal (n=1).
|
|
|
|
The canonical allele e644, in addition to the originally described
Unc phenotype (Brenner, 1974
),
results in zygotic defects that cause 20% lethality among the homozygous
mutant progeny of heterozygous hermaphrodites, primarily during larval stages
(Table 1). The e644
homozygotes that survive to adulthood exhibit a much higher level (67%) of
progeny lethality (Table 1),
indicating a significant maternal effect. Some of these progeny die as
embryos, but about half are inviable larvae with variable phenotypes, some of
which probably result from abnormal embryonic development
(Fig. 3B). The defective
embryos show variable misplacement of seam cells and failure of hypodermal
cells to fuse normally into hypodermal syncytia
(Fig. 4I,J). Surviving
e644 mutant adults display several phenotypes, including Unc,
egg-laying-defective (Egl) and variably abnormal larval morphology (Vab).
Previous studies suggested that the Unc movement defects may be a result of
aberrant axonal outgrowth of motoneurons
(Siddiqui, 1990
). The Egl
animals appear to have normal vulval structures but fail to lay eggs, even
when treated with serotonin (5-HT) (data not shown), which stimulates the
vulval muscles to promote egg-laying
(Thomas et al., 1990
;
Trent et al., 1983
). This
result suggests that the Egl animals are defective in vulval muscles rather
than vulval innervation. Causes of the Vab phenotype are unknown.
The third non-maternal allele, ku234, was isolated in independent screens for Egl mutations (M. S. and M. H., unpublished). Although 13% of the progeny of homozygous ku234 hermaphrodites die as embryos and larvae (Table 1), the survivors exhibit no gross morphological defects during embryonic or larval stages. However, about 50% of the survivors have visible vulval defects (Fig. 5) and 100% are Egl. The vulval phenotypes of ku234/s472 and the hemizygous ku234/sDf27 are only marginally more severe than those of ku234 homozygotes (Fig. 5). The ku234 mutation was identified as an unc-62 allele on the basis of its failure to complement s472 and e644 (see Materials and Methods and supplemental data at http://dev.biologists.org/supplemental/). However, it does complement the maternal-effect lethal alleles t2012, ct344 and e917.
|
The three alleles t2012, ct344 and e917 result primarily in maternal-effect lethality. Although they also exhibit zygotic effects to different degrees, as discussed below, most of the homozygous progeny embryos from hermaphrodites heterozygous for these alleles develop into fertile adults that appear normal (Table 1). These homozygous hermaphrodites produce nearly 100% inviable embryos and defective larvae by self-fertilization. However, when mated to wild-type males, both t2012 and ct344 hermaphrodites produce 80-90% viable progeny of genotype unc-62/+ (Table 2). Similar rescue experiments with unc-62/+ males indicate that rescue depends on introduction of the + allele (i.e. there is no paternal effect; all surviving progeny are of genotype unc-62/+). e917 hermaphrodites exhibit behavior similar to t2012 and ct344 hermaphrodites in both types of experiments (data not shown). Therefore, these three alleles behave as partial (male-rescuable) maternal rather than strict maternal-effect mutations.
|
For t2012, the most severe of the maternal-effect alleles, almost
all the self-progeny of homozygous hermaphrodites arrest as unhatched embryos
(Table 1). These embryos
execute the normal embryonic lineage pattern in terms of timing and numbers of
divisions (n=2) and produce differentiated gut, muscle and pharyngeal
tissue. However, they exhibit early misplacement of hypodermal precursor cells
(Fig. 4C) and generally fail to
undergo normal enclosure, elongation and morphogenesis
(Fig. 3C). In addition, they
fail to produce the normal number of differentiated hypodermal cells in
embryos and larvae as identified using antibodies to the hypodermal marker
LIN-26 (Labouesse et al.,
1996
). LIN-26, normally expressed in
84 cells, was detected
(by immunofluorescence using an anti-LIN-26 antibody) in an average of only 64
cells (range 53-75; n=28) among progeny of homozygous t2012
hermaphrodites. Severe disorganization was seen among these cells in
t2012 mutant embryos expressing the JAM-1::GFP reporter construct
(Fig. 4K,L), as well as among
body-wall muscle cells visualized with anti-MHC-A (not shown). The
t2012 allele also results in some zygotic lethality
(Table 1) with similar gross
embryonic phenotypes.
Homozygous ct344 hermaphrodites produce embryos that generally arrest later than those from t2012 animals, resulting in roughly equal numbers of unhatched embryos and hatched inviable larvae (Table 1). Embryos usually progress through morphogenesis, but often display a Nob phenotype in which anterior head and pharyngeal structures develop normally, but the posterior is severely malformed (Fig. 3D). As in t2012 embryos, although the embryonic cell lineage pattern of ct344 embryos appears normal (n=2), hypodermal precursors are misplaced by the early gastrulation stage (Fig. 4D), and hypodermal cells are under-represented and grossly disorganized in Nob larvae, as if they fail to differentiate properly (Fig. 4M,N). The ct344 allele also results in some zygotic lethality (Table 1) with similar gross embryonic phenotypes.
Table 2 shows the lethality resulting from heteroallelic genotypes derived from e644, t2012 and ct344. Heteroallelic ct344/t2012 embryos are all inviable, regardless of the parental origins of the two alleles. Interestingly, however, t2012/e644 embryos are >50% viable if t2012 is introduced from the male parent, but 0% viable if the maternal parent is homozygous for t2012. Such non-reciprocality is not observed for ct344/e644 embryos; their viability is similar to that of e644 embryos regardless of the parental origin of ct344. These results are consistent with other observations that ct344 is a weaker allele than t2012.
The third maternal-effect allele e917 is similar to ct344
in the percentages of embryonic and larval lethality among the self progeny of
homozygous hermaphrodites (Table
1). However, the resulting larvae appear to be generally less
defective morphologically (Fig.
3E). The
3% that survive to be fertile adults display a
variety of defects including Egl, Unc and Vab. This allele causes almost no
zygotic lethality (Table 1),
but the homozygous progeny of heterozygous hermaphrodites display the Egl
phenotype. Because e917 is a complex rearrangement as described above
and could affect other genes besides unc-62, the resulting phenotypes
were not analyzed in detail.
The C. elegans PBC-family genes ceh-20 and
ceh-40 may function redundantly during embryogenesis
To test whether the strong interactions observed between MEIS- and
PBC-family proteins in both Drosophila and vertebrates (see
Introduction) might also occur in C. elegans, we first analyzed loss
of function phenotypes for the C. elegans PBC-class gene
ceh-20. Preliminary characterization of the strong ceh-20
allele ay38 indicated that it is probably antimorphic (see Materials
and Methods) and thus inappropriate for interaction studies. A previous
description by Liu and Fire (Liu and Fire,
2000
) of the ceh-20(RNAi) phenotype, which they concluded
to be null, reported failure of post-embryonic development in the M lineage
but little or no embryonic lethality. We obtained similar results
(Table 3, rows 4 and 5),
suggesting that ceh-20 is not essential during embryogenesis.
However, there is a second PBC-family homolog in C. elegans, the
predicted gene ceh-40. The predicted protein products of the two
genes are 41% identical overall and 74% identical in the homeodomain
(Burglin, 1997
), suggesting
that ceh-20 and ceh-40 might function redundantly. No
ceh-40 mutations have been described, and no ceh-40 cDNAs
were found in current databases. However, microarray experiments have shown
that ceh-40 transcripts, absent maternally, appear in embryos at low
levels around the onset of gastrulation (L. R. Baugh and C. P. Hunter,
personal communication). A ceh-40 cDNA was obtained using RT-PCR with
embryonic mRNA, allowing us to confirm the splice sites of the exons predicted
from genomic sequence. When ceh-40(RNAi) was carried out in N2
animals using dsRNA made from this template, no significant embryonic or early
larval lethality was observed (Table
3, row 3). Consistent with redundant function, the combination of
ceh-40(RNAi) with ceh-20(RNAi) caused 21% embryonic
lethality (Table 3, row 6), a
significant increase over either RNAi alone. However, the phenotypes of the
dying embryos were not obviously similar to those resulting from the
unc-62(s472) null allele. [While this paper was in revision, a
similar identification of ceh-40 was reported by Takacs-Vellai et al.
(Takacs-Vellai et al., 2002
),
who also demonstrated embryonic expression of a ceh-40::GFP
construct.]
Losses of ceh-20 and ceh-40 functions interact
strongly with the unc-62(e644) mutation to give an
unc-62(null) phenotype
To test for genetic interactions between the PBC-family genes and
unc-62, we used the semi-viable unc-62(e644) allele
(Table 1). Because the variety
of abnormal phenotypes observed among unc-62(e644) homozygous larvae
(Fig. 3) made it impractical to
reliably detect enhancement of larval defects, we scored only enhancement of
lethality as a measure of ceh-20(RNAi) and ceh-40(RNAi)
interaction. The unc-62(e644); ceh-40(RNAi) combination resulted in a
slight enhancement of embryonic lethality and overall lethality compared to
unc-62(e644) alone (Table
3, rows 7 and 8). The ceh-20(RNAi); unc-62(e644)
combination caused an enhancement of embryonic lethality and a larger increase
in overall lethality (Table 3,
rows 7 and 9). Most strikingly, the triple combination ceh-20(RNAi);
unc-62(e644); ceh-40(RNAi) caused high embryonic and overall lethality,
similar to that seen with unc-62(RNAi)
(Table 3, rows 10 and 11).
Moreover, the phenotypes of the dying, hatched larvae resembled those
resulting from the null allele unc-62(s472)
(Table 1,
Fig. 3) and
unc-62(RNAi) (Table
3). Other experiments showed that overexpression of
ceh-20 enhanced the lethality and other phenotypes resulting from
s472/+, e644, and ct344 [see legend to supplemental Fig. S4
(http://dev.biologists.org/supplemental/)].
Additional evidence for interaction was obtained in experiments to test whether nuclear localization of a CEH-20::GFP fusion protein would be affected by unc-62 defects, as predicted from studies cited in the Introduction showing that Drosophila Hth and vertebrate Meis functions are required for nuclear localization of Exd and Pbx proteins, respectively. In wild-type embryos, CEH-20::GFP was found to be expressed in many cells, all of which exhibited nuclear localization. In unc-62(ct344), unc-62(e644) and unc-62(RNAi) embryos, expression was still widespread, but nuclear localization, like the other mutant phenotypes, was variable, observed in none to about half of the expressing cells [see supplemental Fig. S4 (http://dev.biologists.org/supplemental/)].
| DISCUSSION |
|---|
|
|
|---|
Assuming these suggestions are valid, we can make several predictions about
the time of synthesis and function of the unc-62 mRNAs and their
translation products. 1a transcripts must be required in the early embryo
because the self-progeny of t2012/t2012 hermaphrodites (lacking 1a)
are all inviable. Apparently either maternal or zygotic provision of the
1a-containing transcripts is equally effective in promoting survival, because
either the self-progeny t2012/t2012 embryos from t2012/+
hermaphrodites or the t2012/+ cross-progeny embryos from
t2012/t2012 hermaphrodites mated to wild-type males are
90%
viable. 1a-containing transcripts are usually sufficient for survival because
87% of the self progeny of ku234/ku234 hermaphrodites (lacking 1b)
are viable. However, we observe a strong dependence of viability on dose of 1a
transcripts. 1a transcripts can be reduced by 75% (t2012 homozygous
progeny of a t2012/+ heterozygote) and animals are still 90% viable,
but a further 25% reduction (t2012 homozygous progeny of a
t2012 homozygote) results in 100% lethality.
We can infer less about time of synthesis or function of 1b-containing transcripts, which are less abundant than 1a transcripts. As mentioned above, 1b transcripts may be nonessential for viability, as the ku234 allele causes only 13% lethality. However, their presence can affect viability when levels of 1a transcripts are reduced, based on the difference in viability between t2012 embryos from t2012/+ hermaphrodites and s472 embryos from s472/+ hermaphrodites. Both these embryos should have only 25% the wild-type level of 1a transcripts, yet the former, which can produce normal levels of 1b transcripts, are 90% viable, while the latter, which can produce no 1b transcripts, are <1% viable. There may be additional differences in transcript levels if the ku234 and t2012 missense alleles produce some functional transcripts that the s472 deletion cannot.
The fact that dose effects may contribute to the phenotypes observed does not eliminate the likelihood of transcript-specific functions. This is demonstrated by the 100% penetrance of the Egl phenotype caused by the weak ku234 allele when compared with the sporadic appearance of this phenotype resulting from the stronger e644 allele.
With regard to the alternative homeodomains encoded by 7a- and 7b-containing transcripts, survival of up to 33% of the self-progeny of e644/e644 hermaphrodites (deficient in translation products of 7b-containing mRNAs) suggests that the rarer 7a products may compensate for the lack of 7b products. We cannot be confident that 7a products are present in the early embryo, because our quantitative PCR data suggested that 7a-containing transcripts might not be produced maternally (Fig. 2). Alternatively, other proteins with related functions might compensate for 7b products (see discussion of ceh-20 and ceh-40 below). Interestingly, molecular analysis of unc-62 mRNAs in the related nematode C. briggsae (estimated time of divergence 15-30 Mya; see supplemental Fig. S3) showed that the splice acceptor sequence for exon 7a appears to be missing, and only transcripts corresponding to 7b could be detected (B. R. and W. B. W., unpublished). This finding supports the suggestion that the 7a and 7b derived proteins in C. elegans may have overlapping functions.
The maternal-effect unc-62 alleles define putative upstream
regulatory elements
The t2012, ct344, and e917 mutations appear to comprise
an allelic series of decreasing severity. All result in maternal-effect
lethality that can be rescued by zygotic expression of a wild-type copy
introduced from a mating male. The ct344 allele is less severe than
t2012, based on generally later arrest of mutant embryos and the
finding that progeny of ct344 hermaphrodites can be rescued by mating
to e644 males, while progeny of t2012 hermaphrodites can be
rescued only by mating to wild-type males. The e917 allele is even
less severe, as indicated by the lack of any zygotic lethality and the
observation that 3% of the self progeny from homozygous hermaphrodites survive
to reproduce.
Based on the similarity of the phenotypes resulting from these three
alleles, they seem likely to affect common functions. Because t2012
affects translation of la-containing mRNAs, while ct344 and
e917 affect a region
7 kb upstream of the unc-62-coding
sequence (Fig. 6), we postulate
that ct344 and e917 disrupt or remove upstream regulatory
elements required for the production of la-containing transcripts. Because the
e917 inversion results in a very similar maternal-effect phenotype to
ct344, at least one such enhancer element may lie between the
e917 breakpoint and the promoter-distal end of the region deleted by
ct344 (Fig. 6, region
1). The zygotic lethality caused by ct344, which is not seen with
e917, suggests that an additional element may lie in the
1 kb
region between the e917 inversion breakpoint and the proximal end of
the ct344 deletion (Fig.
6, region 2). Additional enhancers may also be present in regions
3 and 4.
The Meis family gene unc-62 and the PBC-family genes
ceh-20 and ceh-40 interact genetically
In Drosophila, similar phenotypes result from loss of function
mutations in the Meis-family homolog hth and the PBC-family homolog
exd, consistent with other evidence for strong interactions between
Meis- and PBC-family proteins (see Introduction). Although inactivation of the
only previously studied C. elegans exd homolog, ceh-20,
causes only larval and adult defects and no embryonic lethality
(Liu and Fire, 2000
) (our
results above), we have shown that this result may be at least partially due
to overlapping functions of two C. elegans PBC-family genes,
ceh-20 and ceh-40. These two genes interact genetically:
ceh-40(RNAi) causes no significant embryonic lethality, while
ceh-20(RNAi); ceh-40(RNAi) causes a substantial decrease in larval
lethality with a corresponding increase in embryonic lethality compared with
ceh-20(RNAi) alone. In addition, whereas unc-62(RNAi)
embryos arrest with the Nob phenotype, ceh-20(RNAi); ceh-40(RNAi)
embryos arrest earlier, prior to morphogenesis. Recent phylogenetic
comparisons with similar genes in other nematodes support the view that
ceh-40 may be a C. elegans exd ortholog (A. Aboobaker,
personal communication). The RNAi results suggest that ceh-20 and
ceh-40 functions may overlap, with ceh-40 normally
functioning earlier than ceh-20. The incomplete penetrance of the
ceh-20(RNAi); ceh-40(RNAi) lethality compared with the complete
penetrance of unc-62(s472) or unc-62(RNAi) lethality could
indicate either that silencing by RNAi was incomplete, or that the functions
of ceh-20 and ceh-40 are not essential for unc-62
function as exd is essential for hth function in
Drosophila.
In the background of the hypomorphic unc-62(e644) allele, which is predicted to reduce or eliminate production of a functional protein from 7b-containing transcripts, ceh-20 and ceh-40 show a pattern of interaction with each other similar to that described above. Individually, their RNAi phenotypes are roughly additive to the unc-62(e644) phenotype. However, the triple combination of ceh-20(RNAi); unc-62(e644); ceh-40(RNAi) results in complete embryonic inviability, with terminal phenotypes similar to those caused by the null allele unc-62(s472). One interpretation of these results is that when levels of the putatively interacting UNC-62 and CEH-20/CEH-40 proteins both fall below some threshold level, the result is a strong Unc-62 phenotype. A more intriguing possibility is that there is some overlap in the functions of CEH-20/CEH-40 and the UNC-62 proteins encoded by 7b-containing transcripts. Perhaps, for example, the latter could act directly as a Hox transcription cofactor.
Possible functions of UNC-62 proteins in embryogenesis
Is UNC-62 a co-factor for the posterior-group homeodomain transcription
factors NOB-1 and PHP-3 in embryonic development, as might be expected from
findings in other organisms? Table
4 summarizes characteristics of Nob phenotypes resulting from
strong lf mutations in unc-62 and nob-1/php-3 as
well as, for comparison, the caudal homolog pal-1. Although
some aspects of the unc-62 and nob-1 Nob phenotypes are
similar, others are not. For example, we did not detect posterior to anterior
cell fate transformations in the E lineage of unc-62(s472) embryos,
and the severe enclosure defects and hypodermal cell disorganization in these
embryos are more similar to pal-1 than to nob-1 Nobs [see
Fig. 4 and supplemental Fig. S2
and Fig. S5
(http://dev.biologists.org/supplemental/)].
In experiments with a rescuing nob-1::GFP reporter construct, the
number of nob-1-expressing cells was not significantly altered in
unc-62(RNAi) embryos, and overexpression of nob-1 did not
rescue the unc-62 phenotype (E. Kress and T. S., unpublished).
Furthermore, presence of the unc-62(e644) allele did not increase the
lethality resulting from a weak nob-1 allele (E. Kress and T. S.,
unpublished). We conclude that there is so far no convincing evidence for an
essential co-factor role, and that the unc-62 phenotypes are not
primarily the result of altered NOB-1 function. We have not tested for
possible interactions of unc-62 products with the later acting Hox
gene functions of lin-39, mab-5 and egl-5. Possible
interactions of unc-62 and pal-1 functions are under
investigation.
|
Are UNC-62 proteins required to mediate nuclear localization of CEH-20, as might be expected from findings in other organisms? It appears that this requirement may be partial rather than complete; unc-62-defective embryos show variable nuclear localization of a translational CEH-20::GFP reporter in CEH-20-expressing cells, with less localization in early than in late embryos [see supplemental Fig. S4 (http://dev.biologists.org/supplemental/)], as if other mechanisms of CEH-20 nuclear import may exist.
Although the identity and interactions of all the players are not yet
clear, our results do suggest that embryonically acting unc-62
products are involved in controlling hypodermal specification, differentiation
and morphogenesis. In wild-type embryos, dorsal and lateral hypodermal cell
precursors form distinct populations that reside next to each other initially
on the dorsal side of the embryo. We observed early s472, t2012 and
ct344 mutant embryos in which dorsal and lateral hypodermal
precursors intermingled, and fewer than the normal number of cells expressing
hypodermal markers formed subsequently. These abnormalities probably
contribute to later morphological defects, as successful enclosure, elongation
and morphogenesis require proper hypodermal cell arrangement and function
(Priess and Hirsh, 1986
;
Williams-Masson et al., 1998
;
Williams-Masson et al., 1997
).
The abnormal mixing of hypodermal cell populations in these mutants may
indicate involvement of unc-62 in maintaining distinct hypodermal
cell identities, perhaps similar to the role of Drosophila hth in
specifying distinct populations of cells that normally do not intermingle in
the leg (Wu and Cohen, 1999
)
and eye-antenna (Pichaud and Casares,
2000
) imaginal discs.
There are several differences between C. elegans and
Drosophila that may somehow be related to our finding that phenotypes
caused by unc-62, ceh-20 and ceh-40 mutations are not as
expected from observations on the homologous Drosophila genes.
Whereas in Drosophila only one PBC-family and one MEIS-family gene
have been reported, C. elegans has at least two PBC-family genes.
Furthermore, the unc-62 gene generates four different transcripts by
alternative splicing, while Drosophila hth transcripts are not
alternatively spliced. Therefore, C. elegans, with several PBC-family
and Meis-family proteins, resembles vertebrates more closely than
Drosophila with regard to the repertoire and possible interactions of
these cofactors. A second possibly relevant difference between C.
elegans and Drosophila could be that C. elegans
requires only anterior-group and posterior-group Hox gene functions for
embryonic survival (Brunschwig et al.,
1999
; Van Auken et al.,
2000
). As PBC- and Meis-family proteins can act as cofactors for
Hox proteins, the fact that medial-group Hox proteins are essential for
completion of embryogenesis in Drosophila but not C. elegans
might account for different phenotypes resulting from loss of co-factor
functions.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Abu-Shaar, M., Ryoo, H. D. and Mann, R. S.
(1999). Control of the nuclear localization of Extradenticle by
competing nuclear import and export signals. Genes
Dev. 13,935
-945.
Affolter, M., Marty, T. and Vigano, M. A.
(1999). Balancing import and export in development.
Genes Dev. 13,913
-915.
Babu, P. (1974). Biochemical genetics of Caenorhabditis elegans. Mol. Gen. Genet. 135, 39-44.[CrossRef]
Beanan, M. J. and Strome, S. (1992). Characterization of a germ-line proliferation mutation in C. elegans.Development 116,755 -766.[Abstract]
Berthelsen, J., Kilstrup-Nielsen, C., Blasi, F., Mavilio, F. and
Zappavigna, V. (1999). The subcellular localization of PBX1
and EXD proteins depends on nuclear import and export signals and is modulated
by association with PREP1 and HTH. Genes Dev.
13,946
-953.
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Brunschwig, K., Wittmann, C., Schnabel, R., Burglin, T. R., Tobler, H. and Mueller, F. (1999). Anterior organization of the Caenorhabditis elegans embryo by the labial-like Hox gene ceh-13. Development 126,1537 -1546.[Abstract]
Burglin, T. R. (1997). Analysis of TALE
superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel
domain conserved between plants and animals. Nucleic Acids
Res. 25,4173
-4180.
Chan, S., Jaffe, L., Capovilla, M., Botas, J. and Mann, R. (1994). The DNA binding specificity of ultrabithorax is modulated by cooperative interactions with extradenticle, another homeoprotein. Cell 78,603 -615.[CrossRef][Medline]
Chisholm, A. (1991). Control of cell fate in
the tail region of C. elegans by the gene egl-5.Development 111,921
-932.
Clark, S., Chisholm, A. and Horvitz, H. (1993). Control of cell fates in the central body region of C. elegans by the homeobox gene lin-39. Cell 74, 43-55.[CrossRef][Medline]
Edgar, L. G., Carr, S., Wang, H. and Wood, W. B. (2001). Zygotic expression of the caudal homolog pal-1 is required for posterior patterning in Caenorhabditis elegans embryogenesis. Dev. Biol. 229, 71-88.[CrossRef][Medline]
Ekker, S. C., Jackson, D. G., von Kessler, D. P., Sun, B. I., Young, K. E. and Beachy, P. A. (1994). The degree of variation in DNA sequence recognition among four Drosophila homeotic proteins. EMBO J. 13,3551 -3560.[Medline]
Giulietti, A., Overbergh, L., Valckx, D., Decallonne, B., Bouillon, R. and Mathieu, C. (2001). An overview of real-time quantitative PCR: applications to quantify cytokine gene expression. Methods 25,386 -401.[CrossRef][Medline]
Hoey, T. and Levine, M. (1988). Divergent homeo box proteins recognize similar DNA sequences in Drosophila. Nature 332,858 -861.[CrossRef][Medline]
Kimble, J., Edgar, L. and Hirsh, D. (1984). Specification of male development in Caenorhabditis elegans: the fem genes. Dev. Biol. 105,234 -239.[CrossRef][Medline]
Kurant, E., Eytan, D. and Salzberg, A. (2001).
Mutational analysis of the Drosophila homothorax gene.
Genetics 157,689
-698.
Labouesse, M., Hartwieg, E. and Horvitz, H. R. (1996). The Caenorhabditis elegans LIN-26 protein is required to specify and/or maintain all non-neuronal ectodermal cell fates. Development 122,2579 -2588.[Abstract]
Lipardi, C., Wei, Q. and Paterson, B. M. (2001). RNAi as random degradative PCR. siRNA primers convert mRNA into dsRNAs that are degraded to generate new siRNAs. Cell 107,297 -307.[CrossRef][Medline]
Liu, J. and Fire, A. (2000). Overlapping roles of two Hox genes and the exd ortholog ceh-20 in diversification of the C. elegans postembryonic mesoderm. Development 127,5179 -5190.[Abstract]
Livak, K. J. and Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) method. Methods 25,402 -408.[CrossRef][Medline]
Manak, J. and Scott, M. (1994). A class act: conservation of homeodomain protein functions. Development Suppl.,61 -71.
Mann, R. S. (1995). The specificity of homeotic gene function. BioEssays 17,855 -863.[CrossRef][Medline]
Mann, R. S. and Affolter, M. (1998). Hox proteins meet more partners. Curr. Opin. Genet. Dev. 8,423 -429.[CrossRef][Medline]
Mann, R. S. and Chan, S. K. (1996). Extra specificity from extradenticle: the partnership between HOX and PBX/EXD homeodomain proteins. Trends Genet. 12,258 -262.[CrossRef][Medline]
Montgomery, M. K., Xu, S. and Fire, A. (1998).
RNA as a target of double-stranded RNA-mediated genetic interference in
Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA
95,15502
-15507.
Pai, C. Y., Kuo, T. S., Jaw, T. J., Kurant, E., Chen, C. T.,
Bessarab, D. A., Salzberg, A. and Sun, Y. H. (1998). The
Homothorax homeoprotein activates the nuclear localization of another
homeoprotein, extradenticle, and suppresses eye development in Drosophila.
Genes Dev. 12,435
-446.
Pichaud, F. and Casares, F. (2000). homothorax and iroquois-C genes are required for the establishment of territories within the developing eye disc. Mech. Dev. 96,15 -25.[CrossRef][Medline]
Priess, J. R. and Hirsh, D. I. (1986). Caenorhabditis elegans morphogenesis: The role of the cytoskeleton in elongation of the embryo. Dev. Biol. 117,156 -173.[CrossRef][Medline]
Pulak, R. and Anderson, P. (1993). mRNA
surveillance by the Caenorhabditis elegans smg genes.
Genes Dev. 7,1885
-1897.
Rieckhof, G. E., Casares, F., Ryoo, H. D., Abu-Shaar, M. and Mann, R. S. (1997). Nuclear translocation of Extradenticle requires Homothorax, which encodes an Extradenticle-related homeodomain protein. Cell 91,171 -183.[CrossRef][Medline]
Rosenbluth, R., Rogalski, T., Johnson, R., Addison, L. and Baillie, D. (1988). Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genet. Res. 52,105 -118.
Ryoo, H. D., Marty, T., Casares, F., Affolter, M. and Mann, R. S. (1999). Regulation of Hox target genes by a DNA bound Homothorax/Hox/Extradenticle complex. Development 126,5137 -5148.[Abstract]
Schauer, I. and Wood, W. (1990). Early C.
elegans embryos are transcriptionally active.
Development 110,1303
-1317.
Shen, W. F., Montgomery, J. C., Rozenfeld, S., Moskow, J. J., Lawrence, H. J., Buchberg, A. M. and Largman, C. (1997a). AbdB-like Hox proteins stabilize DNA binding by the Meis 1 homeodomain proteins. Mol. Cell. Biol. 17,6448 -6458.[Abstract]
Shen, W. F., Rozenfeld, S., Lawrence, H. J. and Largman, C.
(1997b). The Abd-B-like Hox homeodomain proteins can be
subdivided by the ability to form complexes with Pbx1a on a novel DNA target.
J. Biol. Chem. 272,8198
-8206.
Siddiqui, S. (1990). Mutations affecting axonal growth and guidance of motor neurons and mechanosensory neurons in the nematode Caenorhabditis elegans. Neurosci. Res. 13,171 -190.[CrossRef]
Streit, A., Li, W., Robertson, B., Schein, J., Kamal, I. H.,
Marra, M. and Wood, W. B. (1999). Homologs of the
Caenorhabditis elegans masculinizing gene her-1 in C.
briggsae and the filarial parasite Brugia malayi.Genetics 152,1573
-1584.
Sulston, J. and Hodgkin, J. (1988). Methods. InThe Nematode Caenorhabditis elegans (ed. W. B. Wood), pp. 81-122. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Tabara, H., Grishok, A. and Mello, C. C.
(1998). RNAi in C. elegans: soaking in the genome
sequence. Science 282,430
-431.
Takacs-Vellai, K., Vellai, T., Vigano, A., Affolter, M. and Mueller, F. (2002). A functional analysis of the extradenticle ortholog ceh-40. Abstracts, European C. elegans meeting, Paestum, Italy, May 18-21.,197 .
Thomas, C., DeVries, P., Hardin, J. and White, J.
(1996). Four-dimensional imaging: computer visualization of 3D
movements in living specimens. Science
273,603
-607.
Thomas, J., Stern, M. and Horvitz, H. (1990). Cell interactions coordinate the development of the C. elegans egg-laying system. Cell 62,1041 -1052.[CrossRef][Medline]
Trent, C., Tsung, N. and Horvitz, H. R. (1983).
Egg-laying defective mutants of the nematode Caenorhabditis elegans.Genetics 104,619
-647.
Van Auken, K., Weaver, D. C., Edgar, L. G. and Wood, W. B.
(2000). C. elegans embryonic axial patterning requires
two recently discovered posterior-group Hox genes. Proc. Natl.
Acad. Sci. USA 97,4499
-4503.
Van Auken, K. M. (1998). Genetic and molecular analysis of nob-1, a gene required for posterior development in the Caenorhabditis elegans embryo. PhD dissertation, University of Colorado, Boulder, CO.
van Dijk, M. and Murre, C. (1994). Extradenticle raises the Dna binding specificity of homeotic selector gene products. Cell 78,617 -624.[CrossRef][Medline]
Wang, B., Muller-Immergluck, M., Austin, J., Robinson, N., Chisholm, A. and Kenyon, C. (1993). A homeotic gene cluster patterns the anteroposterior body axis of C. elegans.Cell 74,29 -42.[CrossRef][Medline]
Williams-Masson, E. M., Heid, P. J., Lavin, C. A. and Hardin, J. (1998). The cellular mechanism of epithelial rearrangement during morphogenesis of the Caenorhabditis elegans dorsal hypodermis. Dev. Biol. 204,263 -276.[CrossRef][Medline]
Williams-Masson, E. M., Malik, A. N. and Hardin, J. (1997). An actin-mediated two-step mechanism is required for ventral enclosure of the C. elegans hypodermis. Development 124,2889 -2901.[Abstract]
Wrischnik, L. A. and Kenyon, C. J. (1997). The role of lin-22, a hairy/enhancer of split homolog, in patterning the peripheral nervous system of C. elegans.Development 124,2875 -2888.[Abstract]
Wu, J. and Cohen, S. M. (1999). Proximodistal axis formation in the Drosophila leg: subdivision into proximal and distal domains by Homothorax and Distal-less. Development 126,109 -117.[Abstract]
This article has been cited by other articles:
![]() |
A. Gutierrez, L. Knoch, H. Witte, and R. J. Sommer Functional specificity of the nematode Hox gene mab-5 Development, March 1, 2003; 130(5): 983 - 993. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||