|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00111

1 Plant Science Center, RIKEN, 1-7-22 Suehiro-cho, Tsurumi-Ku, Yokohama,
Kanagawa 230-0045, Japan
2 Department of Botany, Graduate School of Science, Kyoto University,
Kitashirakawa Oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan
3 Research Institute for Biological Science, Kayo-cho, Jobo, Okayama 716-1241,
Japan
4 Department of Genetics and Cell Biology, University of Minnesota, St. Paul, MN
55108-1095, USA
5 Biomolecular Engineering Research Institute, 6-2-3 Furuedai, Suita, Osaka
565-0874, Japan
* Present address: Chugai Pharmaceutical Co. Ltd., 1-135 Komakado, Gotemba,
Shizuoka 412-8513, Japan
Author for correspondence (e-mail:
kiyo{at}ok-lab.bot.kyoto-u.ac.jp)
Accepted 26 August 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Arabidiopsis, CAPRICE, Myb, bHLH, Root hair, Transcriptional regulation, Epidermis, Protein movement
| INTRODUCTION |
|---|
|
|
|---|
|
The molecular genetic mechanism of cell fate determination of root-hair
cells is being studied by use of a set of mutants. Three Arabidopsis
genes, TRANSPARENT TESTA GLABRA (TTG), GLABRA2
(GL2), and WERWOLF (WER), are involved in the
formation of the hairless cells, because all epidermal cells differentiate
into hair cells in the ttg, gl2 and wer mutants
(Fig. 1D)
(Galway et al., 1994
;
Masucci et al., 1996
;
Lee and Schiefelbein, 1999
).
GL2 encodes a homeodomain-leucine zipper (HD-Zip) protein that is
expressed preferentially in the differentiating hairless cells
(Masucci et al., 1996
;
Rerie et al., 1994
;
Di Cristina et al., 1996
).
TTG has been considered to encode a bHLH protein, because the
ttg mutation was complemented by the ectopic expression of a maize
gene, R, encoding a protein with a bHLH domain
(Lloyd et al., 1992
;
Galway et al., 1994
). However,
recent isolation of TTG has shown that it encodes a protein with a
WD40 motif (Walker et al.,
1999
). TTG may have a role in the expression of an
Arabidopsis R homolog. Involvement of the Arabidopsis R
homolog in the root epidermal cell fate determination is strongly suggested.
In contrast, specification of the hair cells was shown to be positively
controlled by CAPRICE (CPC), a gene encoding a small protein
of 94 amino acid residues with a Myb-like DNA-binding domain
(Wada et al., 1997
). The
loss-of-function mutant of CPC shows only a few normal-shaped root
hairs (Fig. 1C). Genetic
analysis of double mutants showed that CPC may act together with
TTG upstream of GL2 in the cell fate determination process
(Wada et al., 1997
). Unlike
other Myb proteins, CPC lacks a domain that activates transcription.
Therefore, CPC may work as a negative transcriptional regulator. These
previous results indicate that CPC functions as a negative regulator of
GL2, the latter promoting differentiation of the hairless cells, and
therefore CPC indirectly promotes differentiation of hair cells.
We have examined the expression pattern of CPC and GL2 in the root tissue of wild-type Arabidopsis by in situ hybridization and by analysis of transgenic plants carrying the promoter::GUS fusion genes in a series of mutants, and of several transgenic plants ectopically expressing the regulatory genes. In the wild-type plant, both CPC and GL2 were strongly expressed in the hairless cells. Interestingly, GL2 was expressed in the hair cells as well as in the hairless cells in the cpc mutant. The expression pattern and the hair-forming phenotype of the mutants and of the transgenic lines led us to examine the interaction of the regulatory proteins at the molecular level. Analysis of CPC promoter::CPC:GFP transgenic plants confirms that the CPC protein moves from the hairless cell to the hair-cell and induce root hair formation. Combining these results, we deduced a model explaining the regulatory interaction between transcription factors controlling the fate determination of the root epidermal cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of chimeric genes and transgenic plants
To make CPC promoter::GL2, we subcloned a 3.6 kb
HindIII fragment obtained from pg12gen into pBluescript SK+
(Stratagene). After digestion of this plasmid with NheI and
ApaI, the larger fragment was purified and ligated into the
XbaI and ApaI sites of CPC cDNA prepared from SK+CPC
(SK+GL2::CPC). The GL2::CPC region was removed with HindIII and
ApaI from SK+GL2::CPC and ligated into the HindIII and
SacI sites of a binary vector, pARK5. For 35S::RN construction, a
XbaI-Sse83871 fragment including the 5' UTR region and
the N-terminal region of R was ligated to a PstI and
EcoRV-digested fragment including the 3' UTR region of R, and
inserted into pBluescript SK+. This plasmid DNA was digested with
XbaI and HincII, and subcloned into the XbaI and
HpaI sites of pMAT137Hm (Matsuoka
and Nakamura, 1991
).
The GL2 promoter::GUS chimeric gene was constructed by ligation of
a XhoI-SalI fragment of 4 kb at the 5' upstream region
of GL2 into a SalI site of pBI101
(Masucci et al., 1996
;
Szymanski et al., 1998
). For
construction of the CPC promoter::GUS, a PstI-BbsI
fragment of 1.2 kb was blunted by T4 DNA polymerase and subcloned into a
SmaI site of pBI101-Hm3 (provided by H. Hirano and K. Nakamura,
Nagoya University, Nagoya, Japan) (Mita et
al., 1995
).
Binary plasmids were introduced into an Agrobacterium tumefaciens
strain C58::pGV2260 by electroporation using a Gene Pulser (Bio-Rad). Plant
transformation of Arabidopsis wild type (ecotype WS) was performed by
a vacuum infiltration procedure (Bechtold
et al., 1993
). Selection of transformants was performed on B5 agar
medium containing 20 mg/l hygromycin (Wako Junyaku, Osaka, Japan) or 50 mg/l
kanamycin.
The GL2::GUS and CPC::GUS constructs were introduced onto the various mutant backgrounds by crossing plants harboring the markers and analyzing F2 seedlings for homozygous mutants.
GUS staining
Samples of the transgenic plants were stained under vacuum in X-Gluc
solution containing 5.7 mM X-Gluc
(5-bromo-4-chloro-3-indolyl-ß-glucronide), 1.5 mM
K3Fe(CN)6, 1.5 mM K4Fe(CN)6, 50 mM
NaPi (pH 7.0), and 0.9% Triton X-100
(Jefferson et al., 1987
).
Stained roots were embedded in 5% low-melting point agarose (BRL) and
sectioned with a microslicer DTK-3000 (Dohann EM, Kyoto, Japan).
In situ hybridization
RNA probes used for detecting CPC transcripts in situ were prepared by PCR
using the following primers:
A PCR fragment (400 bp) was digested with HindIII and
EcoRI, and cloned into Bluescript SK+ (for use as a sense probe) or
into KS+ (for use as an antisense probe) (Stratagene). To prepare the
antisense and the sense probe, we linearized the plasmids with
HindIII or EcoRI, respectively, prior to adding them to the
in vitro transcription mixture (Trans Probe kit, Pharmacia) containing T3 RNA
polymerase and 35S-UTP. RNA probes for detection of GL2 transcripts
in situ were prepared as previously reported
(Masucci et al., 1996
;
Rerie et al., 1994
).
Tissue fixation in paraffin, hybridization and washing were carried out as
described elsewhere (Di Laurenzio et al.,
1996
; Drews et al.,
1991
). 10 µm thick transverse sections of roots and 8 µm
longitudinal sections were prepared. Slides were emulsion coated and exposed
for 5 weeks before development. The sections were observed under a Zeiss
Axiophot microscope.
Two-hybrid analysis
Vectors and yeast strains were obtained from Clonetech (MATCHMAKER
Two-Hybrid System). The plasmid carrying the various forms of truncated R were
prepared as follows:
A series of the CPC deletion constructs was prepared by PCR using primers below:
PCR was performed using Pfu DNA polymerase (Stratagene) and a combination of primers as follows: CPCN and CPCC for full-length CPC protein, CPCN and MybB for CPC of residues 1-83, MybF and CPCC for CPC of residues 33-94, and MybF and MybB for CPC of residues 33-88. The PCR-amplified fragments were digested with EcoRI and SalI and inserted into the EcoRI and SalI sites in pGAD424 or pGBT9. For preparation of CPC of residues 1-65, pGAD- full-length CPC was linearized by SmaI and SalI and self-ligated. To prepare CPC of residues 44-94, we digested pGAD- full-length CPC with BglII and SalI, and cloned the obtained fragment into the BamHI and XhoI sites of pGAD GL. To prepare CPC of residues 1-75, we subcloned into pGAD424 a PCR-amplified fragment from the cpc mutant using CPCN and a oligonucleotide corresponding to the T-DNA (5' CATAGTCGACTATCTCTCTATCTCC 3') as primers.
Plasmid DNAs used as positive controls, pVA3 and pTD1, which encode murine
p53/GAL4 and SV40 large T-antigen, respectively, were supplied from Clonetec.
Cultures of yeast strains SFY526 and HF7c were transformed with appropriate
plasmids using carrier DNA and the lithium acetate method. Then, the cells
were pelleted, resuspended in TE (Tris-EDTA) buffer, and spread on plates
containing SD synthetic medium (2% dextrose, 1x yeast nitrogen base)
lacking Trp and Leu. For the His requirement test, the yeast cells were
streaked on plates with SD synthetic medium lacking Trp, Leu and His and
containing the appropriate concentration of 3-amino-1, 2, 4-triazole (3-AT;
Sigma #A-8056). To assay ß-galactosidase activity, cells were grown in 2
ml of liquid SD medium lacking Leu and Trp until an
OD600=0.6
0.9 was obtained. The cells were collected and
resuspended in the reaction buffer containing ONPG (o-nitrophenyl
ß-D-galactopyranoside; Sigma #N-1127) as a substrate. After incubation,
the samples were centrifuged, and absorbance of the supernatant at 420 nm was
then measured.
In vitro binding analysis
R proteins were prepared by in vitro transcription/translation using a
system of TNT SP6-coupled rabbit reticulocyte lysate (Promega). R-coding
sequence that was cloned in an in vitro translation vector into pSPUTK
(Stratagene) (pSPUTK-R) (Symanski, 1998) was used as a template for synthesis
of intact R protein. The DNA template for the N-terminal region of R was
constructed by digesting pSPUTKR with MluI and ClaI and
purifying the larger fragment. This fragment was blunted by a Klenow fragment
and self-ligated. The self-ligation created a stop codon at the junction
between the R-coding sequence and the multiple cloning sites. The DNA template
for the C-terminal region of R was made by digesting pSPUTKR with
KasI and NcoI. After the ends had been blunted by a Klenow
fragment, the fragment was inserted into the NcoI and ClaI
sites of pSPUTK. The ligated DNA also created a stop codon, at the C terminus
of the inserted DNA.
The GST-CPC DNA was made by digesting pGAD424-CPC with EcoRI and SalI. The fragment was cloned into pGEX4T-1 (Pharmacia). The plasmid DNA was used to transform E. coli strain BL21 (DE3). After incubation of the transformed bacteria at 37°C for 3 hours, IPTG was added to a final concentration of 1 mM, and the incubation continued for 3 hours. The culture was harvested, and the GST-CPC protein was purified by passage through a glutathione-Sepharose (Pharmacia) column.
For in vitro association assay, appropriate aliquots of [35S]methionine-labeled R proteins were mixed with 2 µg of the purified GST-CPC protein or GST protein in 50 µl PBS and incubated for 1 hour at room temperature. Then, 30 µl of a 50% suspension of glutathione-Sepharose was added to the reaction mixture and gently agitated for 15 minutes. The protein complex bound to the resin was eluted with a solution of 10 mM reduced glutathione in 50 mM Tris-HCl (pH 8.0) after the resin had been washed three times with PBS. The eluted proteins were analyzed on a SDS-polyacrylamide gel.
GFP imaging of gene expression
To prepare the CPC promoter::GFP and CPC
promoter::CPC::GFP, the CPC promoter that was used
in CPC promoter::GUS construct, was combined with 2XrsGFP
(Crawford and Zambryski, 2000
)
(gift from Katrina Crawford). To prepare the CPC promoter::SV40
NLS:2X GFP, synthesized SV40 NLS sequence
(ATGCCTAAGAAGAAGCGTAAGGTCGAT) was inserted between the CPC promoter and 2XGFP
(Kalderon et al., 1984
).
Seedlings were incubated for 5 minutes in 5 µg/ml propidium iodide to stain the cell walls. GFP fluorescence was visualized in whole mount using a confocal laser scanning microscope (Zeiss LSM 5 Pascal) with the FITC channel (green, GFP) and the rhodamine channel (red, propidium iodide).
| RESULTS |
|---|
|
|
|---|
|
|
GL2, TTG and R are negative regulators of root hair development
In contrast to the cpc mutant, the gl2 and ttg
mutants formed root hairs in all epidermal cells, indicating that GL2
and TTG are required for generating the hairless cells
(Fig. 1D,
Fig. 2D,I) (Galway et al., 1994
;
Masucci et al., 1996
).
Formation of root hairs was reduced when the maize R gene was
introduced into wild-type Arabidopsis under the control of the 35S
promoter (Lloyd et al., 1992
;
Galway et al., 1994
)
(Fig. 2E,
Table 1). Formation of the
hairs was abolished when R was introduced into the ttg mutant, but
not when it was introduced into the gl2 mutant
(Galway et al., 1994
;
Hung et al., 1998
). These
results indicate that maize R is a strong negative regulator of root
hair development. The R gene encodes a protein of 610 amino acid
residues with a bHLH domain at the C terminus and an acidic region at the N
terminus (Fig. 5A)
(Ludwig et al., 1989
). bHLH
proteins are known to work as transcription factors. There are many genes
encoding bHLH proteins in plants, but, so far, only R has been reported to
complement the ttg mutation in formation of root hairs
(Lloyd et al., 1992
;
Galway et al., 1994
).
Therefore, some region outside the HLH domain of R is likely to be responsible
for the regulation of root hair development. In order to examine the function
of the N-terminal region of the R protein, we constructed transgenic plants
carrying a chimeric gene covering residues 1-298 driven by the 35S promoter.
Like the transgenic plants ectopically expressing the intact R protein, the
transgenic plants carrying the N-terminal region of R failed to form root
hairs (Fig. 2F,J,
Table 1). This result indicates
that the N-terminal region including an acidic domain is required for the
negative control of root hair development.
|
Expression pattern of CPC
Because the expression of CPC is required for the development of
the root hair cells, CPC was postulated to be expressed in the root
hair cells. The gene was also expected to be expressed in the cells at the
root tip, because root epidermal cells elongate and begin to differentiate
into the hair cells after dividing from the epidermal initial cells located at
the root meristem (Dolan et al.,
1994
; Galway et al.,
1994
).
In order to examine the type and position of cells expressing CPC, we
transformed wild-type plants with the GUS reporter gene driven by the
CPC promoter including an approximately 1.2 kb region upstream of the
initiation codon, the region sufficient to complement the cpc
mutation (Wada et al., 1997
).
Histochemical staining of the primary roots of the 5-day-old transgenic plants
showed vertical stripes of stained cells
(Fig. 3K). Epidermal cells in
the elongation zone were strongly stained, and cells in the division zone
below the elongation zone and cells that had shifted into the differentiation
zone were weakly stained. The blue stain was not observed in the root cap or
in cells in the fully differentiated regions. The longitudinal pattern of the
CPC expression is consistent with the model that CPC is
involved in the development of hair cells. In transverse sections, strong
stainign was observed in the hairless cells, and weak staining was seen in the
hair cells and in the stele cells (Fig.
3A). Cells of other tissues also were stained weakly. This result
was contrary to our expectation that CPC would be expressed in hair cells, but
not in the hairless cells. It is not clear whether the weak staining reflects
low-level expression, or diffusion from the neighboring strongly stained
cells.
|
The expression pattern of CPC was further confirmed by in situ hybridization with a probe of the CPC antisense RNA corresponding to the 5' UTR and the coding region. Although the probe included the Myb region, genomic Southern blots with this probe showed no extra bands in addition to the fragments encoding CPC, even after washing under moderately stringent conditions, showing that the signal obtained in the in situ hybridization may not have included any `noise' originating from transcripts of other Myb genes. The results of the in situ hybridization were clear: a strong signal was detected in hairless cells, but not in hair-forming cells and other cells (Fig. 4D), confirming the results of the CPC promoter::GUS staining. In situ hybridization experiments using longitudinal sections also confirmed that CPC mRNA had accumulated in the epidermal cells (data not shown). Weak signals were observed in root hair cells and other types of cells. In situ hybridization experiments using the sense strand of CPC as a control showed no significant signals (Fig. 4N).
|
For the purpose of analyzing the expression pattern of CPC on a
series of mutant backgrounds, we crossed the CPC
promoter::GUS plants with various root-hair mutants. In the
ttg mutant, GUS staining was not detected in the epidermal cells, but
weak GUS expression was observed in the stele
(Fig. 3C). Also in situ
hybridization experiment did not reveal any significant signals in the
transverse sections of primary root of the ttg mutant
(Fig. 4F). The results indicate
that TTG positively controls the expression of CPC in the
epidermal cells, but is possibly not involved in expression in the stele
cells. In plants overexpressing R, strong GUS expression was observed
in almost all cells (Fig. 3D).
Staining was not found to be stronger in any particular files. In addition,
GUS expression was observed in cells of columella and lateral root cap, except
the two columella cell layers at the top
(Fig. 3M). The in situ
hybridization experiments also showed uniform CPC RNA accumulation in
longitudinal sections of the primary root overexpressing R (data not shown).
These results indicate that R functions as a positive regulator of
CPC. In the other mutant with ectopic root hairs, gl2, the
expression pattern of CPC was essentially the same as that in the
wild type, as shown by in situ hybridization
(Fig. 4E). The results
confirmed our previous conclusion obtained from double mutant analysis
(Wada et al., 1997
), that
GL2 acts downstream of CPC. Interestingly, the level of
CPC promoter::GUS expression was dramatically enhanced in
the cpc mutant background in all epidermal cells
(Fig. 3B). In contrast,
expression of the CPC promoter::GUS gene was repressed in
epidermal cells when CPC was overexpressed under the 35S
promoter (Fig. 3L). These
results indicate the presence of a self-regulation system for CPC
expression; namely, its expression is promoted in the absence of CPC,
but it is repressed by overexpression.
ctr1 and rhd6 are known to control the hormone-dependent
formation of root hairs (Dolan et al.,
1994
; Kieber et al.,
1993
; Masucci and
Schiefelbein, 1994
), and in plants mutant for these genes the
pattern of CPC expression was found to be the same as that of wild
type (Fig. 3E,F), indicating
that CTR1 and RHD6 work downstream of CPC.
Expression pattern of GL2
Previous studies using the promoter-GUS analysis indicated that
GL2 is expressed in hairless cells but not in hair-forming cells of
wild-type roots (Masucci et al.,
1996
). Our observations using GL2::GUS gene expression
and in situ hybridization with the GL2 probe confirmed this. In
transverse sections, GL2 was expressed preferentially in the hairless
cells (Fig. 3G), a pattern
consistent with the model that GL2 is a negative regulator of root
hair development. GL2 was expressed in the cells of the elongation
zone, but the expression level was gradually decreased as cells entered the
differentiation zone, and the expression was hardly detected in cells that had
initiated root hair formation (Fig.
3N). The pattern of GL2 expression was confirmed by in situ
hybridization. As shown in Fig.
4J, the GL2 mRNA was localized in the hairless epidermal
cells. Expression of GL2 overlapped that of CPC, but the
amount of the GL2 message appeared to be higher than that of
CPC. In addition, unlike CPC, expression of GL2 was
not detected in the stele cells.
Previous analysis of double mutants showed that the gl2 mutation
is epistatic to the cpc mutation in the developmental pathway of
epidermal cell differentiation (Wada et
al., 1997
). In order to study the regulatory network, we examined
the expression pattern of GL2 on various mutant backgrounds. The
GL2 promoter::GUS gene was shown to be expressed in almost
all epidermal cells in the cpc mutant
(Fig. 3H). In situ
hybridization also clearly demonstrated that the GL2 expression was
permitted in the hair cells at the same level as that in the hairless cell
(Fig. 4K). This result strongly
suggests that CPC represses GL2 expression. This
interpretation was also confirmed by the drastic reduction of the
GL2::GUS expression observed in roots of the 35S::CPC
transgenic plants overexpressing CPC
(Fig. 3O).
In the ttg mutant, a reduction in GL2 expression was
observed by GL2 promoter::GUS and in situ hybridization
experiments (Fig. 3I, Fig. 4L). The results are
consistent with the reported model that GL2 is positively controlled
by TTG (Hung et al.,
1998
). In contrast, GL2 expression was enhanced in
transgenic plants overexpressing R
(Fig. 3J,P), indicating that
R is a positive regulator of GL2. The in situ hybridization
experiment also showed that GL2 RNA was observed throughout the
epidermis in the 35S::R transgenic plant (data not shown).
The CPC promoter can be replaced by the GL2
promoter
Because the expression patterns of GL2 and CPC are
similar in wild type, several mutants and in a transgenic background, the two
genes are likely to be regulated by some common mechanism. In order to confirm
that the regulatory system works similarly, we tested whether the GL2
promoter could replace the CPC promoter. When a chimeric gene, GL2
promoter::CPC, was introduced into the cpc mutant, the
transgenic plants showed the normal pattern of root hairs
(Fig. 2G,K,
Table 1). This confirms that
the CPC and GL2 genes are controlled by similar regulatory
circuits and that the GL2 promoter has sufficient activity to support
the spatial and temporal expression of CPC. In addition, it is likely
that the expression of CPC in the stele cells does not contribute to
the normal pattern of root hair development, because the GL2 promoter
did not support the expression in the stele cells.
CPC protein binds to the N-terminal region of R protein
The promoter::GUS expression as well as the in situ hybridization
experiments revealed that expression of GL2 is negatively controlled
by CPC, and positively regulated by TTG and R. Root
hair formation was abolished in transgenic plants ectopically expressing the
N-terminal region of R lacking the HLH region
(Fig. 2F,J,
Table 1). This result suggests
that the CPC protein might interact with the N-terminal region of R.
As a first approach to show the interaction between R and CPC, we employed the yeast two-hybrid analysis using the GAL4 protein-fusion system. CPC was conjugated to the GAL4 transcriptional activation domain (GAL4-AD), and assayed for its ability to bind various constructs of R fused to the GAL4 DNA binding domain (GAL4-BD). As shown in Fig. 5B, CPC interacted with residues 1-525 and residues 1-371 of R to a similar degree. However, CPC interacted with residues 372-525 of R at a very low level, similar to that with the negative controls. A domain-swapping experiment showed that residues 1-371 of R conjugated to GAL4-AD strongly interacted with CPC fused to GAL4-BD. The strength of the interaction between CPC and R was strong, about twice that of the positive control between the large T-antigen and p53. These results indicate that CPC bound to the N-terminal half of R (residues 1-371), but not to the C-terminal half (residues 372-525), which includes the HLH region.
In order to identify further the interacting domain of R, we conjugated a series of R deletions to the GAL-AD, and examined their ability to bind to CPC fused to the GAL4-BD (Fig. 5C). The results indicated that the truncated R deleted of residues 1-371, 1-312 or 1-298 interacted with CPC to about the same degree as the intact R. The strength of interaction between CPC and R truncated of residues 1-291, 1-244 or 1-239 was low; about one-tenth that of R deleted of residues 1-371. R deleted of residues 1-206 did not show any detectable interaction with CPC. Although residues 23-298 of R interacted with CPC, residues 30-298 did not. The results indicate that CPC binds to the N-terminal region of R covering residues 23-298 and that the HLH domain is not required for the binding.
A series of truncated CPC proteins were combined with GAL4-AD, and tested
for their ability to bind to the N-terminal region of R (residues 1-371). CPC
was separated into the N-terminal region, residues 1-32, the Myb-homologous
region, residues 33-83, and the C-terminal region, residues 84-94
(Fig. 5A). As shown in
Fig. 5D, residues 1-83, 33-94
and 33-83 of CPC, interacted with R to about the same degree as intact CPC
(residues 1-94). However, residues 1-75, 1-65, and 44-94 of CPC of showed no
interaction with R. It is worth noting that the cpc mutant is thought
to express residues 1-75 of the CPC protein
(Wada et al., 1997
). These
results show that the Myb-homologous domain of CPC, residues 33-83, is
sufficient for binding to R.
As a second approach to show the interaction between CPC and R, we used an in vitro binding assay. The CPC construct fused to glutathione S-transferase (GST) was expressed in E. coli cells. Three R proteins, intact R and R truncated of residues 1-312 or 372-525, were labeled with [35S]methionine by use of an in vitro transcription/translation system, which revealed 64 kDa, 34 kDa and 17 kDa products, respectively (Fig. 6, lanes 1-3). The R proteins were incubated with the GST-CPC fusion protein, and the complex was coprecipitated with glutathione-Sepharose. As a negative control, the R proteins were incubated with GST (Fig. 6, lanes 7-9). Intact R and R deleted of residues 1-312 were coprecipitated with CPC (Fig. 6, lanes 4,5). However, residues 372-525 of R showed no significant association with CPC (Fig. 6, lane 6). These results confirm the conclusion drawn from the two-hybrid analysis showing that CPC binds to the N-terminal region of R.
|
Localization of the CPC protein
CPC was predominately expressed in the hairless cell
(Fig. 3A,K,
Fig. 4D). In the cpc
mutant, root-hair cells were converted into hairless cells
(Wada et al., 1997
). To
examine the localization of the CPC protein, we made a DNA construct of a
CPC-GFP fusion protein (Crawford and
Zambryski, 2000
). In CPC promoter::GFP
transgenic plants, GFP fluorescence was observed mainly in the cytoplasm of
hairless cells. This pattern is the same as that of CPC
promoter::GUS (Fig.
7A). However, GFP fluorescence was observed in the nuclei of all
root epidermal cells in CPC promoter::CPC:GFP
protein::2XrsGFPs transgenic plants (Fig.
7B). To avoid the possibility that targeting the GFP protein into
the nucleus simply increase the sensitivity of the assay, we produced
transgenic plants harboring CPC promoter::NLS:GFP. We
observed GFP fluorescence in the nucleus of hairless cells, but not of hair
cells (Fig. 7C).
|
In situ hybridization showed that CPC RNA also localizes in hairless cells (Fig. 4D). These results indicate that CPC protein is translated in hairless cells, and it then moves into the hair cells, where it represses GL2 transcription.
| DISCUSSION |
|---|
|
|
|---|
A series of genetic analyses showed that GL2 functions downstream
of the other regulators. Phenotype analysis of double mutants suggested that
CPC acts upstream of GL2 in the regulatory process of root
hair development because the double mutant showed ectopic root hairs similar
to the gl2 single mutant (Wada et
al., 1997
). TTG and the R homolog are also
considered to act upstream of GL2, because ectopic expression of
maize R complemented the ttg mutation, but not the
gl2 mutation (Galway et al.,
1994
; Hung et al.,
1998
). This result suggests that the R homolog mediates a
regulatory process between TTG and GL2. In addition, the
pattern of root hair development in the cpc ttg double mutant
suggested that CPC and TTG may act together
(Wada et al., 1997
). These
results suggest a genetic model in which GL2 is a key regulator
controlling the development of hairless cells: i.e. TTG and the
R homolog work as negative regulators of root hair development by
promoting GL2, and CPC serves as a positive regulator by
repressing GL2.
Expression pattern of GL2 supports the genetic model
Staining of the GL2::GUS construct and in situ hybridization using
the GL2 gene as a probe clearly demonstrated that the expression of
GL2 was promoted by TTG and R, but repressed by
CPC. In wild-type roots, GL2 was preferentially expressed in
the hairless cells (Fig. 3G,N,
Fig. 4J)
(Masucci et al., 1996
),
consistent with the model that GL2 is a negative regulator of hair
development. The ttg mutation repressed GL2 expression in
both the hairless and hair cells (Fig.
3I, Fig. 4L),
whereas ectopic expression of R induced GL2 expression in
all the epidermal cells (Fig.
3J,P). These results confirm that both TTG and R
promote GL2 expression (Hung et
al., 1998
). The cpc mutation also induced the expression
of GL2 in the hairforming cells as well as in the hairless cells, as
clearly shown by both in situ hybridization and GL2::GUS analysis
(Fig. 3H,
Fig. 4K). In contrast, ectopic
expression of CPC repressed GL2 expression in epidermal
cells (Fig. 3O). Another Myb
gene, WER, is expressed in hairless cells
(Lee and Schiefelbein, 1999
).
GL2::GUS expression has been shown to be reduced in wer-1
mutants (Lee and Schiefelbein,
1999
). These results support the genetic model that CPC
represses GL2 expression and WER activates GL2
expression.
Expression of CPC is under several regulatory controls
Unlike GL2, the expression pattern of CPC did not
correlate with its site of action. First, CPC promoter::GUS
staining and in situ hybridization showed that CPC was strongly
expressed in the hairless cells (Fig.
3A,K, Fig. 4D).
Weak GUS staining was observed in the hair cells, but this was not clear from
the in situ hybridization using the CPC gene as a probe. The results
of CPC promoter::NLS:GFP expression indicate that CPC is not
expressed in the hair cell. The weak GUS staining in the hair cell may
represent diffusion from the strongly stained hairless cells. Second,
CPC expression was observed in stele cells as well as in epidermal
cells. CPC expression in the stele cells was shown not to be involved
in the normal root hair patterning, because the cpc mutation was
complemented by transforming the GL2::CPC gene
(Fig. 2G,K,
Table 1). Third, the data
suggested that a self-repression system is at work in the expression of
CPC. When the CPC::GUS gene was introduced into the
cpc mutant, a high level of GUS staining was observed
(Fig. 3B), but GUS staining was
detected at a low level when the CPC::GUS gene was introduced in
transgenic plants carrying the 35S::CPC gene
(Fig. 3L).
The expression pattern of CPC::GUS was not changed in rhd6,
ctr1 mutants (Fig. 3E,F),
or wild-type seedlings treated with an ethylene precursor ACC
(1-amino-cyclopropane-1-carboxylic acid) or an ethylene synthesis inhibitor,
AVG (aminoethoxyvinylglycine) (data not shown). Similarly, the expression
pattern of GL2::GUS was not affected in axr2, rhd6 or
ctr1 mutants or by treatment with ACC or AVG
(Masucci and Schiefelbein,
1996
). These results suggest that the steps controlled by plant
hormones lie downstream of those where CPC and GL2 act in
the process of root hair patterning.
CPC and GL2 expression have similar controls
Although the genetic roles of CPC and GL2 are opposite,
the expression pattern of the two genes in different mutant or transgenic
backgrounds revealed that both genes have similar controls. Expression of both
genes is promoted by TTG and R, but repressed by
CPC. The almost identical patterns of expression indicate that the
promoter region of the two genes share common cis elements responsive
to the regulator proteins.
This notion was supported by the promoter substitution experiment. When a chimeric gene of GL2 promoter::CPC was introduced into the cpc mutant, the transgenic plants showed normal pattern of root hairs. A detailed analysis of the CPC promoter and comparison with the GL2 promoter will be necessary to clarify the regulatory mechanism.
Role of the CPC and R complex
CPC is a small protein carrying a Myb domain but no other domains that
might activate transcription. The Myb region is known to be a DNA binding
motif in mammals and plants, and also to be a protein-protein interaction
domain in plants (Goff et al.,
1991
; Goff et al.,
1992
; Szymanski et al.,
1998
). The two-hybrid assay in yeast cells and the direct
coprecipitation experiment showed that the Myb region of the CPC protein
interacts with the N-terminal region of R. This is supported by reports that
two plant Myb proteins carrying a transcriptional activation domain, maize C1
and Arabidopsis GL1, interact with R and promote the expression of
anthocyanin biosynthesis genes and GL2, respectively
(Goff et al., 1991
;
Goff et al., 1992
;
Larkin et al., 1994
;
Szymanski et al., 1998
).
WER, another Myb homolog controlling root-hair differentiation, also
interacts with R in yeast (Lee and
Schiefelbein, 1999
).
In a dominant inhibitor allele of maize C1, C1-I, asparate (D) at position
101 was changed to glutamate (E) in a dominant inhibitor allele of c1, C1-I
(Paz-Arez et al., 1990
).
C1:D101E was able to interact with the maize Myc gene, B
(Goff et al., 1992
). In
contrast, C1:D101E was not able to bind a1 promoter, which is one of the
enzymes involved in anthocyanin biosynthesis
(Sainz et al., 1997
). These
two results lead to the prediction that C1:D101E is a DNA binding mutant. The
amino acid in CPC corresponding to position 101 in C1 is proline. Therefore,
the CPC Myb domain is thought to act only as a protein-protein interaction
region.
It is important to identify the functional homolog of R in
Arabidopsis that forms a complex with the CPC protein to regulate
root-hair differentiation. There are several Myc-like genes in
Arabidopsis (Abe et al.,
1997
; de Pater et al.,
1997
; Urao et al.,
1996
). Further analysis is required for determining the true
functional R homolog involved in root hair development.
Model of root hair development
Based on the results presented here and previous reports on the regulation
of the root hair development, we propose a model explaining the patterning of
hair-forming cells and hairless cells. The hairless cells express
GL2, which leads to the repression of the formation of root hairs.
GL2 expression is induced by the transcriptional activation function
of the R homolog and repressed by CPC. The expression of CPC and the
R homolog in the hairless cells could be induced by TTG, whereas in
hair cells, the expression of GL2 is repressed. Because the
repression in hair cells is lost in the cpc mutant, the CPC protein
synthesized in hairless cells is postulated to be responsible for the
repression. Our results from CPC promoter::GFP transgenic
plants suggested that the repression can be explained as follows. CPC mRNA and
possibly the protein are synthesized abundantly in hairless cells and then
transferred to the neighboring hair cells where CPC protein represses GL2
expression. NLS:GFP data confirm that the CPC protein moves from the hairless
cell to the hair cell.
In 35S::CPC transgenic plants, the high-level expression of CPC produces free CPC proteins that could repress GL2 expression in both hairless cells and hair cells. Repression of GL2 would induce root hair formation in both types of epidermal cells. When 35S::R is introduced into wild type cells, the large amount of R may promote expression of both CPC and GL2. In transgenic plants expressing the N-terminal region of R, truncated R would quench the free CPC protein by forming a complex with it. The reduction in the level of free CPC would help the endogenous R homolog and activate the expression of GL2.
The initial step in the differentiation of the two types of cells might be the perception of some positional information related to the arrangement of the cortical cells underneath the epidermis. Although the molecular nature of this information is not known, it could be postulated that it induces the expression of TTG in the hairless cells, which leads to the differentiation and maintenance of the two types of cells. This idea could be tested by examining the expression pattern of TTG.
A maize homeobox protein, KNOTTED1, that controls leaf formation was shown
to move from inner cells to the epidermal cells possibly through plasmodesmata
(Lucas et al., 1995
).
Recently, an Arabidopsis protein, SHORTROOT, was shown to move from
stele cells to the surrounding endodermis cells, possibly through
plasmodesmata (Nakajima et al.,
2001
). Because the CPC protein is small, it may be transferred
through such structures.
Root hair development is parallel to trichome development
Recent genetic and molecular analyses have revealed that the initial step
in the development of trichomes, which are branched, outgrowths of epidermal
cells on the surface of leaves and stems, is controlled by a genetic mechanism
similar to that operating in root hair development. The gl2 mutant
forms a few non-branched trichomes
(Koornneef et al., 1982
), and
the ttg mutant fails to form trichomes
(Koornneef, 1981
). The mutant
phenotypes indicate that both GL2 and TTG act as positive
regulators of the trichome development. Expression of the maize R
gene in the ttg mutant induced trichome formation
(Lloyd et al., 1992
). The
genetic complementation of the ttg mutation by R strongly
indicates that some R homolog(s) of Arabidopsis are working in the
process of trichome development, too. Recently, GLABRA3
(GL3) was shown to encode a bHLH protein
(Payne et al., 2000
). GL3
interacts with the N-terminal portion of GL1 in yeast
(Payne et al., 2000
). In
addition, formation of the trichome-forming cells is also positively
controlled by GL1, a gene encoding a Myb domain and an acidic region
(Oppenheimer et al., 1991
).
Plants that ectopically express both GL1 and R initiate ectopic trichomes
(Larkin et al., 1994
).
GL2::GUS analysis indicated that GL2::GUS expression is
reduced in mature leaves of gl1 and ttg mutants and strong
and ectopic expression of GL2::GUS resulted in ectopic expression of
both GL1 and R (Szymanski et al.,
1998
). These results are interpreted to indicate that GL1
and GL3 cooperatively promote the expression of GL2 and that
GL2 initiates the trichome development.
As shown above, CPC protein is likely to be a repressor of GL2
expression, because this protein does not have an activation domain. This
notion is supported by the phenotypes of 35S::CPC transgenic plants
that failed to develop trichomes on leaves and stems
(Wada et al., 1997
), possibly
because overexpression of CPC protein in the trichome-forming epidermal cells
competitively blocked the action of the GL1 protein, and repressed the
expression of GL2. The similarity between the genetic control of root
hair development and that of the trichomes may indicate that the two processes
are derived from a basic cell differentiation process that accompanies
oriented cell growth.
This study showed that interaction of a set of transcription factors determines the initial step in cell differentiation. It strongly suggests that a signaling between neighboring cells is important in the process. The genetic regulatory system of root hair development appears to be a good model system of cell differentiation in plants.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abe, H., Yamaguchi-Shinozaki, K., Urao, T., Iwasaki, T., Hosokawa, D. and Shinozaki, K. (1997). Role of arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression. Plant Cell 9,1859 -1868.[Abstract]
Bechtold, N., Ellis, J. and Pelletier, G. (1993). In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. C. R. Acad. Sci. Paris 316,1194 -1199.
Crawford, K. M. and Zambryski, P. C. (2000). Subcellular localization determines the availability of non-targeted proteins to plasmodesmatal transport. Curr. Biol. 10,1032 -1040.[CrossRef][Medline]
Berger, F., Haseloff, J., Schiefelbein, J. and Dolan, L. (1998). Positional information in root epidermis is defined during embryogenesis and acts in domains with strict boundaries. Curr. Biol. 8,421 -430.[CrossRef][Medline]
de Pater, S., Pham, K., Memelink, J. and Kijne, J. (1997). RAP-1 is an Arabidopsis MYC-like R protein homologue, that binds to G- box sequence motifs. Plant Mol. Biol. 34,169 -174.[CrossRef][Medline]
Di Cristina, M., Sessa, G., Dolan, L., Linstead, P., Baima, S., Ruberti, I. and Morelli, G. (1996). The Arabidopsis Athb-10 (GLABRA2) is an HD-Zip protein required for regulation of root hair development. Plant J. 10,393 -402.[CrossRef][Medline]
Di Laurenzio, L., Wysocka-Diller, J., Malamy, J. E., Pysh, L., Helariutta, Y., Freshour, G., Hahn, M. G., Feldmann, K. A. and Benfey, P. N. (1996). The SCARECROW gene regulates an asymmetric cell division that is essential for generating the radial organization of the Arabidopsis root. Cell 86,423 -433.[CrossRef][Medline]
Dolan, L., Duckett, M. D., Grierson, C., Linstead, P.,
Schneider, K., Lawson, E., Dean, C., Poethig, S. and Roberts, K.
(1994). Clonal relationships and cell patterning in the root
epidermis of Arabidopsis. Development
120,2465
-2474.
Drews, G. N., Bowman, J. L. and Meyerowitz, E. M. (1991). Negative regulation of the Arabidopsis homeotic gene AGAMOUS by the APETALA2 product. Cell 65,991 -1002.[CrossRef][Medline]
Galway, M. E., Masucci, J. D., Lloyd, A. M., Walbot, V., Davis, R. W. and Schiefelbein, J. W. (1994). The TTG gene is required to specify epidermal cell fate and cell patterning in the Arabidopsis root. Dev. Biol. 166,740 -754.[CrossRef][Medline]
Goff, S. A., Cone, K. C. and Fromm, M. E.
(1991). Identification of functional domains in the maize
transcriptional activator C1: comparison of wild-type and dominant inhibitor
proteins. Genes Dev. 5,298
-309.
Goff, S. A., Cone, K. C. and Chandler, V. L.
(1992). Functional analysis of the transcriptional activator
encoded by the maize B gene: evidence for a direct functional interaction
between two classes of regulatory proteins. Genes Dev.
6, 864-875.
Hung, C. Y., Lin, Y., Zhang, M., Pollock, S., Marks, M. D. and
Schiefelbein, J. (1998). A common position-dependent
mechanism controls cell-type patterning and GLABRA2 regulation in the root and
hypocotyl epidermis of Arabidopsis. Plant Physiol.
117, 73-84.
Jefferson, R. A., Kavanagh, T. A. and Bevan, M. W. (1987). GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6,3901 -3907.[Medline]
Kalderon, D., Roberts, B. L., Richardson, W. D. and Smith, A. E. (1984). A short amino acid sequence able to specify nuclear location. Cell 39,499 -509.[CrossRef][Medline]
Kieber, J. J., Rothenberg, M., Roman, G., Feldmann, K. A. and Ecker, J. R. (1993). CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinase. Cell 72,427 -441.[CrossRef][Medline]
Koornneef, M. (1981). The complex syndrome of the ttg mutants. Arabid. Inform. Serv. 18, 45-51.
Koornneef, M., Dellaert, L. W. and van der Veen, J. H. (1982). EMS- and radiation-induced mutation frequencies at individual loci in Arabidopsis thaliana (L.) Heynh. Mutat Res 93,109 -123.[Medline]
Larkin, J. C., Oppenheimer, D. G., Lloyd, A. M., Paparozzi, E. T. and Marks, M. D. (1994). Roles of the GLABROUS1 and TRANSPARENT TESTA GLABRA genes in Arabidopsis trichome development. Plant Cell 6,1065 -1076.[Abstract]
Lee, M. M. and Schiefelbein, J. (1999). WERWOLF, a MYB-related protein in Arabidopsis, is a position-dependent regulator of epidermal cell patterning. Cell 99,473 -483.[CrossRef][Medline]
Lloyd, A. M., Walbot, V. and Davis, R. W.
(1992). Arabidopsis and Nicotiana anthocyanin
production activated by regulators R and C1. Science
258,1773
-1775.
Lucas, W. J., Bouche-Pillon, S., Jackson, D. P., Nguyen, L.,
Baker, L., Ding, B. and Hake, S. (1995). Selective
trafficking of KNOTTED1 homeodomain protein and its mRNA through
plasmodesmata. Science
270,1980
-1983.
Ludwig, S. R., Habera, L. F., Dellaporta, S. L. and Wessler, S.
R. (1989). Lc, a member of the maize R gene family
responsible for tissue-specific anthocyanin production, encodes a similar to
transcriptional activators and contains and contains the myc-homology region.
Proc. Natl. Acad. Sci. USA
86,7092
-7096.
Masucci, J. D. and Schiefelbein, J. W. (1994). The rhd6 mutation of Arabidopsis thaliana alters root-hair initiation through an auxin- and etylene-associated process. Plant Physiol. 106,1335 -1346.[Abstract]
Masucci, J. D., Rerie, W. G., Foreman, D. R., Zhang, M., Galway, M. E., Marks, M. D. and Schiefelbein, J. W. (1996). The homeobox gene GLABRA2 is required for position-dependent cell differentiation in the root epidermis of Arabidopsis thaliana.Development 122,1253 -1260.[Abstract]
Masucci, J. D. and Schiefelbein, J. W. (1996). Hormones act downstream of TTG and GL2 to promote root hair outgrowth during epidermis development in the Arabidopsis root. Plant Cell 8,1505 -1517.[Abstract]
Matsuoka, K. and Nakamura, K. (1991).
Propeptide of a precursor to a plant vacuolar protein required for vacuolar
targeting. Proc. Natl. Acad. Sci. USA
88,834
-838.
Mita, S., Suzuki-Fujii, K. and Nakamura, K. (1995). Sugar-inducible expression of a gene for beta-amylase in Arabidopsis thaliana. Plant Physiol. 107,895 -904.[Abstract]
Nakajima, K., Sena, G., Nawy, T. and Benfey, P. N. (2001). Intercellular movement of the putative transcription factor SHR in root patterning. Nature 413,307 -311.[CrossRef][Medline]
Okada, K. and Shimura, Y. (1990). Revesible
root tip rotation in Arabidopsis seedlings induced by
obstacle-touching stimulus. Science
250,274
-276.
Oppenheimer, D. G., Herman, P. L., Sivakumaran, S., Esch, J. and Marks, M. D. (1991). A myb gene required for leaf trichome differentiation in Arabidopsis is expressed in stipules. Cell 67,483 -493.[CrossRef][Medline]
Payne, C. T., Zhang, F. and Lloyd, A. M.
(2000). GL3 encodes a bHLH protein that regulates trichome
development in Arabidopsis through interaction with GL1 and TTG1.
Genetics 156,1349
-1362.
Paz-Arez, J., Ghosal, D. and Seadler, H. (1990). Molecular analysis of the C1-I allele from Zea mays: a dominant mutant of the regulatory C1 locus. EMBO J. 9, 315-321.[Medline]
Rerie, W. G., Feldmann, K. A. and Marks, M. D.
(1994). The GLABRA2 gene encodes a homeo domain protein required
for normal trichome development in Arabidopsis. Genes
Dev. 8,1388
-1399.
Sainz, M. B., Grotewold, E. and Chandler, V. L. (1997). Evidence for direct activation of an anthocyanin promoter by the maize C1 protein and comparison of DNA binding by related Myb domain proteins. Plant Cell 9,611 -625.[Abstract]
Szymanski, D. B., Jilk, R. A., Pollock, S. M. and Marks, M. D. (1998). Control of GL2 expression in Arabidopsis leaves and trichomes. Development 125,1161 -1171.[Abstract]
Urao, T., Yamaguchi-Shinozaki, K., Mitsukawa, N., Shibata, D. and Shinozaki, K. (1996). Molecular cloning and characterization of a gene that encodes a MYC- related protein in Arabidopsis. Plant Mol. Biol. 32,571 -576.[CrossRef][Medline]
Wada, T., Tachibana, T., Shimura, Y. and Okada, K.
(1997). Epidermal cell differentiation in Arabidopsis
determined by a Myb homolog, CPC. Science
277,1113
-1116.
Walker, A. R., Davison, P. A., Bolognesi-Winfield, A. C., James,
C. M., Srinivasan, N., Blundell, T. L., Esch, J. J., Marks, M. D. and Gray, J.
C. (1999). The TRANSPARENT TESTA GLABRA1 locus, which
regulates trichome differentiation and anthocyanin biosynthesis in
Arabidopsis, encodes a WD40 repeat protein. Plant Cell
11,1337
-1350.
This article has been cited by other articles:
![]() |
H.-F. Zhu, K. Fitzsimmons, A. Khandelwal, and R. G. Kranz CPC, a Single-Repeat R3 MYB, Is a Negative Regulator of Anthocyanin Biosynthesis in Arabidopsis Mol Plant, June 2, 2009; (2009) ssp030v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Schiefelbein, S.-H. Kwak, Y. Wieckowski, C. Barron, and A. Bruex The gene regulatory network for root epidermal cell-type pattern formation in Arabidopsis J. Exp. Bot., April 1, 2009; 60(5): 1515 - 1521. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. H. Kang, V. Kirik, M. Hulskamp, K. H. Nam, K. Hagely, M. M. Lee, and J. Schiefelbein The MYB23 Gene Provides a Positive Feedback Loop for Cell Fate Specification in the Arabidopsis Root Epidermis PLANT CELL, April 1, 2009; 21(4): 1080 - 1094. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yoshida, R. Sano, T. Wada, J. Takabayashi, and K. Okada Jasmonic acid control of GLABRA3 links inducible defense and trichome patterning in Arabidopsis Development, March 15, 2009; 136(6): 1039 - 1048. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Li, O. N. Milliken, H. Pham, R. Seyit, R. Napoli, J. Preston, A. M. Koltunow, and R. W. Parish The Arabidopsis MYB5 Transcription Factor Regulates Mucilage Synthesis, Seed Coat Development, and Trichome Morphogenesis PLANT CELL, January 1, 2009; 21(1): 72 - 89. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wang and J.-G. Chen Arabidopsis Transient Expression Analysis Reveals that Activation of GLABRA2 May Require Concurrent Binding of GLABRA1 and GLABRA3 to the Promoter of GLABRA2 Plant Cell Physiol., December 1, 2008; 49(12): 1792 - 1804. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zhao, K. Morohashi, G. Hatlestad, E. Grotewold, and A. Lloyd The TTG1-bHLH-MYB complex controls trichome cell fate and patterning through direct targeting of regulatory loci Development, June 1, 2008; 135(11): 1991 - 1999. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Tominaga, M. Iwata, R. Sano, K. Inoue, K. Okada, and T. Wada Arabidopsis CAPRICE-LIKE MYB 3 (CPL3) controls endoreduplication and flowering development in addition to trichome and root hair formation Development, April 1, 2008; 135(7): 1335 - 1345. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wang, S.-H. Kwak, Q. Zeng, B. E. Ellis, X.-Y. Chen, J. Schiefelbein, and J.-G. Chen TRICHOMELESS1 regulates trichome patterning by suppressing GLABRA1 in Arabidopsis Development, November 1, 2007; 134(21): 3873 - 3882. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Morohashi, M. Zhao, M. Yang, B. Read, A. Lloyd, R. Lamb, and E. Grotewold Participation of the Arabidopsis bHLH Factor GL3 in Trichome Initiation Regulatory Events Plant Physiology, November 1, 2007; 145(3): 736 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ishida, S. Hattori, R. Sano, K. Inoue, Y. Shirano, H. Hayashi, D. Shibata, S. Sato, T. Kato, S. Tabata, et al. Arabidopsis TRANSPARENT TESTA GLABRA2 Is Directly Regulated by R2R3 MYB Transcription Factors and Is Involved in Regulation of GLABRA2 Transcription in Epidermal Differentiation PLANT CELL, August 1, 2007; 19(8): 2531 - 2543. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Tominaga, M. Iwata, K. Okada, and T. Wada Functional Analysis of the Epidermal-Specific MYB Genes CAPRICE and WEREWOLF in Arabidopsis PLANT CELL, July 1, 2007; 19(7): 2264 - 2277. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Jakoby, C. Weinl, S. Pusch, S. J.H. Kuijt, T. Merkle, N. Dissmeyer, and A. Schnittger Analysis of the Subcellular Localization, Function, and Proteolytic Control of the Arabidopsis Cyclin-Dependent Kinase Inhibitor ICK1/KRP1 Plant Physiology, August 1, 2006; 141(4): 1293 - 1305. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kwasniewski and I. Szarejko Molecular Cloning and Characterization of beta-Expansin Gene Related to Root Hair Formation in Barley Plant Physiology, July 1, 2006; 141(3): 1149 - 1158. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Lee, J. Colinas, J. Y. Wang, D. Mace, U. Ohler, and P. N. Benfey Transcriptional and posttranscriptional regulation of transcription factor expression in Arabidopsis roots PNAS, April 11, 2006; 103(15): 6055 - 6060. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Dolan Positional information and mobile transcriptional regulators determine cell pattern in the Arabidopsis root epidermis J. Exp. Bot., January 1, 2006; 57(1): 51 - 54. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kurata, T. Ishida, C. Kawabata-Awai, M. Noguchi, S. Hattori, R. Sano, R. Nagasaka, R. Tominaga, Y. Koshino-Kimura, T. Kato, et al. Cell-to-cell movement of the CAPRICE protein in Arabidopsis root epidermal cell differentiation Development, December 15, 2005; 132(24): 5387 - 5398. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. I. Prokhnevsky, V. V. Peremyslov, and V. V. Dolja Actin Cytoskeleton Is Involved in Targeting of a Viral Hsp70 Homolog to the Cell Periphery J. Virol., November 15, 2005; 79(22): 14421 - 14428. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. H. Ryu, Y. H. Kang, Y.-h. Park, I. Hwang, J. Schiefelbein, and M. M. Lee The WEREWOLF MYB protein directly regulates CAPRICE transcription during cell fate specification in the Arabidopsis root epidermis Development, November 1, 2005; 132(21): 4765 - 4775. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-R. Xu, C. Liu, Y.-L. Wang, L.-C. Li, W.-Q. Chen, Z.-H. Xu, and S.-N. Bai Histone acetylation affects expression of cellular patterning genes in the Arabidopsis root epidermis PNAS, October 4, 2005; 102(40): 14469 - 14474. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Lee, K.-i. Taoka, B.-C. Yoo, G. Ben-Nissan, D.-J. Kim, and W. J. Lucas Plasmodesmal-Associated Protein Kinase in Tobacco and Arabidopsis Recognizes a Subset of Non-Cell-Autonomous Proteins PLANT CELL, October 1, 2005; 17(10): 2817 - 2831. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Serna Epidermal cell patterning and differentiation throughout the apical-basal axis of the seedling J. Exp. Bot., August 1, 2005; 56(418): 1983 - 1989. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Koshino-Kimura, T. Wada, T. Tachibana, R. Tsugeki, S. Ishiguro, and K. Okada Regulation of CAPRICE Transcription by MYB Proteins for Root Epidermis Differentiation in Arabidopsis Plant Cell Physiol., June 1, 2005; 46(6): 817 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Corley, R. Carpenter, L. Copsey, and E. Coen Floral asymmetry involves an interplay between TCP and MYB transcription factors in Antirrhinum PNAS, April 5, 2005; 102(14): 5068 - 5073. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Kim, Y. Rim, J. Wang, and D. Jackson A novel cell-to-cell trafficking assay indicates that the KNOX homeodomain is necessary and sufficient for intercellular protein and mRNA trafficking Genes & Dev., April 1, 2005; 19(7): 788 - 793. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Kwak, R. Shen, and J. Schiefelbein Positional Signaling Mediated by a Receptor-like Kinase in Arabidopsis Science, February 18, 2005; 307(5712): 1111 - 1113. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kim, E. Cho, K. Crawford, F. D. Hempel, and P. C. Zambryski Cell-to-cell movement of GFP during embryogenesis and early seedling development in Arabidopsis PNAS, February 8, 2005; 102(6): 2227 - 2231. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Gallagher and P. N. Benfey Not just another hole in the wall: understanding intercellular protein trafficking Genes & Dev., January 15, 2005; 19(2): 189 - 195. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bernhardt, M. Zhao, A. Gonzalez, A. Lloyd, and J. Schiefelbein The bHLH genes GL3 and EGL3 participate in an intercellular regulatory circuit that controls cell patterning in the Arabidopsis root epidermis Development, January 15, 2005; 132(2): 291 - 298. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Dolan and J. A. Langdale New insights into plant development in New England Development, November 1, 2004; 131(21): 5215 - 5220. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Montiel, P. Gantet, C. Jay-Allemand, and C. Breton Transcription Factor Networks. Pathways to the Knowledge of Root Development Plant Physiology, November 1, 2004; 136(3): 3478 - 3485. [Full Text] [PDF] |
||||
![]() |
L. Serna A Network of Interacting Factors Triggering Different Cell Fates PLANT CELL, September 1, 2004; 16(9): 2258 - 2263. [Full Text] [PDF] |
||||
![]() |
S. Wang, J.-W. Wang, N. Yu, C.-H. Li, B. Luo, J.-Y. Gou, L.-J. Wang, and X.-Y. Chen Control of Plant Trichome Development by a Cotton Fiber MYB Gene PLANT CELL, September 1, 2004; 16(9): 2323 - 2334. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-C. Yoo, F. Kragler, E. Varkonyi-Gasic, V. Haywood, S. Archer-Evans, Y. M. Lee, T. J. Lough, and W. J. Lucas A Systemic Small RNA Signaling System in Plants PLANT CELL, August 1, 2004; 16(8): 1979 - 2000. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sena, J. W. Jung, and P. N. Benfey A broad competence to respond to SHORT ROOT revealed by tissue-specific ectopic expression Development, June 15, 2004; 131(12): 2817 - 2826. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Muller and W. Schmidt Environmentally Induced Plasticity of Root Hair Development in Arabidopsis Plant Physiology, January 1, 2004; 134(1): 409 - 419. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bernhardt, M. M. Lee, A. Gonzalez, F. Zhang, A. Lloyd, and J. Schiefelbein The bHLH genes GLABRA3 (GL3) andENHANCER OF GLABRA3 (EGL3) specify epidermal cell fate in the Arabidopsis root Development, December 29, 2003; 130(26): 6431 - 6439. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Esch, M. Chen, M. Sanders, M. Hillestad, S. Ndkium, B. Idelkope, J. Neizer, and M. D. Marks A contradictory GLABRA3 allele helps define gene interactions controlling trichome development in Arabidopsis Development, December 15, 2003; 130(24): 5885 - 5894. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Zhang, A. Gonzalez, M. Zhao, C. T. Payne, and A. Lloyd A network of redundant bHLH proteins functions in all TTG1-dependent pathways of Arabidopsis Development, October 15, 2003; 130(20): 4859 - 4869. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Costa and L. Dolan Epidermal patterning genes are active during embryogenesis in Arabidopsis Development, July 1, 2003; 130(13): 2893 - 2901. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||