|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00114
Department of Genetics, Harvard Medical School, Howard Hughes Medical Institute, 200 Longwood Avenue, Boston, MA 02115, USA
* Author for correspondence (e-mail: cepko{at}genetics.med.harvard.edu)
Accepted 22 August 2002
| SUMMARY |
|---|
|
|
|---|
C) was introduced in vivo into the early chick eye using a
retroviral vector. EnRaxL
C, but not the dominant negative Rax
(EnRax
C), caused a significant reduction in expression of early markers
of photoreceptor cells. Examination of the transactivation activity of RaxL on
a reporter construct bearing a canonical photoreceptor-specific enhancer
element showed that RaxL exhibited significant activation activity, and that
this activity was severely diminished in the presence of EnRaxL
C. The
effect on photoreceptor gene expression in vivo was specific in that other
cell types were unaffected, as was general proliferation in the retina. The
reduction in numbers of cells expressing photoreceptor markers was probably
due to decreased survival of developing photoreceptor cells, as there was
increased apoptosis among cells of the retina expressing dominant-negative
RaxL. We propose that RaxL plays a role in the initiation of
differentiation, and also possibly commitment, of photoreceptor cells in the
chicken retina.
Key words: Photoreceptors, Rx, Rax, RaxL, Retina, Homeodomain protein, Cell fate, Cell differentiation, Chicken
| INTRODUCTION |
|---|
|
|
|---|
Rods, which comprise the majority of photoreceptors in rodents and in
humans, are the most light-sensitive photoreceptor cell types. They are
susceptible to degeneration, in some cases, because of mutations that effect
the development of rods. Studies of human diseases (reviewed by
Clarke et al., 2000
) and a
comprehensive analysis of genes expressed in photoreceptor cells
(Blackshaw et al., 2001
) have
provided us with a source of candidate genes for the study of photoreceptor
development. Cone photoreceptor development remains somewhat more mysterious.
Cone photoreceptors are much less sensitive to light, but are active in the
light intensities typical of daylight and of our brightly lit night. Cones
provide us with high acuity vision, because of their high density in several
regions of the retina and the high density of cells that compute the
information from the photoreceptors and report it to the brain. Cone
photoreceptors are also susceptible to degeneration, particularly in the
prevalent human disease of the elderly, age related macular degeneration
(reviewed by Weber, 1998
). It
is thus of great interest to learn how both rods and cones develop, not only
to provide us with a basic understanding of retinal development, but also to
allow for replacement of these cells in retinal degenerations, and/or to
provide us with other points at which to intervene in disease processes.
Many types of birds have a need for high-acuity vision during the day. They
typically have cone photoreceptors as the major photoreceptor cell type. Such
is the case with chickens, which have a rod-free, cone-rich central zone,
similar to that of humans (Morris,
1982
; Bruhn and Cepko,
1996
). We have been investigating the development of rod and cone
photoreceptors in chickens and in mammals. In the chick, we and others have
found two Rax genes, Rax/Rx and RaxL
(Ohuchi et al., 1999
). The
Rax gene is expressed in all retinal progenitor cells, which is
similar to the expression of mouse Rax
(Furukawa et al., 1997a
). By
contrast, we found that RaxL is expressed in both retinal progenitor
cells and early developing photoreceptors. RaxL homologs, including
rx1 and rx2, have been previously reported in zebrafish and
medaka. In zebrafish, rx1 and rx2 are expressed in cone, but
not rod, photoreceptors (Chuang et al.,
1999
). We provide evidence that chick RaxL is required
for the earliest stage(s) of photoreceptor development, most probably by
acting at the stage of commitment to the photoreceptor fate, and/or at the
earliest stages of photoreceptor differentiation. We also report the presence
of a second Rax gene (RAX2) in humans that may be the human homolog
of RaxL. Wang, Zack and their colleagues have also identified this
human gene and have found mutations in this gene in several individuals with
retinal degenerations (D. Zack, personal communication). However, the
significance of these mutations has not yet been established.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid constructions
The BbsI/EcoRI and BsaI/EcoRI DNA
fragments encoding oar/paired-tail motif deletion of Rax and
RaxL were PCR amplified using TGAGAAGACCCCATGCACCCTCCCGGC and
GAGAATTCCATGGCTCCCAGGGGCTG, and AAGGTCTCAGATGTTCCTCAATAAGTG and
GAGAATTCCATGGGCTGCATGCCCTG as prime pairs, and were subcloned into
NcoI/EcoRI site of pSlaxEn vector to generate
pSlaxEnRax
C and pSlaxEnRaxL
C, respectively. The
NcoI/EcoRI DNA fragment encoding the homeodomain of RaxL was PCR
amplified using AACCATGGCTGCTGCTGAGGAGGAACAGCCC and
GAGAATTCGGACAGCATGGGGGTGTCGTG as primers and subcloned into pSlaxEn vector to
generate pSlaxEnRaxLHD. The ClaI DNA fragments of pSlaxEnRax
C,
pSlaxEnRaxL
C and pSlaxEnRaxLHD were subsequently cloned into pRCAS(B)
retroviral vector (Hughes et al.,
1987
) to generate pRCASEnRax
C, pRCASEnRaxL
C and
pRCASEnRaxLHD, respectively. The same fragments were also subcloned into pCS2
expression vectors (Rupp et al.,
1994
; Turner and Weintraub,
1994
) to generate pCSEnRax
C, pCSEnRaxL
C and
pCSEnRaxLHD, respectively. The RaxL expression vectors were generated as
follows: the DNA fragment encoding the N-terminal region of RaxL was PCR
amplified using CGACCATGGAGATGTTCCTCAATAAGTGT and GTGCCCGCCATAGGGGGG as
primers; the NcoI/AflIII fragment of this PCR product
together with AflIII/SacII(blunted) DNA fragment encoding
the C-terminal region of RaxL were ligated into the
NcoI/EcoRV site of pSlax21
(Chen et al., 1999
) to product
pSlaxcRaxL vector; the ClaI fragment and ClaI/SpeI
fragment of pSlaxcRaxL were further subcloned into the ClaI site of
pRCAS(A) and the ClaI/XbaI region of pCS2 to generate pRCAS
(A) cRaxL retroviral and pCScRaxL expression vectors, respectively. The Rax
expression vector was generated as follows: the BbsI/EcoRI
DNA fragment encoding Rax ORF was PCR amplified from pKScRax using
TGAGAAGACCCCATGCACCCTCCCGGC and M13 reverse primers and subcloned into
NcoI/EcoRI locus of pSlax21 to generate pSlaxcRax; the
ClaI DNA fragment of pSlaxcRax was further subcloned into
ClaI site of pCS to generate pCScRax expression vector. The
RcaI fragment of mouse Crx was cloned into the NcoI
locus of pSlax21 to generate pSlaxmCrx. The ClaI fragment of
pSlaxmCrx was further subcloned into pRCAS(A) to construct pRCAS(A)mCrx
retroviral vector. In situ hybridization probes specific to Rax and
RaxL were transcribed from pKScRaxspl and pKScRaxLspl, respectively,
which includes 5' UTR, 3' UTR and the homeodomain deleted coding
regions of Rax and RaxL, respectively. The pKScRaxspl was
constructed by ligating two EcoRI/BamHI PCR fragments into
EcoRI site of pBluescriptKS. These two PCR fragments were amplified
from pSKcRax using T7 primer and GCGGATCCCTCCTCGTCCGACGGCTTCCC primer pair, T3
primer and AAGGATCCAGCCGCTCCCCGCAGGCG primer pair. The pKScRaxLspl was
constructed in a similar way in that T3 (GCGGATCCTTCCTCCTCAGCAGCAGCTGG) and T7
(AAGGATCCAACCGGCCGCCCATGACG) were used as two PCR primer sets.
Electroporation
Plasmid DNA containing 0.05% of Fast Green was injected into the right
optic vesicle of Hamburger-Hamilton stage 9 to stage 11 chick embryos in ovo.
Immediately after injection, the embryo was subjected to electroporation using
the Tokiwa CUY-21 square electroporator with 10 mV for three cycles of 50
mseconds pulse and 950 mseconds chase.
In situ hybridization
Whole-mount and section in situ hybridization were performed as described
(Chen and Cepko, 2000
).
Flat-mount in situ hybridization was performed as described
(Bruhn and Cepko, 1996
) with
the following modification. The flat-mounted retinal tissues were hybridized
overnight at 70°C with digoxigenin-labeled RNA probes of specific cell
markers together with the fluorescein-labeled RNA probe of engrailed repressor
domain. After hybridization, the retinas were washed and blocked as described
and incubated overnight at 4°C with 1:2000 dilution of AP-conjugated
anti-digoxigenin antibody (Roche Diagnostics Coporation) in TBST and 1%
heat-inactivated sheep serum. Retinas were washed several times in TBST and
further detected with NBT and BCIP until the desired purple signal developed.
The developing reaction was stopped by washing three times with TBST (pH 5.5)
and heating at 70°C for 2 hours in the same buffer to dissociate
anti-digoxigenin Ab. The pictures of the retinas with the first in situ signal
were taken before detecting the second signal. To detect the second signal,
the heat-inactivated retinas were blocked in TBST and 10% sheep serum for 2
hours and incubated overnight at 4°C with 1:2000 dilution of AP-conjugated
antifluorescein antibody (Roche Diagnostics Corporation) in 1% sheep
serum/TBST. After washing in TBST, the second in situ signal was detected with
BCIP alone until the desired blue color developed. The developing reaction was
stopped in TBST (pH 5.5) and pictures of the retinas with both the first and
second in situ signals were taken. To further detect the total viral
infection, the retinas were further subjected to 3C2 mAb staining based on the
protocol described in the Immunostaining section, after treatment at 70°C
for 2 hours to dissociate anti-Fluorescein Ab.
Cell transfection and CAT assays
COS cells were grown in DMEM with 10% fetal calf serum. Five micrograms of
pRET1-CAT reporter (Furukawa et al.,
1997b
), 1 µg of pSVß (Clontech), 5 µg of pCScRaxL with
increasing amounts of pCSEnRax
C, pCSEnRaxL
C or pCSEnRaxLHD, and
decreasing amounts of pCS2 to make a total 26 µg of plasmid DNA were
transfected onto 10 cm dishes using Superfect as the transfection reagent
according to the manufacture's protocol (Qiagen). Cells were harvested for a
CAT assay 48 hour post-transfection as described
(Chen et al., 1996
). Five to
10 µl of cell extract without heat treatment were used for measuring the
ß-galactosidase activity at room temperature in 1 ml of Z buffer (60 mM
Na2HPO4/40 mM NaH2PO4/10 mM
KCl/1mM MgSO4) containing 1 µl of ß-mercaptoethanol and 0.5
mg/ml of ONPG. The reactions were stop with 0.5 ml of 1 M
Na2CO3 and OD420 were measured. The OD420 value, which
reflects the transfection efficiency of each extract, was used to normalize
the CAT value from each transfection.
The generation of visinin monoclonal antibodies and western blot
analysis
Monoclonal antibodies to chick visinin were generated by Maine
Biotechnology Service Incorporation (S. Bruhn and C. Cepko, unpublished) using
purified chick visinin protein as an antigen (gift from Dr A. Polans)
(Polans et al., 1993
). One of
the visinin mAbs (7G4) was deposited into The Developmental Studies Hybridoma
Bank at the University of Iowa. For western blot analysis, chick retinas were
harvested and sonicated in whole cell extract buffer (20 mM HEPES pH7.6/150 mM
NaCl/0.5 mM DTT/0.2 mM EGTA/0.2 mM EDTA/25% glycerol) with proteinase
inhibitor cocktail (Roche Diagnostics Corporation). The cell lysates were
collected after centrifugation for 15 minutes at 4°C and the protein
concentration was determined by Bradford analysis (BioRad protein assay) using
bovine serum albumin as a standard. The retinal extracts containing 25 µg
protein were run on a 10% precast SDS-PAGE gels and transferred to a
nitrocellulose membrane according to the manufacture's protocol (Invitrogen).
The transferred nitrocellulose membrane was stained with Ponceau S to confirm
that an equal amount of protein was loaded and transferred in each lane before
blocking with 5% nonfat milk in PBST (0.1% Tween-20 in PBS). Two-thousand-fold
dilution of visinin mAb ascites fluid was used as a primary antibody and
peroxidase-conjugated goat anti-mouse IgG (1:4000 dilution) (Jackson
Immunoresearch Laboratory) was used as a secondary antibody. The western blot
signal was further detected with ECL reagent (Amersham).
Immunostaining
Retinal cryosections (20 µm) were blocked with 5% sheep serum/0.02%
TritonX-100/PBS for 30 minutes at room temperature. The sections were
subsequently incubated with visinin mAb (1:100 dilution of hybridoma culture
supernant) for 1 hour. After several washes in PBS, the sections were
incubated in biotinylated anti-mouse IgG (1:500 dilution) (Vector) for another
hour. The Vectastain ABC kit (Vector) and DAB peroxidase substrate kit
(Vector) were further used for amplifying and detecting the signal according
to manufacture's protocol.
Retina dissociation and FACS analysis
Papain (100 units/ml) (Worthington Biochenical Corporation) was first
activated in Hank's balanced salt solution (HBSS) containing 10 mM HEPES pH
7.6, 2.5 mM cysteine and 0.5 mM EDTA for 15 minutes at 37°C. Dissected
chick retinas were incubated in activated papain solution for 40 minutes at
37°C. Retinal pellets were gently triturated and incubated in 0.1 mg/ml of
DNaseI/HBSS for 10 minutes. The dissociated retinal cells were further washed
twice with HBSS and fixed in 4% paraformaldehyde for 5 minutes at room
temperature. The protocol for antibody staining on fixed cells is the same as
staining tissue sections. The Cyt2-conjugated anti-rabbit IgG and
Cyt3-conjugated anti-mouse IgG (1:500 dilution) (Jackson Immunoresearch
Laboratories) were used for secondary antibodies. After two washes with PBS,
the cells were suspended in 1% formaldehyde/PBS for FACS analysis.
TUNEL assay
Viral-infected retinas were fixed in 4% paraformaldehyde/PBS and embedded
in OCT compound (Tissue-Tek) after cryoprotection in 30% sucrose solution.
Cryosections (20 µm) were subjected to the TUNEL assay using the in situ
cell death detection fluorescein kit (Roche) according to the manufacture's
protocol. Retinal sections were then further stained with 3C2 mAb and
Cyt3-conjugated goat anti-mouse IgG (1:400 dilution) (Jackson Immunoresearch
Laboratories) to visualize the viral infected areas.
| RESULTS |
|---|
|
|
|---|
Through searches of the human EST and genome databases, a second human Rax (RAX2) gene was found and located on human chromosome 19. The correspoinding EST was also isolated from a human retinoblastoma cell line (I.M.A.G.E. clone ID3344166). An amino acid sequence comparison showed 93% identity in the homeodomain region between RaxL and the human protein (RAX2). Scattered similarity was also found outside of the homeodomain. Interestingly, like RaxL, the RAX2 exhibited a very short sequence N-terminal to the homeodomain, and was lacking the octapeptide (Fig. 1A). Based on these sequence similarities, this gene is probably the human homolog of RaxL.
|
The expression patterns of Rax and RaxL in early
chick embryos
The expression patterns of Rax and RaxL in early chick
embryos (Hamburger-Hamilton stage 8 to stage 20) were analyzed by whole-mount
in situ hybridization. To avoid cross-hybridization between Rax and
RaxL through their conserved homeodomain regions, specific RNA probes
with the homeodomain regions deleted were used. Rax RNA was detected
in the anterior neural folds at stage 8 (data not shown). By stage 11,
Rax was expressed in the entire forebrain region
(Fig. 1B) and highly
concentrated in the optic vesicles and the ventral midline structure, the
infundibulum (Fig. 1C,
arrowhead and arrow, respectively). By stage 12, when the optic vesicles have
formed, the Rax signal remained strong in the optic vesicles and in
the infundibulum, but became weak in the anterior and dorsal forebrain
(Fig. 1D,E). By stage 14, the
expression of Rax was confined to the retina and ventral diencephalon
(Fig. 1F,G arrowhead and arrow,
respectively). The retinal and ventral diencephalon expression of Rax
persisted to stage 20, the oldest stage we have analyzed by whole-mount in
situ hybridization (Fig. 1H,I,
and data not shown).
RaxL was expressed in an overlapping but not identical pattern to that of Rax. The transcript of RaxL was first found at stage 9 in the ventral anterior neural tube (data not shown). By stage 11, RaxL was highly expressed in the ventral optic vesicles, while the signals in the anterior forebrain and infundibulum were barely detectable (Fig. 1J,K). In contrast to Rax, by stage 12, RaxL was expressed strongly in the optic vesicles, very weakly in the infundibulum, and at undetectable levels in the dorsal and anterior forebrain (Fig. 1L,M). By stage 14, RaxL was expressed only in the retina and no infundibulum expression was observed (Fig. 1N,O compare with Fig. 1G arrow). Interestingly, the early retinal expression of both Rax and RaxL was not uniform throughout the optic vesicle. RaxL was expressed in a high ventral to low dorsal gradient transiently from stage 13 to stage 17 (Fig. 1N,P, and data not shown). By contrast, Rax was expressed at a high level in both dorsal and ventral domains and at a low level in the middle region of the retina at similar stages (Fig. 1F,H, and data not shown).
The expression patterns of Rax and RaxL in the
developing retina
As both Rax and RaxL expression was observed in the eyes
of early chick embryos, a further detailed analysis of retinal expression was
carried out on retinal sections from embryonic day 5 (E5) to E19
(Fig. 2). The Rax
transcript was detected in the majority of retinoblasts at a high level in the
E5 retina (Fig. 2A). By E6, two
domains with undetectable Rax expression were observed. One was
adjacent to the pigment epithelium, presumably comprising differentiating
photoreceptor cells, and the other was adjacent to the vitreous, presumably
comprising ganglion cells (Fig.
2B, arrows). This pattern is consistent with the observation that
mouse Rax is highly expressed in proliferating retinal progenitors
and is downregulated in differentiated retinal cells
(Furukawa et al., 1997a
). At
E7, the Rax transcript was found in a small population of cells
residing in the future inner nuclear layer (INL) throughout the retina, which
are likely to be the remaining retinal progenitors
(Fig. 2C,D). Rax
expression was further restricted into a narrow domain in the INL at E9
(Fig. 2I). At E11, when almost
all retinal progenitor cells have become postmitotic, we observed a low level
of Rax signal in the middle of the INL
(Fig. 2J). Because a low level
expression of Rax was found in Muller glial cells of the mouse retina
(Furukawa et al., 2000
), it is
likely that this small population comprises the remaining retinal progenitors
and/or differentiating Muller glial cells. However, the identity of these
Rax-expressing cells needs further characterization. A faint
Rax signal remained at E14 (Fig.
2K) and became undetectable at E19, immediately before hatching
(Fig. 2L). We found no
Rax expression in the retina of post-hatched chicks at one month of
age (P30) (data not shown). Based on the in situ hybridization analysis of
Rax, which shows a similar expression pattern to that of the mouse
Rax gene, and given the amino acid sequence similarity of Rax and
mouse Rax, chick Rax is likely to be the homolog of the mouse
Rax gene.
|
The RaxL transcript was detected at a lower level than Rax throughout the retina at E5 (Fig. 2E). By E6, the RaxL non-expressing domain was seen in the ganglion cell region (Fig. 2F, arrow). However, unlike Rax, the RaxL signal remained in the developing photoreceptor layer at this stage (compare Fig. 2B,F). As development proceeded, some retinal cells expressing higher levels of RaxL appeared near the pigment epithelium at E7 (Fig. 2G), presumably the progenitors fated to be photoreceptors. This pattern of expression in the future outer nuclear layer (ONL) persisted (Fig. 2H). The increase in staining of the future ONL progressed from the center to the periphery (compare Fig. 2H,G) in a pattern that coincides with the overall temporal developmental of the retina. As development progressed, two expression domains of RaxL resulted; one weak expression zone overlapping that of Rax in the INL, representing the remaining retinal progenitor cells (Fig. 2H, arrowhead), and one strong expression zone located in the future ONL, most likely representing the developing photoreceptor cells (Fig. 2H arrow). This two-domain expression pattern of RaxL persisted until E11 with decreasing signal in the INL and increasing signal in the ONL (Fig. 2M,N). By E14, RaxL was detected only in photoreceptors, and this expression was downregulated to an undetectable level by E19 (Fig. 2O,P). No RaxL expression was found in the P30 chick retina (data not shown). The expression of RaxL in retinal progenitor cells, and later at a high level in developing photoreceptors, suggests a key role for RaxL in the early stage of photoreceptor development.
RaxL is required for photoreceptor cell development
To determine whether RaxL plays a role in photoreceptor
development, we ectopically expressed full-length RaxL protein in optic
vesicles using a retroviral expression vector. The optic vesicles of chick
embryos were infected with a RaxL retrovirus at Hamburger-Hamilton stage 10
and infected retinas were harvested between E6 and E7. The development of
photoreceptor cells was analyzed using the photoreceptor marker, visinin, by
flat-mount in situ hybridization (Yamagata
et al., 1990
). We detected no ectopic expression of
visinin-expressing cells in the RaxL infected retina (data not
shown), suggesting the RaxL is not sufficient to promote
photoreceptor cell fate choice. We then examined if RaxL is necessary
for photoreceptor cell development by introducing a putative dominant-negative
allele of RaxL. As RaxL shares the identical amino acid sequence in
the homeodomain region with Rax, dominant-negative RaxL could
potentially interfere with both RaxL and Rax functions. To
minimize this possibility and maintain as much RaxL specificity as
possible, we made a fusion construct containing the engrailed repressor domain
and RaxL with deletion only of the oar/paired-tail motif
(EnRaxL
C). The similar fusion construct has been shown as a dominant
negative allele of Xrx1 (Xenopus homolog of Rax) in
Xenopus embryos (Andreazzoli et
al., 1999
). The EnRaxL
C retroviral vector was
electroporated into optic vesicles of Hamburger-Hamilton stage 10 chick
embryos. After electroporation, the EnRaxL
C transfected retinal cells
should produce EnRaxL
C virus, which subsequently infects neighboring
retinal cells to create some viral infected patches in the retina. As we have
found that electroporation with high concentrations of DNA can lead to a
nonspecific small eye phenotype, we electroporated the viral construct at the
low concentration of 0.1-0.2 µg/µl. The infected retinas were harvested
at E7.5-E8, and the expression of endogenous visinin and exogenous
EnRaxL
C was analyzed by double in situ hybridization using visinin and
engrailed probes, respectively. The infected retinas showed the same overall
visinin pattern as control non-electroporated retinas. However, 73%
(11 out of 15) of the retinas electroporated with the EnRaxL
C had
several patches with low visinin expression
(Fig. 3A). These patches were
within the infected areas, detected with an engrailed probe
(Fig. 3B in greenish blue). In
some cases, there was no reduction in visinin expression in infected
areas. This could be due to a low level expression of the EnRaxL
C
protein, which could occur because of the interference of some viral
integration sites. We found no correlation between the size and location of
infected patches and the reduction of visinin. To examine if viral
infection grossly altered retinal morphology by affecting progenitor cell
proliferation, a concern because RaxL is expressed in retinal
progenitors, the retina was sectioned after double in situ hybridization.
Fig. 3C shows that the viral
infected patches spanned the entire thickness of the retina and that the
retinal thickness remained normal within those patches. However, there were
fewer cells expressing visinin transcript within the EnRaxL
C
virus-infected domains. To further investigate whether EnRaxL
C
interfered with the proper development of photoreceptor cells, or just visinin
marker gene expression, we examined the expression of another
photoreceptor-specific gene, RXR
(Rxrg)
(Hoover et al., 1998
).
Rxrg exhibited a uniform pattern of expression in the control,
uninfected E7.5 retina (data not shown). However, when the retina was
electroporated with EnRaxL
C viral construct, the virus infected patches
showed significant reduction of Rxrg expression in 82% (14 out of 17)
of the infected retinas (Fig.
3D-F). The fact that two independent photoreceptor specific genes
were reduced by EnRaxL
C, makes it likely that the development of
photoreceptor cells is affected by EnRaxL
C. These results suggest that
RaxL is required for the development of photoreceptors, and that
introducing EnRaxL
C did not alter retinal cell proliferation.
|
To determine whether EnRaxL
C interfered specifically with
RaxL, we electroporated a similar viral construct, EnRax
C,
containing the engrailed repressor domain and Rax, with deletion of
the oar/paired-tail motif. Seven and 16 infected retinas were tested for
visinin and Rxrg expression, respectively. We found all the
retinas tested exhibited normal visinin and Rxrg expression
within the EnRax
C infected patches
(Fig. 3G-I and 3J-L,
respectively). These results strongly suggest that RaxL, but not
Rax, is required for photoreceptor cell development. Interestingly,
we observed a similar photoreceptor phenotype with 100% penetrance when we
introduced a dominant-negative allele comprising the engrailed repressor
domain fused with the RaxL homeodomain (EnRaxLHD)
(Fig. 3M,N). However, when a
control viral construct, EnIrx, which carries the homeodomain of Irx
fused to the engrailed repressor domain
(Bao et al., 1999
), was
introduced into chick retina, the normal visinin and Rxrg
expression was observed within the EnIrx infected patches
(Fig. 3O,P, and data not
shown).
RaxL is not required for non-photoreceptor cell development
in the retina
In order to examine whether the effects on retina cell differentiation by
EnRaxL
C virus were specific to photoreceptors, the expression of
markers of other cell types were analyzed. The expression of Brn3a
(now known as Pou4f1) the ganglion cell marker
(Liu et al., 2000
),
Chx10, the bipolar cell marker
(Belecky-Adams et al., 1997
;
Chen and Cepko, 2000
), and
Pax6, which marks horizontal, amacrine and ganglion cells
(Belecky-Adams et al., 1997
),
were analyzed on EnRaxL
C infected retina. Virus infected E9 retinas,
including seven retinas for Brn3a, 6 retinas for Chx10 and 8
retinas for Pax6, were analyzed. None of these markers were affected
by expression of EnRaxL
C (Fig.
4). We also found no changes on the expression of these markers
when EnRaxLHD was introduced into chick retina (data not shown). These results
strongly suggest that the RaxL gene is required for proper
development of photoreceptor cells, but not other retinal neurons.
|
EnRaxL
C functions as a dominant negative form of
RaxL
We have shown that EnRaxL
C, which theoretically acts as a dominant
negative allele of RaxL, blocks normal photoreceptor differentiation.
To determine whether EnRaxL
C indeed functions as a dominant negative
allele of RaxL, the transactivation activities of RaxL and
EnRaxL
C were analyzed using a reporter construct encoding the
chloramphenicol acetyltransferase (CAT) gene driven by five copies of the Ret1
enhancer element (RET1-CAT) (Fig.
5A). The Ret1/PCE1 site, an enhancer element present in many
photoreceptor specific genes, is required for photoreceptor specific
expression of these genes (Kikuchi et al.,
1993
). Fig. 5B
shows that RaxL transactivated the RET1-CAT reporter construct 53-fold above
the control expression vector when transiently transfected into COS cells,
suggesting that RaxL is a strong transcriptional activator which can
transactive photoreceptor specific genes through the Ret1 enhancer element. By
contrast, Rax transactived the same reporter construct more weakly (ninefold
above the control vector) (Fig.
5B), suggesting that Rax might recognize different enhancer
elements that perhaps function in progenitor cells. To test the
dominant-negative activity of EnRaxL
C, the RET1-CAT construct was
transiently co-transfected with vectors expressing RaxL and/or various
engrailed-fusion constructs into COS cells. The CAT activity of cell extracts
was assayed 48 hours after transfection. In the presence of an increasing
amount of EnRaxL
C, the activation activity of RaxL was reduced in a
dose-responsive manner. An equal amount of EnRaxL
C repressed the RaxL
activation activity to 25.3%, and three times more EnRaxL
C further
repressed the activity of RaxL to 3.9%
(Fig. 5C). This decrease of CAT
activity is not due to the overexpression of a homeodomain protein, as cells
transfected with four doses of RaxL showed similar CAT activity to those
transactivated by a single dose of RaxL (data not shown). EnRaxL
C
repressed the transactivation of RaxL specifically, as EnRaxL
C showed
no effect on the activity of a CAT reporter driven by the SV40 enhancer
elements (data not shown). These data suggest that EnRaxL
C functions as
a dominant negative form of RaxL, and that expression of
EnRaxL
C inhibits the endogenous RaxL activity. Interestingly,
we also found dominant negative activities of EnRax
C and EnRaxLHD on
RaxL transactivation activity in a dose-related manner
(Fig. 5C). The dominant
negative effects of EnRax
C and EnRaxLHD were similar but weaker than
EnRaxL
C.
|
Overexpression of RaxL rescues the photoreceptor phenotype
induced by EnRaxLHD
We have demonstrated that EnRaxL
C can inhibit the transcription
activity of RaxL in tissue culture cells, suggesting that the phenotype
observed by expressing EnRaxL
C in the chick retina is due to a block of
endogenous RaxL activity. If this assumption is correct, the dominant negative
phenotype created by EnRaxL
C should be rescued by coexpression of RaxL
in ovo. As the phenotype created by EnRaxL
C did not show full
penetrance, we decided to use the dominant-negative EnRaxLHD, which is more
effective, and thus facilitate the interpretation of a rescue experiment. We
electroporated EnRaxLHD alone or together with RaxL into chick optic vesicles.
The EnRaxLHD and RaxL retroviral constructs carry the type B and type A
envelope proteins, respectively, which allows co-infection of both viruses
into the same cells. After the detection of EnRaxLHD virus, we stained the
infected retinas with the 3C2 mAb, which recognizes a matrix core protein of
Rous Sarcoma virus (Potts et al.,
1987
). The 3C2 mAb recognizes both viruses. When EnRaxLHD alone
was electroporated, we observed strong inhibition of the visinin signal, which
correlated with EnRaxLHD infected patches, detected by engrailed expression.
The staining pattern of 3C2 mAb perfectly matched the engrailed staining
pattern (Fig. 6A-C). This
observation allows us to assume that 3C2 stained areas with no engrailed
signal represents the RaxL-only infected region. However, the patches with
engrailed signal may express EnRaxLHD virus alone, or express both EnRaxLHD
and RaxL viruses. To ensure that most of the EnRaxLHD infected cells were also
infected with RaxL virus, we electroporated three times as much RaxL viral
construct as EnRaxLHD construct when co-electroporation was performed.
Fig. 6D-G show that when both
EnRaxLHD and RaxL were introduced, the inhibitory effect on visinin
expression by EnRaxLHD was dramatically reduced
(Fig. 6D,E, arrows). These data
demonstrated that ectopic expression of RaxL rescued the dominant-negative
phenotype generated by EnRaxLHD. This rescue was specific to RaxL. Chick Rax
can not rescue the photoreceptor phenotype
(Fig. 6H-K). Similarly, when
the mouse Crx viral construct, encoding another paired-type homeodomain
protein, which is required for photoreceptor maturation but not for initial
photoreceptor cell generation (Furukawa et
al., 1997b
), was introduced with EnRaxLHD, no rescue of
visinin expression was found (Fig.
6L-N). These in vivo rescue results strongly suggest that the
inhibition of photoreceptor gene expression was due to a block of endogenous
RaxL activity. The fact that Crx could not rescue or bypass
RaxL function suggests that RaxL is required before
Crx function during photoreceptor cell development. This is
consistent with the idea that RaxL is required in the early stage of
photoreceptor cell generation.
|
EnRaxLHD caused a reduction in cells expressing photoreceptor
markers
The reduction in the expression of photoreceptor specific genes could be
due to EnRaxL
C interfering with proper photoreceptor differentiation
and/or photoreceptor survival. To further address these issues, we took
advantage of the consistent penetrance of EnRaxLHD to quantify the number of
photoreceptors following expression of EnRaxLHD. Two monoclonal antibodies
(mAb) against chick visinin were generated, 6H9 and 7G4, which exhibited
specificity for chick visinin (S. Bruhn and C. Cepko, unpublished). They
behaved similarly in both western blots and immunohistochemical assays, with
the results of 7G4 shown in Fig.
7A-C. 7G4 recognized a single band of 24 kDa from chick retinal
extracts by western blot analysis, which corresponds to the predicted size of
chick visinin (Fig. 7A). A low
level of visinin protein was evident at E5.5 and the level increased gradually
as more photoreceptors differentiated between E6.5 and E8.5
(Fig. 7A). This time course is
consistent with the expression profile of visinin transcripts
(Bruhn and Cepko, 1996
). The
immunostaining on retinal sections further demonstrated that the visinin mAb
recognized differentiating and mature photoreceptors, which are localized to
the developing ONL in differentiating (E7) and mature (E18) retinas
(Fig. 7B,C). These analyses
demonstrate that the visinin mAb is a reliable early marker of
photoreceptors.
|
To quantify the number of photoreceptor cells, optic vesicles were electroporated with EnRaxLHD, RaxL or control RCAS retroviral constructs at Hamburger-Hamilton stage 10 and infected retinas were harvested and dissociated at E8. FACS analysis was performed on dissociated retinal cells after staining with 7G4 mAb against visinin and antiserum against p27, an Avian Leukemia Viral protein (SPAFAS) (Fig. 7D,E). As viral infections only occurred in some patches of the retina and we expected the action of EnRaxLHD to be cell autonomous, only infected cells were scored for visinin expression. The percentage of visinin and p27 double-positive cells among the viral infected population (p27 positive) was calculated after a total of 250,000 cells were counted from each retina. In two independent experiments, 10.8% and 15.7% (on average) of control virus infected retinal cells were visinin-positive photoreceptors. However, when the retina was infected with the EnRaxLHD virus, the percentage of photoreceptors was significantly decreased to average 7.5% and 10.4%, respectively (Fig. 7F). We found no significant change in the VC1.1-positive population, which comprises amacrine and ganglion cells, when the retina was infected with EnRaxLHD virus (data not shown). Interestingly, we found a slight increase in visinin-expressing photoreceptors in retinas infected with RaxL virus (from average 10.8% and 13.5% to 12.3% and 15.8%, respectively) (Fig. 7F). Overexpression of RaxL thus slightly increased the number of photoreceptors, and interfering with the endogenous RaxL by overexpression of the dominant negative EnRaxLHD led to a significant reduction of differentiating photoreceptor cells in the retina.
EnRaxLHD induces apoptosis
Results from both the FACS analysis and whole-mount in situ hybridization
showed that decreasing the number of differentiating photoreceptors did not
lead to an increase of the other retinal cell types scored following
introduction of dominant negative RaxL. These data suggested that
interfering with the normal function of RaxL did not induce a change
in retinal cell fates. The reduction in differentiating photoreceptors could
then be a block in photoreceptor cell differentiation and/or induction of
photoreceptor cell death, or an effect on proliferation that affects only
photoreceptor cells. The latter case is very unlikely, as photoreceptors are
made by a multipotent progenitor (Fekete
et al., 1994
) and thus other cells would be affected, as would
general proliferation, if this were the case. Nevertheless, to test the effect
of dominant negative RaxL on cell proliferation, the
anti-phospho-Histone H3 antibody was used to detect mitotic cells on E7.5
retinal sections electroporated with the EnRaxLHD viral construct. The virus
infected patches were visualized with 3C2 mAb
(Fig. 8, red). At E7.5 very few
M-phase cells were found in or near the ventricular surface (green nuclei in
Fig. 8A), and there was no
significant difference between virus-infected patches and adjacent
non-infected areas (Fig. 8A,B).
We also found that EnRaxLHD had no significant effect when scored for
phospho-Histone H3 staining on E5.5 and E6.5 retinas when there were more
mitotic cells (data not shown). These data suggest that the decrease in
differentiating photoreceptor cells by EnRaxLHD was not due to interference
with progenitor cell proliferation. We then examined the possibility that
reduction was due to apoptosis. The TUNEL assay was performed on E7.5 retinal
sections electroporated with EnRaxLHD or control EnIrx viral constructs.
TUNEL-positive cells were found only occasionally in normal E7.5 retinal
sections. Very few TUNEL-positive cells were found in control EnIrx infected
retina (Fig. 8C,D) and
non-infected patches in EnRaxLHD infected retina
(Fig. 8E,F). However, many
TUNEL-positive cells were observed in the EnRaxLHD infected patches
(Fig. 8E, green and yellow
dots). The same viral construct induced no apoptosis when electroporated into
chick brain (Fig. 8G,H),
suggesting that overexpression of EnRaxLHD does not lead to non-specific
apoptosis. The specific increase of apoptosis in EnRaxLHD infected retina
provides an explanation for the decreased number of photoreceptor cells.
Interestingly, we found that the TUNEL-positive cells were not concentrated in
the photoreceptor layer, but spanned the radial thickness of the retina.
|
| DISCUSSION |
|---|
|
|
|---|
Rax and RaxL are expressed in overlapping, but not
identical, patterns
We have isolated cDNAs encoding two members of chick Rax family,
Rax and RaxL. Rax is highly expressed in the optic vesicles,
retinal progenitor cells, and the ventral diencephalon, in a pattern similar
to that of the mouse Rax/Rx
(Furukawa et al., 1997a
;
Mathers et al., 1997
) and the
published chicken Rax gene
(Ohuchi et al., 1999
).
However, contrary to the previous report that RaxL is highly
expressed in the developing retina and ventral diencephalon
(Ohuchi et al., 1999
), we
found that RaxL is expressed in the optic vesicles and retinal
progenitor cells, but is absent from the ventral diencephalon. We reason that
this difference is due to the specificity of the RaxL probe used in
each study. The RaxL probe used previously contains the homeodomain,
which shares 96% nucleotide (173 out of 180 nucleotides) identity to the
Rax homeodomain region. The RaxL probe containing the
homeodomain region can recognize both Rax and RaxL
transcripts, and therefore can cross-hybridize with Rax in the
ventral diencephalon. The fact that we do not observe RaxL in the
ventral diencephalon allows us to conclude that the RaxL expression
pattern resembles that of the zebrafish homologs rx1 and rx2.
rx1 and rx2 are expressed in the optic primordium and are absent
from the ventral midline of the diencephalon. More interestingly, similar to
RaxL, rx1 and rx2 are also downregulated as the retina
differentiates, except in the ONL where they continue to be expressed at high
levels in photoreceptors. The photoreceptor cells where rx1 and
rx2 expressed are cones, but not rods
(Chuang et al., 1999
).
RaxL is also expressed in cones as cones comprise 80% of chick
photoreceptors and the RaxL-expressing population comprises the
majority, if not all, of the photoreceptors. However, we cannot determine if
RaxL is also expressed in rods. We speculate that RaxL
homologs are expressed in cone, but not rod, photoreceptor cells in
vertebrates. Such conserved expression pattern and gene sequences suggest an
important function for RaxL in photoreceptor development. In mammals,
the expression of a human RaxL homolog (RAX2) in a
retinoblastoma cell line further suggests a role of RaxL in retina
development. In addition, mutations in the human RAX2 gene have been
found in individuals with photoreceptor degeneration, which, if shown to be
causal, would further establish the importance of RaxL homologs in
photoreceptor cell development and/or function (D. Zack, personal
communication). A mouse RaxL homolog has not been isolated.
Surprisingly, the human RAX2 syntenic region is missing in the mouse
genome (T. Matsuda and C. Cepko, unpublished). It is possible that the mouse
RaxL homolog is located in a different location in the mouse genome,
and is expressed at very low abundance because it is expected to be in cone
photoreceptors, which comprise only 2.2% of retina cells in the mouse
(Young, 1985
). It is also
possible that the mouse has no RaxL homolog. The function of
RaxL may be carried out by the mouse Rax/Rx gene, as mouse
Rax/Rx has been reported to be expressed in photoreceptor cells and
can transactivate photoreceptor specific genes
(Kimura et al., 2000
).
The expression pattern of RaxL suggests a role in early
developing photoreceptors
Photoreceptor cells develop in a temporal gradient from the central to the
peripheral retina. In the peripheral chick E7 retina, a subset of retinal
cells that express a high level of RaxL spans the retinal epithelium,
except in the differentiating ganglion cell layer. As development proceeds,
centrally located RaxL-expressing cells become concentrated in the
photoreceptor layer. This pattern is consistent with RaxL being
expressed in mitotic progenitors that are in the process of producing
photoreceptors, and/or in newly postmitotic photoreceptors. The high level
expression of RaxL in such populations places RaxL at an
important point in early photoreceptor development.
Chick photoreceptor genesis is reported to begin sometime between E3 and E5
in different studies (Kahn,
1974
; Spence and Robson,
1989
), with the bulk of photoreceptor genesis occurring between E5
and E6 (Prada et al., 1991
;
Belecky-Adams et al., 1996
).
Photoreceptors do not differentiate morphologically until E9.5, when the inner
segments appear (Meller and Tetzlaff,
1976
). The outer segments appear on E13
(Meller and Tetzlaff, 1976
),
and the synapses from photoreceptors to bipolar cells are evident on about E18
(Hughes and LaVelle, 1974
). As
discussed above, we found that RaxL is expressed in developing
photoreceptors, but not in mature photoreceptors on E19, suggesting that
RaxL is not required for the maintenance or survival of mature
photoreceptors. Furthermore, apoptosis was observed as early as E7.5 when
proper RaxL function was blocked, also indicating that RaxL
is required for an early step in photoreceptor development.
EnRaxLHD interferes with the function of RaxL but not
Rax
There are two populations of retinal progenitor cells expressing the
RaxL transcript. One is the majority of retinal progenitors, which
expresses a low level of RaxL and a high level of Rax. The
other population is a small subset of cells that expresses a high level of
RaxL. Our data show that overexpression of a fusion construct,
EnRaxLHD, interferes with survival of a subset of cells located predominantly
in the middle retinal layer. This is the area where mitotic progenitor cells
reside and thus it is possible that EnRaxLHD interferes with survival of a
subset of mitotic cells. These may be the same cells that express high levels
of RaxL in this area, and we would propose that these are the cells
that are in the process of producing photoreceptor cells. We believe that it
would be this subset of cells, rather than all progenitor cells, based upon
the observations that EnRaxLHD does not interfere with general progenitor
proliferation, as the number of mitotic cells and the overall thickness of
infected areas, as well as differentiation of other retinal cell types, were
not significantly affected. Alternatively, the dying cells located in the
middle of the retina following transduction with EnRaxLHD are newly produced,
postmitotic cells that are fated to be photoreceptor cells. It is not known if
cells in this state would be located in this area as there are no markers for
cells that are newly postmitotic and fated to be photoreceptors. Although
photoreceptor cells are usually located in the outer nuclear layer, it is
possible that they briefly reside in the middle of the retina prior to
migrating to the future outer nuclear layer. It is curious that murine cones
do display an inward migration prior to undergoing full differentiation in the
mouse (Rich et al., 1997
).
Despite the identical amino acid sequence in the homeodomain regions of
Rax and RaxL, dominant-negative EnRaxL
C, which
included most of the RaxL sequence outside of homeodomain region,
seemed to maintain it's specificity and interfere mainly with the function of
RaxL, and not Rax. It is possible that the enhancer sequence
recognized by Rax in progenitor cells is different from that
recognized by RaxL in early photoreceptors. The finding that RaxL
transactives the photoreceptor specific Ret1 enhancer element more efficiently
than Rax supports this idea. However, this idea remains to be confirmed after
the identification of the authentic binding elements of Rax and
RaxL. It is also possible that the expression level of Rax
is higher than that of RaxL in the retinal progenitor cells and that
the expression level of EnRaxL
C was not high enough to interfere with
Rax function. Alternatively, the function of Rax in
progenitor cells may be dispensable since other paired-type homeodomain genes,
e.g. Pax6 and Chx10 are highly expressed in retinal
progenitor cells. The similar dominant-negative construct, EnRax
C,
which contained most of Rax, had no effect on photoreceptor cell
differentiation, further supporting the notion that the sequence outside of
the homeodomain region provides significant specificity in ovo. Although
EnRax
C can interfere with the transactivation activity of RaxL when
assayed on a simplified reporter construct (RET1-CAT) in tissue culture cells,
it appears not to function as a dominant-negative allele of RaxL on
complex photoreceptor promoters in ovo. Our finding that interference with the
endogenous RaxL activity by overexpression of EnRaxL
C disturbs
an early step in photoreceptor development, but not the general progenitor
pool, suggests that only the progenitor population in the process of producing
photoreceptor cells, or newborn photoreceptor cells, is affected. Without the
proper activity of RaxL, photoreceptor cells cannot differentiate
properly and, as a result, undergo apoptosis.
Other transcription factors are required for photoreceptor cell
differentiation
Several photoreceptor-specific transcription factors have been identified
over the last several years. Among them, neuroD (now known as
Neurod1) a basic helix-loop-helix gene, is expressed in retinal
photoreceptors transiently in chick and is sufficient to generate more
photoreceptors when overexpressed in chick retina
(Yan and Wang, 1998
). In mice,
Neurod1 is expressed in retinal progenitor cells as well as in
developing photoreceptor and amacrine cells, and is maintained in a subset of
mature photoreceptors. Analysis of a Neurod1 knockout mouse and
overexpression of Neurod1 in rats shows that it is not required for
the initial formation of photoreceptor cells
(Morrow et al., 1999
). Thus
the role of Neurod1 in photoreceptor cell development is not the same
in chick and mouse, or perhaps it is not required in chick or mouse
photoreceptor development. Further studies are needed to clarify its role.
Crx, an otx-like homeodomain gene, is expressed in newly generated
photoreceptors, including both cones and rods, as well as at a low level in
bipolar cells in mice and a high level in bipolar cells in zebrafish
(Furukawa et al., 1997b
;
Chen et al., 1997
;
Liu et al., 2001
).
Interestingly, in zebrafish, Crx is expressed in mitotic cells
presumably fated to produce photoreceptor cells, while in murine retinal
cells, the expression of Crx appears to be initiated in cells that
are fated to be photoreceptors, just after exit from the cell cycle. The
timing of chick Crx expression appears to be the same at it is in
mouse (T. Furukawa, personal communication). Functional studies in rodents
have shown that Crx is required for a high level of expression of
many photoreceptor specific genes. It is required for maturation, but not for
the initial generation, of photoreceptors
(Furukawa et al., 1997b
;
Livesey et al., 2000
). Another
important transcription factor in photoreceptor development is Nrl, a
basic motif- leucine zipper transcription factor. Nrl is expressed in
rod, but not cone, photoreceptors (Swain
et al., 2001
). It physically interacts with Crx and
synergistically transactivates the rhodopsin promoter in vitro
(Mitton et al., 2000
).
Analysis of Nrl mutant mice has revealed that it is a critical
determinant of early rod photoreceptor cell development
(Mears et al., 2001
). A
similar function is ascribed to Nr2e3 (also known as PNR),
which encodes a ligand-dependent retinal nuclear receptor. Nr2e3 is
expressed in photoreceptor cells
(Kobayashi et al., 1999
), and
mutations in Nr2e3 lead to an increased number of cone cells in mice
and the enhanced S cone syndrome, a disorder of photoreceptor cells, in humans
(Haider et al., 2000
;
Haider et al., 2001
). We
provide evidence that a Rax family member, RaxL, is required
for the initial generation of photoreceptors in chick. RaxL is
expressed in cone photoreceptors. We hypothesize that RaxL and
Nrl are required for the early stages of cone and rod cell fate
determination, respectively. Later in development, as cones and rods take up
their final stages of differentiation, Crx plays the major role in
supporting photoreceptor-specific gene expression. Overexpression of
Crx failed to rescue the photoreceptor phenotype induced by a
dominant-negative allele of RaxL, further supporting the idea of
early role of RaxL in photoreceptor development.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Altshuler, D. M., Turner, D. L. and Cepko, C.
(1991). Specification of cell type in the vertebrate retina. In
Development of the Visual System (ed. M.-K. Lam and C.
Shatz), pp. 37-58. Cambridge, MA: MIT
Press.
Andreazzoli, M., Gestri, G., Angeloni, D., Menna, E. and
Barsacchi, G. (1999). Role of Xrx1 in Xenopus eye and
anterior brain development. Development
126,2451
-2460.[Abstract]
Bao, Z. Z., Bruneau, B. G., Seidman, J. G., Seidman, C. E. and
Cepko, C. L. (1999). Regulation of chamber-specific gene
expression in the developing heart by Irx4. Science
283,1161
-1164.
Belecky-Adams, T., Cook, B. and Adler, R.
(1996). Correlations between terminal mitosis and differentiated
fate of retinal precursor cells in vivo and in vitro: analysis with the
`window-labeling' technique. Dev. Biol.
178,304
-315.[CrossRef][Medline]
Belecky-Adams, T., Tomarev, S., Li, H. S., Ploder, L., McInnes,
R. R., Sundin, O. and Adler, R. (1997). Pax-6, Prox 1, and
Chx10 homeobox gene expression correlates with phenotypic fate of retinal
precursor cells. Invest. Ophthalmol. Vis. Sci.
38,1293
-1303.
Blackshaw, S., Fraioli, R. E., Furukawa, T. and Cepko, C. L.
(2001). Comprehensive analysis of photoreceptor gene expression
and the identification of candidate retinal disease genes.
Cell 107,579
-589.[CrossRef][Medline]
Bruhn, S. L. and Cepko, C. L. (1996).
Development of the pattern of photoreceptors in the chick retina.
J. Neurosci. 16,1430
-1439.
Cepko, C. L., Austin, C. P., Yang, X., Alexiades, M. and
Ezzeddine, D. (1996). Cell fate determination in the
vertebrate retina. Proc. Natl. Acad. Sci. USA
93,589
-595.
Chen, C. M. and Cepko, C. L. (2000). Expression
of Chx10 and Chx10-1 in the developing chicken retina. Mech.
Dev. 90,293
-297.[CrossRef][Medline]
Chen, C. M., Kraut, N., Groudine, M. and Weintraub, H.
(1996). I-mf, a novel myogenic repressor, interacts with members
of the MyoD family. Cell
86,731
-741.[CrossRef][Medline]
Chen, C. M., Smith, D. M., Peters, M. A., Samson, M. E., Zitz,
J., Tabin, C. J. and Cepko, C. L. (1999). Production and
design of more effective avian replication-incompetent retroviral vectors.
Dev. Biol. 214,370
-384.[CrossRef][Medline]
Chen, S., Wang, Q. L., Nie, Z., Sun, H., Lennon, G., Copeland,
N. G., Gilbert, D. J., Jenkins, N. A. and Zack, D. J. (1997).
Crx, a novel Otx-like paired-homeodomain protein, binds to and transactivates
photoreceptor cell-specific genes. Neuron
19,1017
-1030.[CrossRef][Medline]
Chuang, J. C., Mathers, P. H. and Raymond, P. A.
(1999). Expression of three Rx homeobox genes in embryonic and
adult zebrafish. Mech. Dev.
84,195
-198.[CrossRef][Medline]
Clarke, G., Heon, E. and McInnes, R. R. (2000).
Recent advances in the molecular basis of inherited photoreceptor
degeneration. Clin. Genet.
57,313
-329.[CrossRef][Medline]
Fekete, D. M., Perez-Miguelsanz, J., Ryder, E. F. and Cepko, C.
L. (1994). Clonal analysis in the chicken retina reveals
tangential dispersion of clonally related cells. Dev.
Biol. 166,666
-682.[CrossRef][Medline]
Furukawa, T., Kozak, C. A. and Cepko, C. L.
(1997a). rax, a novel paired-type homeobox gene, shows expression
in the anterior neural fold and developing retina. Proc. Natl.
Acad. Sci. USA 94,3088
-3093.
Furukawa, T., Morrow, E. M. and Cepko, C. L.
(1997b). Crx, a novel otx-like homeobox gene, shows
photoreceptor-specific expression and regulates photoreceptor differentiation.
Cell 91,531
-541.[CrossRef][Medline]
Furukawa, T., Mukherjee, S., Bao, Z. Z., Morrow, E. M. and
Cepko, C. L. (2000). rax, Hes1, and notch1 promote the
formation of Muller glia by postnatal retinal progenitor cells.
Neuron 26,383
-394.[CrossRef][Medline]
Haider, N. B., Jacobson, S. G., Cideciyan, A. V., Swiderski, R.,
Streb, L. M., Searby, C., Beck, G., Hockey, R., Hanna, D. B., Gorman, S. et
al. (2000). Mutation of a nuclear receptor gene, NR2E3,
causes enhanced S cone syndrome, a disorder of retinal cell fate.
Nat. Genet. 24,127
-131.[CrossRef][Medline]
Haider, N. B., Naggert, J. K. and Nishina, P. M.
(2001). Excess cone cell proliferation due to lack of a
functional NR2E3 causes retinal dysplasia and degeneration in rd7/rd7 mice.
Hum. Mol. Genet. 10,1619
-1626.
Holt, C. E., Bertsch, T. W., Ellis, H. M. and Harris, W. A.
(1988). Cellular determination in the Xenopus retina is
independent of lineage and birth date. Neuron
1, 15-26.[CrossRef][Medline]
Hoover, F., Seleiro, E. A., Kielland, A., Brickell, P. M. and
Glover, J. C. (1998). Retinoid X receptor gamma gene
transcripts are expressed by a subset of early generated retinal cells and
eventually restricted to photoreceptors. J. Comp.
Neurol. 391,204
-213.[CrossRef][Medline]
Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J. and
Sutrave, P. (1987). Adaptor plasmids simplify the insertion
of foreign DNA into helper-independent retroviral vectors. J.
Virol. 61,3004
-3012.
Hughes, W. F. and LaVelle, A. (1974). On the
synaptogenic sequence in the chick retina. Anat. Rec.
179,297
-301.[CrossRef][Medline]
Kahn, A. J. (1974). An autoradiographic
analysis of the time of appearance of neurons in the developing chick neural
retina. Dev. Biol. 38,30
-40.[CrossRef][Medline]
Kikuchi, T., Raju, K., Breitman, M. L. and Shinohara, T.
(1993). The proximal promoter of the mouse arrestin gene directs
gene expression in photoreceptor cells and contains an evolutionarily
conserved retinal factor-binding site. Mol. Cell.
Biol. 13,4400
-4408.
Kimura, A., Singh, D., Wawrousek, E. F., Kikuchi, M., Nakamura,
M. and Shinohara, T. (2000). Both PCE-1/RX and OTX/CRX
interactions are necessary for photoreceptor- specific gene expression.
J. Biol. Chem. 275,1152
-1160.
Kobayashi, M., Takezawa, S., Hara, K., Yu, R. T., Umesono, Y.,
Agata, K., Taniwaki, M., Yasuda, K. and Umesono, K. (1999).
Identification of a photoreceptor cell-specific nuclear receptor.
Proc. Natl. Acad. Sci. USA
96,4814
-4819.
Levine, E. M., Fuhrmann, S. and Reh, T. A.
(2000). Soluble factors and the development of rod
photoreceptors. Cell Mol. Life Sci.
57,224
-234.[CrossRef][Medline]
Liu, W., Khare, S. L., Liang, X., Peters, M. A., Liu, X., Cepko,
C. L. and Xiang, M. (2000). All Brn3 genes can promote
retinal ganglion cell differentiation in the chick.
Development 127,3237
-3247.[Abstract]
Liu, Y., Shen, Y., Rest, J. S., Raymond, P. A. and Zack, D.
J. (2001). Isolation and characterization of a zebrafish
homologue of the cone rod homeobox gene. Invest. Ophthalmol. Vis.
Sci. 42,481
-487.
Livesey, F. J., Furukawa, T., Steffen, M. A., Church, G. M. and
Cepko, C. L. (2000). Microarray analysis of the
transcriptional network controlled by the photoreceptor homeobox gene Crx.
Curr. Biol. 10,301
-310.[CrossRef][Medline]
Mathers, P. H., Grinberg, A., Mahon, K. A. and Jamrich, M.
(1997). The Rx homeobox gene is essential for vertebrate eye
development. Nature 387,603
-607.[CrossRef][Medline]
Mears, A. J., Kondo, M., Swain, P. K., Takada, Y., Bush, R. A.,
Saunders, T. L., Sieving, P. A. and Swaroop, A. (2001). Nrl
is required for rod photoreceptor development. Nat.
Genet. 5,5
.
Meller, K. and Tetzlaff, W. (1976). Scanning
electron microscopic studies on the development of the chick retina.
Cell Tissue Res. 170,145
-159.[Medline]
Mitton, K. P., Swain, P. K., Chen, S., Xu, S., Zack, D. J. and
Swaroop, A. (2000). The leucine zipper of NRL interacts with
the CRX homeodomain. A possible mechanism of transcriptional synergy in
rhodopsin regulation. J. Biol. Chem.
275,29794
-29799.
Morris, V. B. (1982). An afoveate area
centralis in the chick retina. J. Comp. Neurol.
210,198
-203.[CrossRef][Medline]
Morrow, E. M., Furukawa, T. and Cepko, C. L.
(1998). Vertebrate photoreceptor cell development and disease.
Trends Cell Biol. 8,353
-358.[CrossRef][Medline]
Morrow, E. M., Furukawa, T., Lee, J. E. and Cepko, C. L.
(1999). NeuroD regulates multiple functions in the developing
neural retina in rodent. Development
126, 23-36.[Abstract]
Ohuchi, H., Tomonari, S., Itoh, H., Mikawa, T. and Noji, S.
(1999). Identification of chick rax/rx genes with overlapping
patterns of expression during early eye and brain development.
Mech. Dev. 85,193
-195.[CrossRef][Medline]
Polans, A. S., Burton, M. D., Haley, T. L., Crabb, J. W. and
Palczewski, K. (1993). Recoverin, but not visinin, is an
autoantigen in the human retina identified with a cancer-associated
retinopathy. Invest. Ophthalmol. Vis. Sci.
34, 81-90.
Potts, W. M., Olsen, M., Boettiger, D. and Vogt, V. M.
(1987). Epitope mapping of monoclonal antibodies to gag protein
p19 of avian sarcoma and leukaemia viruses. J. Gen.
Virol. 68,3177
-3182
Prada, C., Puga, J., Mendez-Perez, L., Lopez, R. and Ramirez,
G. (1991). Spatial and temporal patterns of neurogenesis in
the chick retina. Eur. J. Neurosci.
3, 559-569.[CrossRef][Medline]
Rich, K. A., Zhan, Y. and Blanks, J. C. (1997).
Migration and synaptogenesis of cone photoreceptors in the developing mouse
retina. J. Comp. Neurol.
388, 47-63.[CrossRef][Medline]
Rupp, R. A., Snider, L. and Weintraub, H.
(1994). Xenopus embryos regulate the nuclear localization of
XMyoD. Genes Dev. 8,1311
-1323.
Spence, S. G. and Robson, J. A. (1989). An
autoradiographic analysis of neurogenesis in the chick retina in vitro and in
vivo. Neuroscience 32,801
-812.[CrossRef][Medline]
Swain, P. K., Hicks, D., Mears, A. J., Apel, I. J., Smith, J.
E., John, S. K., Hendrickson, A., Milam, A. H. and Swaroop, A.
(2001). Multiple phosphorylated isoforms of NRL are expressed in
rod photoreceptors. J. Biol. Chem.
276,36824
-36830.
Turner, D. L. and Cepko, C. L. (1987). A common
progenitor for neurons and glia persists in rat retina late in development.
Nature 328,131
-136.[CrossRef][Medline]
Turner, D. L., Snyder, E. Y. and Cepko, C. L.
(1990). Lineage-independent determination of cell type in the
embryonic mouse retina. Neuron
4, 833-845.[CrossRef][Medline]
Turner, D. L. and Weintraub, H. (1994).
Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal
cells to a neural fate. Genes Dev.
8,1434
-1447.
Weber, B. H. (1998). Recent advances in the
molecular genetics of hereditary retinal dystrophies with primary involvement
of the macula. Acta Anat.
162, 65-74.[CrossRef][Medline]
Wetts, R. and Fraser, S. E. (1988). Multipotent
precursors can give rise to all major cell types of the frog retina.
Science 239,1142
-1145.
Yamagata, K., Goto, K., Kuo, C. H., Kondo, H. and Miki, N.
(1990). Visinin: a novel calcium binding protein expressed in
retinal cone cells. Neuron
4, 469-476.[CrossRef][Medline]
Yan, R. T. and Wang, S. Z. (1998). neuroD
induces photoreceptor cell overproduction in vivo and de novo generation in
vitro. J. Neurobiol. 36,485
-496.[CrossRef][Medline]
Young, R. W. (1985). Cell differentiation in
the retina of the mouse. Anat. Rec.
212,199
-205.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
L. Liang, R.-T. Yan, X. Li, M. Chimento, and S.-Z. Wang Reprogramming Progeny Cells of Embryonic RPE to Produce Photoreceptors: Development of Advanced Photoreceptor Traits under the Induction of neuroD Invest. Ophthalmol. Vis. Sci., September 1, 2008; 49(9): 4145 - 4153. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Pan, S. Nekkalapudi, L. E. Kelly, and H. M. El-Hodiri The Rx-like Homeobox Gene (Rx-L) Is Necessary for Normal Photoreceptor Development. Invest. Ophthalmol. Vis. Sci., October 1, 2006; 47(10): 4245 - 4253. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Cho and C. L. Cepko Wnt2b/{beta}-catenin-mediated canonical Wnt signaling determines the peripheral fates of the chick eye Development, August 15, 2006; 133(16): 3167 - 3177. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Young-Pearse, L. Ivic, A. R. Kriegstein, and C. L. Cepko Characterization of Mice with Targeted Deletion of Glycine Receptor Alpha 2 Mol. Cell. Biol., August 1, 2006; 26(15): 5728 - 5734. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Jadhav, H. A. Mason, and C. L. Cepko Notch 1 inhibits photoreceptor production in the developing mammalian retina Development, March 1, 2006; 133(5): 913 - 923. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sen, S. Harpavat, M. A. Peters, and C. L. Cepko Retinoic acid regulates the expression of dorsoventral topographic guidance molecules in the chick retina Development, December 1, 2005; 132(23): 5147 - 5159. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Arendt, K. Tessmar-Raible, H. Snyman, A. W. Dorresteijn, and J. Wittbrodt Ciliary Photoreceptors with a Vertebrate-Type Opsin in an Invertebrate Brain Science, October 29, 2004; 306(5697): 869 - 871. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rowan, C.-M. A. Chen, T. L. Young, D. E. Fisher, and C. L. Cepko Transdifferentiation of the retina into pigmented cells in ocular retardation mice defines a new function of the homeodomain gene Chx10 Development, October 15, 2004; 131(20): 5139 - 5152. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Ma, R.-T. Yan, W. Xie, and S.-Z. Wang A Role of ath5 in Inducing neuroD and the Photoreceptor Pathway J. Neurosci., August 11, 2004; 24(32): 7150 - 7158. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q.-l. Wang, S. Chen, N. Esumi, P. K. Swain, H. S. Haines, G. Peng, B. M. Melia, I. McIntosh, J. R. Heckenlively, S. G. Jacobson, et al. QRX, a novel homeobox gene, modulates photoreceptor gene expression Hum. Mol. Genet., May 15, 2004; 13(10): 1025 - 1040. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||