|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00148

1 Centre de Génétique Moléculaire et Cellulaire, CNRS
UMR-5534, Université Claude Bernard Lyon-1, 69622 Villeurbanne,
France
2 Department of Neurobiology and Behavior, The State University of New York at
Stony Brook, Stony Brook, New York 11794, USA
3 Karolinska Institute, Department of Biosciences, Södertörn
University College, Section of Natural Sciences, S-14189 Huddinge,
Sweden
Author for correspondence (e-mail:
durand-b{at}univ-lyon1.fr)
Accepted 3 September 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Ciliated sensory neuron, RFX, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
Cilia are found in most eukaryotes except for fungi and higher plants. They
are distinguished by an axoneme, a radially symmetric cytoskeleton of nine
microtubule doublets and associated structures, enclosed in an extension of
the plasma membrane. The presence or absence of a central microtubule pair
classifies cilia into two types. Those with a central pair (9+2 configuration)
usually have a propulsive function, while those without a central microtubule
pair (9+0 configuration) are found on many animal cell types, where they are
known as `primary' cilia. Some 9+0 cilia [e.g. those on the mammalian
embryonic node (Nonaka et al.,
1998
)], move with a circular, whirling motion. Sensory cilia are
derived from primary cilia and have been modified to varying degrees; most are
probably non-motile.
The importance of cilia for sensory transduction has been demonstrated in
the nematode C. elegans, in which mutations affecting ciliary
structure have been isolated in screens for a variety of sensory defects.
These include defective osmotic avoidance (Osm), chemotaxis
(Che), dauer formation (Daf) as well as defective
fluorescent dye uptake (Dyf) and poor male mating behavior
(Perkins et al., 1986
;
Starich et al., 1995
).
In Drosophila, nonvisual sensory perception relies on two major
classes of sense organs. Type I organs or sensilla include one or more neurons
and several support cells that construct specialized sensory structures such
as bristles. They include the olfactory and mechanosensory bristles, as well
as chordotonal organs (internally located stretch receptors that transduce
auditory or proprioceptive stimuli). Each neuron in a type I organ bears a
single sensory dendrite with a modified cilium. Type II sense organs are
multidendritic neurons that lack cilia and specialized support cells. Their
sensitivities are not known, but they also have been suggested to function as
proprioceptors or mechanoreceptors (Jan
and Jan, 1993
).
Several mutants affecting sensory perception by type I sensilla have been
isolated in Drosophila in screens for loss of mechanosensation
(Kernan et al., 1994
),
audition (Eberl et al., 2000
)
or olfaction (Shiraiwa et al.,
2000
). Those that have been molecularly characterized include
nompC, which encodes a member of the TRP channel superfamily
(Walker et al., 2000
), and
nompA, a component of the dendritic cap that ensheaths the sensory
cilium (Chung et al., 2001
). In
nompA mutants, defects in mechanosensory behavior and
electrophysiology are associated with disconnection of dendritic caps from the
sensory cilia (Chung et al.,
2001
). Two other mutants specifically affecting chordotonal
organs, btv and tilB, have axonemal defects illustrating the
importance of axoneme integrity for chordotonal organ function
(Eberl et al., 2000
).
Structural components of cilia such as tubulins, tektins and axonemal
dynein subunits have mostly been isolated from the single-celled alga
Chlamydomonas reinhardtii and from sea urchin
(Dutcher, 1995
;
Stephens, 1995
) but are well
highly conserved in other phyla. An intraflagellar transport (IFT) mechanism
required for ciliary assembly is also widely conserved
(Kozminski et al., 1993
;
Rosenbaum et al., 1999
). Best
characterized in Chlamydomonas, IFT is a rapid movement of particles
along the axonemal microtubules of cilia and flagella. Although many
individual proteins involved in cilium architecture and IFT are well
described, factors that regulate and coordinate their expression are poorly
understood. In C. elegans, one such factor is DAF-19, a member of the
RFX family of transcription factors. Loss of function daf-19
mutations result in the absence of cilia in sensory neurons, the only type of
ciliated structures present in the nematode
(Swoboda et al., 2000
). DAF-19
regulates several genes required for normal sensory cilium formation,
including components of the intraflagellar transport complex: che-2,
osm-1, osm-5 and osm-6
(Haycraft et al., 2001
;
Qin et al., 2001
;
Swoboda et al., 2000
).
RFX transcription factors are defined by a 76 amino acid DNA-binding domain
with a characteristic wing-helix structure
(Reith et al., 1990
;
Emery et al., 1996
;
Gajiwala et al., 2000
). The
yeasts S. pombe and S. cerevisiae each have a single RFX
factor (Huang et al., 1998
;
Wu and McLeod, 1995
), while
five RFX proteins have been identified in mammals
(Emery et al., 1996
;
Morotomi-Yano et al., 2002
).
Mammalian RFX5 is essential for the transcription of MHC class II genes in the
immune response (for a review, see Reith
and Mach, 2001
), but little is known about the cellular functions
of the other mammalian RFX proteins. Two Rfx genes can be identified in
Drosophila (Durand et al.,
2000
) (FlyBase:
http://flybase.harvard.edu:7081/).
Rfx is homologous to daf-19 and to mammalian Rfx1,
Rfx2 and Rfx3, whereas the second gene shares conserved motifs
with Rfx5, the most divergent mammalian Rfx (A. L., unpublished).
Rfx is expressed in the peripheral nervous system (PNS), in the brain
and in the testis during Drosophila development
(Vandaele et al., 2001
).
We report the isolation and characterization of two Rfx alleles. We show that Rfx mutants have defects in chemosensory and mechanosensory behaviors and in mechanosensory electrophysiology. Remarkably, cellular and ultrastructural analysis demonstrate that loss of Rfx is associated with a severe disorganization of the cilia at the tip of the sensory neuron dendrites. These results identify Rfx as an essential regulator of sensory cilium morphogenesis in Drosophila.
| MATERIALS AND METHODS |
|---|
|
|
|---|
2-3}99B
were crossed with TM3,
ryRKSb1Ser1/TM6B,Tb1 and
(ry-) male progeny were selected. Southern blot
hybridization and PCR were performed to determine breakpoints for each
selected line. For EMS mutagenesis, isogenized
st1esca1 males were fed with 25 mM
EMS in 1% sucrose for 16 hours. EMS solution was then replaced by 1% sucrose
for 72 hours and males were mated with TM2,Ubx/TM6,SbTb females.
Single F1 individuals were crossed to
Rfx49/TM6,SbTb and mutagenized chromosomes were selected
based on lethal or un-coordination phenotypes over Rfx49.
Among 1000 individual crosses, a newly isolated allele
Rfx253 did not complement Rfx49 for
lethality.
Df(3R)hth (Rieckhof et al.,
1997
) chromosome was characterized by in situ hybridization
performed on salivary glands from Df(3R)hth/TM2 individuals. PCR
analysis was performed to show that S143702
(Deak et al., 1997
) is a
deficiency uncovering jumu and Rfx coding sequences.
S143702 homozygous embryos were isolated from w;
l(3)S143702/TM3,
P{w+=GAL4-Kr}P{w+=UAS-GFP.S65T},Sb1
stock. DNA was extracted from pools of three embryos and PCR reactions were
performed with the following primers: ATCTAACAGCAGCGCCACTT;
CGACGGGACCACCTTATGTTATTTCATCATG; CGCCGGAATTCATCCTCTCG; TGTCATGACATCCTCCAGTG;
CAAATTTGCCAATCATGTCG and ATTTCCCAAACGTCTGTTCG.
Complementation analysis shows stich1D233,
stich1EP0359 and S143702 to be allelic to
jumu6439, a hypomorphic mutation of the jumu gene
(Cheah et al., 2000
;
Strodicke et al., 2000
).
S143702 is also allelic to Rfx49 in agreement
with its molecular characterization. The P insertion line l(3)06142
complements both Df(3R)hth and S143702 leading to the
conclusion that the lethal mutation on this chromosome maps outside the
85F-86C region, as previously hypothesized
(Strodicke et al., 2000
).
All stocks described were obtained from the Bloomington stock center,
Indiana, with the exception of Df(3R)hth (a gift from R. Mann) and
sca109-68 (a gift from J. M. Dura). Drosophila
were grown on David's axenic food at 25°C
(David, 1962
).
Rfx rescue
The complete Rfx 3.9kb cDNA
(Durand et al., 2000
) was
cloned in pUAST vector and subsequently injected in flies, as described
(Spradling, 1986
). Both GAL4
drivers, P{GawB}elavC155 and
P{GAL4}sca109-68, which express the protein in the entire
nervous system (Luo et al.,
1994
) and in the peripheral nervous system
(Guo et al., 1996
),
respectively, were used to rescue mutant phenotypes. Crosses were performed
between stocks ywP{GawB}elavC155/FM7,w;
sr1Rfx253esca1/TM6,HuTb
or P{GAL4}sca109-68;
sr1Rfx253es ca1/TM6,HuTb
and w;
P{w+=UAS-Rfx}178/CyO;Rfx49/TM6,HuTb.
Rescued flies show a complete reversal of the uncoordinated phenotype and
normal viability and reversal of the mutant phenotype was analyzed for the
dendrite morphology by GFP labeling in adult legs and wings. Other phenotypes
were not analyzed.
Sequencing and electromobility shift assay (EMSA)
Genomic DNA from Rfx253 flies was sequenced with primer
sets covering all 11 Rfx exons by automatic sequencing using a
MegaBACE sequencing facility. The Rfx253 mutation, a C to
T transition at position 1899 of published sequence (EMBL Accession Number,
AJ133103) changing a Ser to a Phe, was introduced into Rfx cDNA in pBluescript
with QuickchangeTM procedure (Stratagene). RFX253 or RFX
protein was produced by in vitro transcription and translation. EMSA was
performed as previously described (Durand
et al., 2000
).
Sensory perception assay
Olfactory and gustatory tests were performed essentially as described by
Heimbeck et al. (Heimbeck et al.,
1999
). Larvae were selected on their Tubby (Tb)
phenotype from appropriate crosses involving Rfx-/TM6BTb
heterozygotes. Each assays was performed with approximately 30 larvae. Amounts
of olfactants placed on a small filter discs were 1 µl undiluted butanol
(Merk 9630) or 2 µl of undiluted n-octyl-acetate (Sigma O-0504).
We calculated a response index (RI)=Ns-Nc/Ns+Nc. Ns represents the number of
animals less than 30 mm from the odor source. Nc is the number of larvae found
in an identical surface on the opposite (control) side. Positive RI indicate
attraction. Negative RI indicate avoidance, and RI=0 indicates an indifferent
behavior. For gustatory assays, petri dishes were divided in four quadrants
filled with 1% agarose with a defined content of NaCl. The response index was
calculated as RI=Ns-Nc/Ns+Nc, where Ns is the number of larvae on the high
NaCl (1 M) quadrants and Nc is the number of larvae on the control (no NaCl)
quadrants. Phototaxis assays were performed as described by Lilly and Carlson
(Lilly and Carlson, 1990
).
Response index was calculated as RI=Nd-Nl/Nd+Nl, where Nl is the number of
larvae in the light quadrants and Nd number of larvae in the dark quadrants.
Significance of behavioral differences was assayed with nonparametric
Mann-Whitney U tests (Mann and Whitney,
1947
) and data are available upon request.
Electrophysiological recordings
Transepithelial mechanoreceptor potentials (TEP) and currents were recorded
from single macrochaete bristles. Decapitated flies were mounted between 24
and 48 hours after eclosion as described
(Walker et al., 2000
). All
recordings were performed on the posterior dorsocentral (pDC) and anterior
scutellar (aSC) bristles on the dorsal thorax. Voltage and current signals
were amplified (EPC7 amplifier; Heka Elektronik, Lambrecht, Germany) in
current-clamp and voltage-clamp mode, respectively, and data were sampled at 5
kHz with an InstruNet 100 analog-to-digital converter and Superscope II
software (GW Instruments, Somerville, MA). The reference ground was an Ag/AgCl
wire inserted in the abdomen; zero potential was determined by placing the
recording pipette in the thorax prior to recording from bristles. Bristles
were mechanically stimulated with a 10 µm, 1.5 second ramp-and-hold
displacement, generated by a piezoelectric actuator (PZS-100HS, Burleigh
Instruments) on which the recording pipette was mounted. Mechanoreceptor
potential (MRP) amplitude was calculated as the difference between the TEP
just before the stimulus onset and the minimum TEP value reached during the
stimulus. The transepithelial series resistance was calculated from the
steady-state current resulting from a 10 mV step command applied to the
recording pipette in voltage-clamp mode.
Sound-elicited potentials were recorded from the antennal nerve with
tungsten electrodes inserted between the first and second antennal segments
and in the head capsule as previously described
(Eberl et al., 2000
). Sound
stimuli were generated and delivered as described
(Eberl at al., 2000
). They
approximated the pulse phase of Drosophila courtship song and
consisted of brief pulses of a 500 Hz carrier frequency repeated at 35
mseconds intervals.
Dendrite observation
For embryonic PNS observation, Rfx-/TM2,
P{ry+=ftz-lacZ} stocks were used to differentiate mutant from
heterozygous embryos based on their ß-galactosidase staining [mouse
anti-ß-galactosidase (Promega; code Z3781)]. Mouse anti-22C10
(Zipursky et al., 1984
)
(kindly provided by S. Benzer) and affinity purified rabbit anti-HRP (Jackson
Immunoresearch Laboratories; code 323-005-021) both at dilution 1:3000 were
used. Antibodies were revealed with the Vectastain ABC kit for Nomarski
observation or with Alexa Fluor® 546 goat anti-rabbit IgG and Alexa
Fluor® 488 goat anti-mouse IgG (Molecular Probes) for confocal microscopy
analysis.
To visualize GFP-expressing neurons, wP{GawB}elavC155P{w+=UAS-mCD8:GFP}.LL4; Rfx-/TM6B stocks were used. Wing campaniform sensilla were observed from adult wings fixed 15 minutes in 5% formaldehyde and observed under epifluorescence (Zeiss Axoplan). The femoral chordotonal groups were observed in dissected legs from 72-hour-old pupae, fixed for 15 minutes in 5% formaldehyde and imaged by confocal microscopy (Zeiss LSM510).
Electron microscopy
Antennae were dissected in PBS and immediately fixed in 2% glutaraldehyde,
0.5% paraformaldehyde and 0.1 M Na-cacodylate (pH 7.4) for 48 hours. After
extensive washing in sodium cacodylate 0.15 M (pH 7.4), antennae were stained
in 1% OsO4 for 4 hours, and dehydrated through ethanol series and
propylene oxide. Antennae were embedded in Spurr medium (Fluka). Ultrafine
sections were cut on a Leica ultramicrotome. Sectioned materials were
contrasted in Leica ultrastainer in alcoholic uranyl acetate and lead
citrate.
| RESULTS |
|---|
|
|
|---|
|
|
A P-element inserted 5' of Rfx (A143.1F3) was
mobilized to generate more aberrations affecting the Rfx locus
(Fig. 1A). Several chromosomes
were selected by molecular screening, including Rfx49, a
small deficiency uncovering the 5' end of Rfx
(Fig. 1A). Molecular
characterization of Rfx49 breakpoints revealed that the
deletion does not uncover the adjacent jumu gene. Indeed,
Rfx49 complements the lethal phenotype of all
jumu lethal alleles tested (Table
1). Moreover, no RFX immunostaining was found in the peripheral
nervous system (PNS) of Rfx49 mutant embryos (data not
shown) compared with wild-type embryos
(Vandaele et al., 2001
).
Complementation analysis with Rfx49 and Df(3R)hth chromosomes identifies two complementation groups in the 86A1-2 region that we define as jumu and Rfx (Table 1). Our analysis shows that all stich1 alleles fail to complement jumu loss of function alleles. We also showed by PCR analysis that S143702 is actually a deficiency uncovering both jumu and Rfx loci (data not shown, see Materials and Methods). All together these results imply that stich1 mutations affect the jumu gene but not CG17100.
The more distal breakpoint of Rfx49 maps 100 bp
upstream of the 5' end of CG17100. It is therefore theoretically
possible that Rfx49 also affects this gene. We thus
undertook an EMS non-complementation screen to isolate other Rfx
alleles (see Materials and Methods) and isolated the
Rfx253 chromosome, which defines the same complementation
group as Rfx49 (Table
1). Sequencing analysis revealed a mutation causing an amino acid
substitution, S435F, in the DNA-binding domain
(Fig. 1C). Serine at position
65 of the DBD is replaced by a phenylalanine. Remarkably, the mutated serine
is absolutely conserved in all RFX proteins described from yeast to mammals
(Fig. 1C) and, in a
crystallographic structure of the mammalian RFX1 DBD, is located in the `wing'
loop that mediates most DNA contacts
(Gajiwala et al., 2000
). We
confirmed by electromobility shift assay that Rfx253 is no
longer able to bind its target sequence
(Fig. 1D). Thus, based on its
lack of DNA binding, Rfx253 represents a hypomorphic or
null allele of Rfx.
Rfx larvae are insensitive to chemical or odorant
stimuli
Under standard rearing conditions, most Rfx49 and
Rfx253 homozygotes die as larvae. Mutant pupae could not
be observed on the walls of the culture vials, regardless of allelic
combination. However, in uncrowded conditions, a small proportion of
homozygous pupae were detected on vials, indicating that a few larvae can
pupate. Approximately 15% of first instar larvae give rise to pupae. Mutant
larvae lag their heterologous siblings by more than 3 days in development to
pupae. Close observation of larvae show a peculiar foraging behavior with weak
food digging efficiency. This could result from an altered peripheral
sensitivity, a hypothesis that was suggested by the fact that Rfx is
expressed in sensory neurons during embryogenesis (Vandaele et al., 2000). We
thus decided to investigate the gustatory and olfactory-driven behavior of
mutant larvae.
An olfactory test was performed using two pure odors (butanol and
n-octyl-acetate) that induce characteristic attractive and repulsive
responses (reviewed in Cobb,
1999
). Whereas control larvae responded efficiently, mutant larvae
showed no sensitivity to either odor (Fig.
2A). We also assayed repulsion by high NaCl concentrations: while
control larvae are repulsed by concentrated salt, mutant larvae do not avoid
this medium (Fig. 2B), showing
that Rfx mutant larvae are defective in gustatory chemotaxis as well.
To demonstrate that these responses are not due to a defect in the larval
motility, we tested phototaxis behavior
(Fig. 2C). This is based on our
finding that Rfx is not expressed in the Bolwig organs, the larval
visual system (Vandaele et al.,
2001
). Rfx mutant larvae should therefore not be affected
in visual perception. This was clearly demonstrated by the phototaxis
behavioral assay as shown in Fig.
2C. The phototaxis behaviors of Rfx mutant and control
larvae were found to be identical, demonstrating that Rfx mutants are
not affected in their capacity to move. These data lead to the conclusion that
Rfx is necessary for olfactory and gustatory perception in
Drosophila larvae.
|
Rfx adults have an uncoordinated phenotype and do not
transduce mechanosensory stimuli
Emerging adults are not able to walk and fly and thus stick to the medium
and cannot be retrieved in culture vials. In order to recover adult mutants,
third instar larvae and pupae were selected and raised until hatching on wet
filter paper. The 15 to 30% of Rfx49/Rfx253 or
S143702/Rfx253 adults that emerge from pupae, all present
a characteristic uncoordinated phenotype. Mutant flies cannot stand or walk:
legs are crossed and wings are held up. However, mutants do react to light
stimulation by moving legs and wings in an effort to right themselves and
walk, but uncoordination limits their movement to a few steps or a flip from
one side to another. This transient activity indicates that general
neuromuscular excitability is retained. To ascertain that Rfx is
responsible for the observed phenotype, an Rfx cDNA was expressed in
all neurons in Rfx49/Rfx253 mutants. We found
that the transgene expression indeed completely rescued the
Rfx49/Rfx253 uncoordinated and low viability
phenotypes.
The uncoordination of Rfx mutant flies is similar to the phenotype
of mutants with defects in mechanosensory transduction
(Kernan et al., 1994
). Type I
external mechanosensory bristles include three support cells and one neuron
(Fig. 3A). The innermost
support cell (sheath cell) forms a tubular extension around the sensory
process and produces an extracellular dendritic cap that covers the cilium tip
(Keil, 1997
). The two outer
support cells (shaft and socket cells) construct the cuticular bristle socket
and shaft and in mature organ generate the receptor lymph. To test if
Rfx mutants also have defects in mechanosensory bristle
electrophysiology, transepithelial potentials (TEPs) and currents were
recorded from macrochaete bristles (Fig.
3A). Unstimulated wild-type bristles have a positive TEP, due to
electrogenic K+ transport by sensory support cells into the
restricted apical extracellular space. This creates the electrical driving
force for a receptor current that is triggered by bristle deflection: current
flows from the apical extracellular space into the sensory neuron, reducing
the TEP and depolarizing the neuron so that it fires a series of action
potentials (Thurm and Kuppers,
1980
) (Fig. 3B,C). The response adapts to a sustained deflection.
|
The average resting TEP in Rfx mutants (12±9 mV) is
significantly lower than in their heterozygous sibs (61±4 mV), although
the mutant and control distributions overlapped
(Fig. 3C,E). More strikingly,
no mechanically elicited changes in TEP were detected in any Rfx
mutant bristle, even in bristles with TEP in the normal range
(Fig. 3D). Holding the TEP
constant while stimulating the bristle enables a mechanoreceptor current to be
recorded (Walker et al., 2000
)
(Fig. 3F,G). No receptor
currents were elicited by mechanical stimulation in Rfx mutants, even
when the TEP was clamped at a large positive value (+100 mV; data not shown).
Finally, no action potentials were observed in mutant neurons. Thus, the adult
uncoordination phenotype probably reflects a failure of bristle
mechanotransduction. Maintenance of the TEP requires both active ion transport
by sensory support cells, and high cuticular and transepithelial resistance.
The resistance at Rfx mutant bristles was found to be, on average,
one-third that at control bristles (Fig.
3H), suggesting some reduction in the integrity of the
intercellular junctions connecting the neuron and the surrounding support
cells.
Most mechanosensory mutations affect chordotonal organs as well as bristles
(Eberl et al., 2000
).
Chordotonal organs are type I stretch receptors that transduce proprioceptive
and auditory stimuli. To test chordotonal organ operation, extracellular
sound-elicited potentials were recorded from the antennal nerve projecting
from the auditory chordotonal organs (Johnston's organ,
Fig. 3I) in wild-type and
mutant antennae. Johnston's organ comprises over 100 individual sensory units
or scolopidia located in the second antennal segment, which normally respond
when distal antennal segments are vibrated by near-field sound
(Eberl et al., 2000
). A series
of sound pulses elicited a corresponding response from
Rfx49/TM6B heterozygotes, but
Rfx49/Rfx253 mutants showed no response to
stimuli of the same or greater amplitude, indicating a complete loss of
auditory chordotonal organ function (Fig.
3J).
Taken together, the broad spectrum of behavioral and electrophysiological defects suggested that all type I organs are affected in Rfx mutants. This idea was further pursued by light and electron microscopy.
Type I sensory dendrite morphogenesis is affected in Rfx
mutants
To examine the morphology of sensory neurons in Rfx mutants, we
used a series of molecular markers for the peripheral nervous system (PNS).
With the 22C10 antibody, which stains a microtubule-associated protein in all
sensory neurons, we observed no differences in number and position of sensory
neurons between mutant and wild-type embryos
(Fig. 4A,B). By contrast, the
anti-HRP antibody, which stains all neuron surfaces in wild-type embryos,
revealed a very weak staining of the PNS in the mutant embryos regardless of
the Rfx allelic combination used
(Fig. 4C,D). An identical weak
anti-HRP staining of sensory neurons was also reported for S143702
embryos (Prokopenko et al.,
2000
) but not for the other stich1 mutants, confirming
that this phenotype is specifically due to loss of Rfx function.
|
Anti-HRP staining in mutant embryos was, however, strong enough to visualize a specific dendrite defect, particularly visible in the lateral chordotonal organ clusters (1ch5). Indeed, this array of chordotonal organs is disorganized in Rfx embryos. Most dendrites are shorter, and vary in length within a cluster (Fig. 4E-H). The cilia present in wild type (Fig. 4C,E) or control (Fig. 4G) embryos were always either shorter or missing in Rfx mutants (Fig. 4F,H).
To visualize neuronal dendrites in more detail, we engineered mutant flies expressing a membrane-localized GFP in all neurons. We focused on two types of adult sensory organs: campaniform sensilla of the wing and chordotonal organs of the femur.
Campaniform sensilla of the wing are composed of a single neuron and three accessory cells. The neuronal cell body and the dendrite are situated in the same focal plane and are thus easily visible when marked with GFP. The cilium at the tip of the dendrite is located exactly under the dome-shaped sensilla in wild-type (not shown) or in rescued wings (Fig. 5A-B). In Rfx mutant wings, the dendrite does not reach the dome and the cilium is either absent, or shorter (Fig. 5C-E).
|
In the femoral chordotonal organ, each scolopidium is innervated by two
ciliated neurons. Instead of external cuticular structures, a rigid scolopale
structure encloses the ciliary outer segments. By confocal microscopy analysis
of GFP distribution, three ciliary regions can be distinguished, which
correlate with an ultrastuctural organization previously described by
transmission electron microscopy (Uga and
Kuwabara, 1965
). These are: the axoneme, the ciliary dilation and
the tubular body enclosing the tubular bundle (a dense array of microtubules).
These subregions are clearly distinguished in control or rescued Rfx
mutant flies (Fig. 5F-I). By
contrast, the cilium is always shorter
(Fig. 5J-L) and even absent
(Fig. 5K,L) in mutant flies.
When present, no clear cilium subregions can be distinguished indicating that
its architecture is very disorganized. Moreover the inner dendritic segment
appears swollen (Fig. 5J-L,
arrowheads). These defects were specifically rescued when the Rfx
cDNA was expressed in all neurons thus demonstrating that Rfx
expression in the neuron is necessary for differentiation of the ciliated
sensory ending in adult sense organs.
No organized ciliated structures can be observed in type I neurons of
Rfx mutants
Investigation of the ultrastructure of sensitive neurons was carried out on
the Johnston's organ in the second antennal segment. Each scolopidium of the
Johnston's organ includes two neurons, a scolopale cell and an elongated
conical dendritic cap that encloses the distal tips of the two cilia
(Fig. 6A). The tips of a pair
of cilia are attached via an extracellular cap to a distal attachment cell
(cap cell), and their bases are anchored within the neurons by a long axial
filament that extends through the neuronal dendrites and cell bodies.
Cross-sections performed at different proximodistal positions reveal the three
different typical ultrastructural subregions of chordotonal cilia
(Fig. 6A). The sensory cilium
is composed of 9+0 microtubule doublets. The ciliary dilation contains a
paracrystalline inclusion and the tubular body is composed of microtubule
arrays that are not assembled in a stereotyped fashion as in the cilium. The
two cilia are surrounded by electron dense structures (scolopale rods)
produced by the scolopale cell. The cilium at the tip of the dendrite contacts
an extracellular matrix (dendritic cap).
|
Examination of sectioned antennae of Rfx mutants by light microscopy showed no gross defects in Johnston's organ, but the ultrastructure of individual scolopidia was profoundly altered. Sections of several scolopidia at different proximodistal positions (Fig. 6B,C) clearly show the 9+0 axonemal structure in wild-type antennae, but no axoneme profiles were found in serial sections of Rfx253/Rfx49 antennae (compare Fig. 6B,D with 6C,E). In longitudinal sections the anchoring axial filament could be clearly observed in wild type (Fig. 6I), but not in mutant scolopidia (Fig. 6J). Its absence indicates that Rfx mutant defects extend beyond the cilium proper and affect associated structures in the neuron. In addition, a non-neuronal defect was noted: the electron dense scolopale rods enclosing the cilium are not as regularly arrayed as in wild-type flies (Fig. 6B,C). By contrast, the dendritic cap, also produced by the scolopale cell appears equally well organized in wild type and in Rfx mutants (Fig. 6F-H). These results demonstrate that Rfx is necessary for proper cilium assembly in chordotonal organs.
| DISCUSSION |
|---|
|
|
|---|
We demonstrate that Rfx function in ciliated sensory neurons is essential for the proper signaling in type I sensory organs. Rfx mutant larvae have severe chemosensory and olfactory defects. These sensory defects could explain their peculiar, potentially insufficient foraging and feeding behavior, and could thus be responsible for major developmental delays, leading to lethality at significant frequencies. Moreover, consistent with their adult uncoordinated phenotype, Rfx mutant bristles show clear electrophysiological defects: they are completely unable to generate mechanoreceptor potentials or currents. The reductions in resting transepithelial potentials and transepithelial resistance are not sufficient to explain the complete loss of transduction, as mutants with TEPs in the normal range still showed no receptor current, and receptor currents could not be restored by voltage clamping the TEP at wild-type levels. Although recordings were limited to mechanosensory macrochaete bristles, the combination of mechanosensory and chemosensory behavioral phenotypes suggests a global defect in type I sense organ function, consistent with the pattern of Rfx expression.
Remarkably, we show that sensory defects are correlated with abnormal morphogenesis of the dendrite, which affects primarily the organization of its ciliated sensory endings. Indeed Rfx mutants show sensory dendrites that have severe cilium defects in femoral chordotonal organs as well as wing campaniform sensilla. This probably reflects a general defect in cilium assembly, as both the proximal and the distal parts of the organelle are disorganized: that is both rootlet apparatus and axonemal structures are absent from scolopidia in Rfx mutant antennae as observed by electron microscopy. All together, our observations show that the dendrite cilium is required for signal transduction in these neurons.
Mutant sensory defects are not restricted to the cilium
The observed mutant sensory defects are probably not restricted to only
cilium disorganization. Indeed, electron microscopy reveals that the scolopale
cell of chordotonal organs is also modified in the mutant antennae: the
scolopale rods and membranes are disorganized compared with wild type. A
similar effect on the sheath cell (the homolog of the scolopale cell in
bristle organs) and other supporting cells could underlie the reduced
epithelial resistance and TEP observed in Rfx mutant bristles.
Rfx is expressed as early as the first neural precursor and is
maintained throughout successive asymmetric division in the type I neuron
lineage. Rfx is transiently expressed in the accessory scolopale cell
(Vandaele et al., 2001
). It
could thus be necessary for proper accessory cell differentiation and in
particular for cell junction formation between these cells.
Another observation suggesting that mutant defects are probably not
exclusively restricted to the cilium is the reduced anti-HRP staining in
mutant embryos. Anti-HRP has been shown to bind to neuronal membranes
(Jan and Jan, 1982
). It is
known to recognize an epitope of carbohydrate origin, an
1,3-fucosylated, N-linked glycan
(Fabini et al., 2001
;
Snow et al., 1987
) associated
with proteins such as Nervana-2, an Na+K+ ATPase
expressed in all neurons, and with cell adhesion molecules, Fasciclin I and
II, neurotactin and neuroglian (Desai et
al., 1994
; Sun and Salvaterra,
1995
; Wang et al.,
1994
). In Rfx mutants, either the expression of these
proteins is downregulated or the relevant post-translational modification does
not operate efficiently. Interestingly, a reduction in anti-HRP staining is
seen in both type I and non-ciliated type II PNS neurons, even though no
morphological defects of type II neurons are observed by anti-HRP labeling
(data not shown). Type I and type II neurons arise from common precursors
(Orgogozo et al., 2001
)
expressing Rfx, but the latter lose Rfx expression upon
differentiation and only type I neuron lineage express Rfx throughout
embryonic development (Vandaele et al.,
2001
). Anti-HRP staining phenotype may suggest that all PNS
neurons do not reach full terminal differentiation in Rfx mutant.
Rfx transient expression in type II precursors could also be
necessary for their differentiation. The anti-HRP staining phenotype could
thus reflect a more general function for Rfx during neuronal
differentiation.
Cilium defects are associated with dendrite morphogenesis defects such as incorrect positioning in the wing, swollen shape in the femur and the wing. We do not know if the cilium defect is responsible for these abnormal dendrite differentiations. The swollen dendrite could be a consequence of a defect in outward transport of intraflagellar transport, resulting in an accumulation of unassembled cilium components. The cilium defect could be responsible for incorrect dendrite positioning by disrupting close interactions between the cilium and structures of the sheath and the hair cell. Interestingly, the dendritic cap in the Johnston's chordotonal organ is not affected by cilium defects, which suggests that its production by the scolopale cell does not depend on the cilium. Analyzing Rfx regulatory pathways with the mutants we produced will allow to clarify these questions.
Rfx and ciliogenesis
Cilia are assembled through a process called intraflagellar transport (IFT)
(Rosenbaum et al., 1999
) first
described in the unicellular green alga Chlamydomonas and highly
conserved throughout evolution. osm-1, osm5 and osm-6, which
encode proteins involved in IFT are under the control of daf-19, the
sole RFX gene in C. elegans
(Swoboda et al., 2000
;
Haycraft et al., 2001
;
Qin et al., 2001
).
osm-1 and osm-6 encode homologous proteins to
Chlamydomonas IFT polypeptides p172 and p52
(Cole et al., 1998
;
Collet et al., 1998
).
osm-5 encodes a protein involved in cilium assembly and is homologous
to Chlamydomonas IFT88 protein and to a mouse protein called
Tg737/Polaris that is required for assembly of the primary cilia in mouse
kidney and node (Haycraft et al.,
2001
; Murcia et al.,
2000
; Qin et al.,
2001
; Pazour et al.,
2000
; Pazour et al.,
2002
). Thus, IFT involves conserved proteins in many different
organisms and plays fundamental roles in a variety of physiological functions.
The conservation of function of the two invertebrate homologous genes as
essential regulators of sensory ciliogenesis will allow a fruitful comparative
identification of novel target genes likely to be involved in IFT.
In C. elegans, the only ciliated cells are the sensory neurons;
sperm cells are not flagellated and do not express daf-19.
Conversely, in Drosophila, spermatozoids have an unusually long
flagella. Interestingly, Rfx is also expressed in spermatids but
after flagellar elongation during a stage in which only a few genes have been
reported to be transcribed (Bendena et al.,
1991
; Vandaele et al.,
2001
), suggesting a different role in spermatogenesis.
Rfx mutant sperm are normally elongated and motile, and preliminary
electron microscopy data show no gross defects in spermatid flagellar 9+2
ultrastructure (not shown). Because Rfx mutants are too uncoordinated
to mate, we do not know if mutant spermatozoids are functional in
fertilization. Rfx may have a function in spermatogenesis other than
ciliary assembly. This would imply a different mode of flagellar assembly in
Drosophila spermatozoids that could reflect structural and functional
differences between sensory cilia and sperm flagella. Rfx is also
expressed in subdomain-specific regions of the brain. To our knowledge, no
ciliated cells have been described in Drosophila brain at the present
time, whereas ciliated cells are present in mammalian brain. Studying
Rfx function in Drosophila will thus bring important
information regarding the diversification of the function of RFX transcription
factors in evolution. Whether the ciliary function of RFX genes has
been conserved in vertebrates remains an unanswered question and is of great
interest regarding human pathologies associated with cilium defects.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Bendena, W. G., Ayme-Southgate, A., Garbe, J. C. and Pardue, M.
L. (1991). Expression of heat-shock locus hsr-omega in
nonstressed cells during development in Drosophila melanogaster.
Dev. Biol. 144,65
-77.[CrossRef][Medline]
Cheah, P. Y., Chia, W. and Yang, X. (2000).
Jumeaux, a novel Drosophila winged-helix family protein, is required for
generating asymmetric sibling neuronal cell fates.
Development 127,3325
-3335.[Abstract]
Chung, Y. D., Zhu, J., Han, Y. and Kernan, M. J.
(2001). nompA encodes a PNS-specific, ZP domain protein required
to connect mechanosensory dendrites to sensory structures.
Neuron 29,415
-428.[CrossRef][Medline]
Cobb, M. (1999). What and how do maggots smell?
Biol. Rev. 74,425
-459.[CrossRef]
Cole, D. G., Diener, D. R., Himelblau, A. L., Beech, P. L.,
Fuster, J. C. and Rosenbaum, J. L. (1998). Chlamydomonas
kinesin-II-dependent intraflagellar transport (IFT): IFT particles contain
proteins required for ciliary assembly in Caenorhabditis elegans sensory
neurons. J. Cell Biol.
141,993
-1008.
Collet, J., Spike, C. A., Lundquist, E. A., Shaw, J. E. and
Herman, R. K. (1998). Analysis of osm-6, a gene that affects
sensory cilium structure and sensory neuron function in Caenorhabditis
elegans. Genetics 148,187
-200.
David, J. (1962). A new medium for rearing
drosophila in axenic conditions. Dros. Inf. Ser.
36, 128.
Deak, P., Omar, M. M., Saunders, R. D., Pal, M., Komonyi, O.,
Szidonya, J., Maroy, P., Zhang, Y., Ashburner, M., Benos, P. et al.
(1997). P-element insertion alleles of essential genes on the
third chromosome of Drosophila melanogaster: correlation of physical and
cytogenetic maps in chromosomal region 86E-87F.
Genetics 147,1697
-1722.[Abstract]
Desai, C. J., Popova, E. and Zinn, K. (1994). A
Drosophila receptor tyrosine phosphatase expressed in the embryonic CNS and
larval optic lobes is a member of the set of proteins bearing the `HRP'
carbohydrate epitope. J. Neurosci.
14,7272
-7283.[Abstract]
Durand, B., Vandaele, C., Spencer, D., Pantalacci, S. and
Couble, P. (2000). Cloning and characterization of
dRFX, the Drosophila member of the RFX family of
transcription factors. Gene
246,285
-293.[CrossRef][Medline]
Dutcher, S. K. (1995). Flagellar assembly in
two hundred and fifty easy-to-follow steps. Trends
Genet. 11,398
-404.[CrossRef][Medline]
Eakin, R. M. (1972). Photochemistry of vision.
In Handbook of Sensory Physiology, Vol. VII/1, pp.625
-684. Berlin: Springer Verlag.
Eberl, D. F., Hardy, R. W. and Kernan, M. J.
(2000). Genetically similar transduction mechanisms for touch and
hearing in Drosophila. J. Neurosci.
20,5981
-5988.
Emery, P., Durand, B., Mach, B. and Reith, W.
(1996). RFX proteins, a novel family of DNA binding proteins
conserved in the eukaryotic kingdom. Nucleic Acids
Res. 24,803
-807.
Fabini, G., Freilinger, A., Altmann, F. and Wilson, I. B.
(2001). Identification of core alpha 1,3-fucosylated glycans and
cloning of the requisite fucosyltransferase cDNA from Drosophila melanogaster.
Potential basis of the neural anti-horseadish peroxidase epitope.
J. Biol. Chem. 276,28058
-28067.
Gajiwala, K. S., Chen, H., Cornille, F., Roques, B. P., Reith,
W., Mach, B. and Burley, S. K. (2000). Structure of the
winged-helix protein hRFX1 reveals a new mode of DNA binding.
Nature 403,916
-921.[CrossRef][Medline]
Guo, M., Jan, L. Y. and Jan, Y. N. (1996).
Control of daughter cell fates during asymmetric division: interaction of Numb
and Notch. Neuron 17,27
-41.[CrossRef][Medline]
Haycraft, C. J., Swoboda, P., Taulman, P. D., Thomas, J. H. and
Yoder, B. K. (2001). The C. elegans homolog of the murine
cystic kidney disease gene Tg737 functions in a ciliogenic pathway and is
disrupted in osm-5 mutant worms. Development
128,1493
-1505.[Abstract]
Heimbeck, G., Bugnon, V., Gendre, N., Haberlin, C. and Stocker,
R. F. (1999). Smell and taste perception in Drosophila
melanogaster larva: toxin expression studies in chemosensory neurons.
J. Neurosci. 19,6599
-6609.
Huang, M., Zhou, Z. and Elledge, S. J. (1998).
The DNA replication and damage checkpoint pathways induce transcription by
inhibition of the Crt1 repressor. Cell
94,595
-605.[CrossRef][Medline]
Jan, L. Y. and Jan, Y. N. (1982). Antibodies to
horseradish peroxidase as specific neuronal markers in Drosophila and in
grasshopper embryos. Proc. Natl. Acad. Sci. USA
79,2700
-2704.
Jan, Y. N. and Jan, L. Y. (1993). The
peripheral nervous system. In The Development of Drosophila
melanogaster, Vol. II (ed. M. Bate and A.
Martinez Arias), pp. 1207-1244. Cold Spring Harbor,
NY: Cold Spring Harbor Laboratory Press.
Keil, T. A. (1997). Functional morphology of
insect mechanoreceptors. Microsc. Res. Tech.
39,506
-531.[CrossRef][Medline]
Kernan, M., Cowan, D. and Zuker, C. (1994).
Genetic dissection of mechanosensory transduction: mechanoreception-defective
mutations of Drosophila. Neuron
12,1195
-1206.[CrossRef][Medline]
Kozminski, K. G., Johnson, K. A., Forscher, P. and Rosenbaum, J.
L. (1993). A motility in the eukaryotic flagellum unrelated
to flagellar beating. Proc. Natl. Acad. Sci. USA
90,5519
-5523.
Lilly, M. and Carlson, J. (1990). smellblind: a
gene required for Drosophila olfaction. Genetics
124,293
-302.[Abstract]
Luo, L., Liao, Y. J., Jan, L. Y. and Jan, Y. N.
(1994). Distinct morphogenetic functions of similar small
GTPases: Drosophila Drac1 is involved in axonal outgrowth and myoblast fusion.
Genes Dev. 8,1787
-1802.
Mann, H. B. and Whitney, D. R. (1947). On a
test of whether one of two random variables is stochastically larger than the
other. Ann. Math. Statist.
18, 52-54.
Morotomi-Yano, K., Yano, K., Saito, H., Sun, Z., Iwama, A. and
Miki, Y. (2002). Human regulatory factor X 4 (RFX4) is a
testis-specific dimeric DNA-binding protein that cooperates with other human
RFX members. J. Biol. Chem.
277,836
-842.
Murcia, N. S., Richards, W. G., Yoder, B. K., Mucenski, M. L.,
Dunlap, J. R. and Woychik, R. P. (2000). The Oak Ridge
Polycystic Kidney (orpk) disease gene is required for left-right axis
determination. Development
127,2347
-2355.[Abstract]
Nonaka, S., Tanaka, Y., Okada, Y., Takeda, S., Harada, A.,
Kanai, Y., Kido, M. and Kirokawa, N. (1998). Randomization of
left-right asymmetry due to loss of nodal cilia generating leftward flow of
extraembryonic fluid in mice lacking KIF3B motor protein.
Cell 95,829
-837.[CrossRef][Medline]
Orgogozo, V., Schweisguth, F. and Bellaiche, Y.
(2001). Lineage, cell polarity and inscuteable function in the
peripheral nervous system of the Drosophila embryo.
Development 128,631
-643.[Abstract]
Pazour, G. J., Dickert, B. L., Vucica, Y., Seeley, E. S.,
Rosenbaum, J. L., Witman, G. B. and Cole, D. G. (2000).
Chlamydomonas IFT88 and its mouse homologue, polycystic kidney disease gene
tg737, are required for assembly of cilia and flagella. J. Cell
Biol. 151,709
-718.
Pazour, G. J., Baker, S. A., Deane, J. A., Cole, D. G., Dickert,
B. L., Rosenbaum, J. L., Witman, G. B. and Besharse, J. C.
(2002). The intraflagellar transport protein, IFT88, is essential
for vertebrate photoreceptor assembly and maintenance. J. Cell
Biol. 157,103
-114.
Perkins, L. A., Hedgecock, E. M., Thomson, J. N. and Culotti, J.
G. (1986). Mutant sensory cilia in the nematode
Caenorhabditis elegans. Dev. Biol.
117,456
-487.[CrossRef][Medline]
Prokopenko, S. N., He, Y., Lu, Y. and Bellen, H. J.
(2000). Mutations affecting the development of the peripheral
nervous system in Drosophila: a molecular screen for novel proteins.
Genetics 156,1691
-1715.
Qin, H., Rosenbaum, J. L. and Barr, M. M.
(2001). An autosomal recessive polycystic kidney disease gene
homolog is involved in intraflagellar transport in C. elegans ciliated sensory
neurons. Curr. Biol. 11,457
-461.[CrossRef][Medline]
Reith, W., Herrero-Sanchez, C., Kobr, M., Silacci, P., Berte,
C., Barras, E., Fey, S. and Mach, B. (1990). MHC class II
regulatory factor RFX has a novel DNA binding domain and functionally
independant dimerization domain. Genes Dev.
4,1528
-1540.
Reith, W. and Mach, B. (2001). The bare
lymphocyte syndrome and the regulation of MHC expression. Annu.
Rev. Immunol. 19,331
-373.[CrossRef][Medline]
Rieckhof, G. E., Casares, F., Ryoo, H. D., Abu-Shaar, M. and
Mann, R. S. (1997). Nuclear translocation of extradenticle
requires homothorax, which encodes an extradenticle-related homeodomain
protein. Cell 91,171
-183.[CrossRef][Medline]
Rosenbaum, J. L., Cole, D. G. and Diener, D. R.
(1999). Intraflagellar transport: the eyes have it. J.
Cell Biol. 144,385
-388.
Shiraiwa, T., Nitasaka, E. and Yamazaki, T.
(2000). Geko, a novel gene involved in olfaction in Drosophila
melanogaster. J. Neurogenet.
14,145
-164.[Medline]
Snow, P. M., Patel, N. H., Harrelson, A. L. and Goodman, C.
S. (1987). Neural-specific carbohydrate moiety shared by many
surface glycoproteins in Drosophila and grasshopper embryos. J.
Neurosci. 7,4137
-4144.[Abstract]
Spradling, A. C. (1986). P element mediated
transformation. In Drosophila: A Practical Approach
(ed. D. Roberts), pp. 175-189. Oxford: IRL
Press.
Starich, T. A., Herman, R. K., Kari, C. K., Yeh, W. H.,
Schackwitz, W. S., Schuyler, M. W., Collet, J., Thomas, J. H. and Riddle, D.
L. (1995). Mutations affecting the chemosensory neurons of
Caenorhabditis elegans. Genetics
139,171
-188.[Abstract]
Stephens, R. E. (1995). Ciliogenesis in sea
urchin embryos a subroutine in the program of development.
BioEssays 17,331
-340.[CrossRef][Medline]
Strodicke, M., Karberg, S. and Korge, G.
(2000). Domina (Dom), a new Drosophila member of the FKH/WH gene
family, affects morphogenesis and is a suppressor of position-effect
variegation. Mech. Dev.
96, 67-78.[CrossRef][Medline]
Sun, B. and Salvaterra, P. M. (1995).
Characterization of nervana, a Drosophila melanogaster neuron-specific
glycoprotein antigen recognized by anti-horseradish peroxidase antibodies.
J. Neurochem. 65,434
-443.[Medline]
Swoboda, P., Adler, H. T. and Thomas, J. H.
(2000). The RFX-type transcription factor DAF-19 regulates
sensory neuron cilium formation in C. elegans. Mol.
Cell 5,411
-421.[CrossRef][Medline]
Thurm, U. and Kuppers, J. (1980). Epithelial
physiology of insect sensilla. In Insect Biology in the
Future (ed. M. Locke and D. Smith), pp.735
-763. New York: Academic Press.
Uga, S. and Kuwabara, M. (1965). On the fine
structure of the chordotonal sensillum in antenna of Drosophila melanogaster.
J Electron Microsc. 14,173
-181.
Vandaele, C., Coulon-Bublex, M., Couble, P. and Durand, B.
(2001). Drosophila regulatory factor X is an embryonic type I
sensory neuron marker also expressed in spermatids and in the brain of
Drosophila. Mech. Dev.
103,159
-162.[CrossRef][Medline]
Walker, R. G., Willingham, A. T. and Zuker, C. S.
(2000). A Drosophila mechanosensory transduction channel.
Science 287,2229
-2234.
Wang, X., Sun, B., Yasuyama, K. and Salvaterra, P. M.
(1994). Biochemical analysis of proteins recognized by anti-HRP
antibodies in Drosophila melanogaster: identification and characterization of
neuron specific and male specific glycoproteins. Insect Biochem.
Mol. Biol. 24,233
-242.[CrossRef][Medline]
Wu, S. Y. and McLeod, M. (1995). The sak1+ gene
of Schizosaccharomyces pombe encodes an RFX family DNA-binding protein thaht
positively regulates cyclic AMP-dependant protein kinase mediated exit from
the mitotic cycle. Mol. Cell. Biol.
15,1479
-1488.[Abstract]
Zipursky, S. L., Venkatesh, T. R., Teplow, D. B. and Benzer,
S. (1984). Neuronal development in the Drosophila retina:
monoclonal antibodies as molecular probes. Cell
36, 15-26.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. M. Ashique, Y. Choe, M. Karlen, S. R. May, K. Phamluong, M. J. Solloway, J. Ericson, and A. S. Peterson The Rfx4 Transcription Factor Modulates Shh Signaling by Regional Control of Ciliogenesis Sci. Signal., November 3, 2009; 2(95): ra70 - ra70. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. R. Stevens, J. Dobbelaere, A. Wainman, F. Gergely, and J. W. Raff Ana3 is a conserved protein required for the structural integrity of centrioles and basal bodies J. Cell Biol., November 2, 2009; 187(3): 355 - 363. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. El Zein, A. Ait-Lounis, L. Morle, J. Thomas, B. Chhin, N. Spassky, W. Reith, and B. Durand RFX3 governs growth and beating efficiency of motile cilia in mouse and controls the expression of genes involved in human ciliopathies J. Cell Sci., September 1, 2009; 122(17): 3180 - 3189. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Huh, M. A. M. Todd, and D. J. Picketts SCO-ping Out the Mechanisms Underlying the Etiology of Hydrocephalus Physiology, April 1, 2009; 24(2): 117 - 126. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Senti and P. Swoboda Distinct Isoforms of the RFX Transcription Factor DAF-19 Regulate Ciliogenesis and Maintenance of Synaptic Activity Mol. Biol. Cell, December 1, 2008; 19(12): 5517 - 5528. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Fielenbach and A. Antebi C. elegans dauer formation and the molecular basis of plasticity Genes & Dev., August 15, 2008; 22(16): 2149 - 2165. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Barreau, E. Benson, E. Gudmannsdottir, F. Newton, and H. White-Cooper Post-meiotic transcription in Drosophila testes Development, June 1, 2008; 135(11): 1897 - 1902. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Xu, P. D. Witmer, S. Lumayag, B. Kovacs, and D. Valle MicroRNA (miRNA) Transcriptome of Mouse Retina and Identification of a Sensory Organ-specific miRNA Cluster J. Biol. Chem., August 24, 2007; 282(34): 25053 - 25066. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Matsumoto, M. Ukai-Tadenuma, R. G. Yamada, J. Houl, K. D. Uno, T. Kasukawa, B. Dauwalder, T. Q. Itoh, K. Takahashi, R. Ueda, et al. A functional genomics strategy reveals clockwork orange as a transcriptional regulator in the Drosophila circadian clock Genes & Dev., July 1, 2007; 21(13): 1687 - 1700. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kadener, D. Stoleru, M. McDonald, P. Nawathean, and M. Rosbash Clockwork Orange is a transcriptional repressor and a new Drosophila circadian pacemaker component Genes & Dev., July 1, 2007; 21(13): 1675 - 1686. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ait-Lounis, D. Baas, E. Barras, C. Benadiba, A. Charollais, R. Nlend Nlend, D. Liegeois, P. Meda, B. Durand, and W. Reith Novel Function of the Ciliogenic Transcription Factor RFX3 in Development of the Endocrine Pancreas Diabetes, April 1, 2007; 56(4): 950 - 959. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Martinez, A. D. Smith, B. Li, M. Q. Zhang, and K. S. Harrod Computational prediction of novel components of lung transcriptional networks Bioinformatics, January 1, 2007; 23(1): 21 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Efimenko, K. Bubb, H. Y. Mak, T. Holzman, M. R. Leroux, G. Ruvkun, J. H. Thomas, and P. Swoboda Analysis of xbx genes in C. elegans Development, April 15, 2005; 132(8): 1923 - 1934. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Barr Caenorhabditis elegans as a Model to Study Renal Development and Disease: Sexy Cilia J. Am. Soc. Nephrol., February 1, 2005; 16(2): 305 - 312. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Elliott, C. F. Cullen, N. Wrobel, M. J. Kernan, and H. Ohkura EB1 Is Essential during Drosophila Development and Plays a Crucial Role in the Integrity of Chordotonal Mechanosensory Organs Mol. Biol. Cell, February 1, 2005; 16(2): 891 - 901. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Otsuki, Y. Hayashi, M. Kato, H. Yoshida, and M. Yamaguchi Characterization of dRFX2, a novel RFX family protein in Drosophila Nucleic Acids Res., October 19, 2004; 32(18): 5636 - 5648. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Baker, S. Adhikarakunnathu, and M. J. Kernan Mechanosensory-defective, male-sterile unc mutants identify a novel basal body protein required for ciliogenesis in Drosophila Development, July 15, 2004; 131(14): 3411 - 3422. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Martinez-Campos, R. Basto, J. Baker, M. Kernan, and J. W. Raff The Drosophila pericentrin-like protein is essential for cilia/flagella function, but appears to be dispensable for mitosis J. Cell Biol., June 7, 2004; 165(5): 673 - 683. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bonnafe, M. Touka, A. AitLounis, D. Baas, E. Barras, C. Ucla, A. Moreau, F. Flamant, R. Dubruille, P. Couble, et al. The Transcription Factor RFX3 Directs Nodal Cilium Development and Left-Right Asymmetry Specification Mol. Cell. Biol., May 15, 2004; 24(10): 4417 - 4427. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Caldwell, M. M. Miller, S. Wing, D. R. Soll, and D. F. Eberl Dynamic analysis of larval locomotion in Drosophila chordotonal organ mutants PNAS, December 23, 2003; 100(26): 16053 - 16058. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||