|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00097

The Laboratory of Vertebrate Embryology, The Rockefeller University, New York, NY, USA
Author for correspondence (e-mail:
brvnlou{at}rockefeller.edu)
Accepted 20 August 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Xenopus laevis, Neural induction, Smad7, Microarray
| INTRODUCTION |
|---|
|
|
|---|
Xenopus blastula ectodermal explants (animal caps) develop into
epidermis when cultured in isolation. In the presence of BMP inhibitors, or
when dissociated in culture, they develop into neural tissue
(Hemmati-Brivanlou and Melton,
1994
). A variety of molecules block the BMP pathway and display
direct neural inducing activities; that is, the ability to induce neural
tissue in the absence of concomitant dorsal mesoderm or organizer induction.
Other molecules reported to have neuralizing activity, such as FGFs, Wnts or
retinoids, induce mesoderm, act on pre-specified neural tissue to change the
type of neural tissue formed, or mediate BMP downregulation, and therefore are
not direct neural inducers (Cox and
Hemmati-Brivanlou, 1995
; Baker
et al., 1999
; Weinstein and
Hemmati-Brivanlou, 1999
;
Wilson et al., 2000
;
Wilson et al., 2001
).
Among the many different molecules with direct neural inducing activity,
two subgroups can be discerned. The first category includes the secreted BMP
antagonists noggin (Lamb et al.,
1993
), follistatin
(Hemmati-Brivanlou et al.,
1994
), chordin (Sasai et al.,
1994
), cerberus (Bouwmeester et
al., 1996
) and Xnr3 (Hansen et
al., 1997
). The second category comprises molecules that act in a
cell-autonomous manner to block BMP signaling intracellularly. The inhibitory
Smads, Smad6 and Smad7 belong to this group
(Massague and Chen, 2000
).
Smad6 inhibits the BMP pathway exclusively
(Hata et al., 1998
;
Nakayama et al., 1998
),
whereas Smad7 has been shown to block both the TGFß and BMP signaling
pathways (Nakao et al., 1997
;
Casellas and Brivanlou, 1998
).
Other molecules known to display neural inducing properties are the Smurfs,
ubiquitin-conjugating enzymes that target the TGFß receptors for
degradation (Kavsak et al.,
2000
; Ebisawa et al.,
2001
). Presently, it is unclear whether the activities of these
neural inducers have completely redundant functions in the embryo in neural
fate specification.
Smad7 remains the most powerful neural inducer described to date, as
assayed in animal cap ectodermal explants
(Casellas and Brivanlou, 1998
).
Smad7 is thought to act intracellularly at multiple levels to inhibit
signaling from both the BMP and the TGFß pathways, through its ability to
block receptor phosphorylation of the effector Smads
(Hayashi et al., 1997
;
Nakao et al., 1997
). In
addition, Smad7 has been shown to target type II receptors for degradation by
the ubiquitin pathway through the recruitment of the UBC-ligases Smurfs to the
receptor complex (Kavsak et al.,
2000
; Ebisawa et al.,
2001
). The relationship between the inhibition of both branches of
the TGFß superfamily and the potency of this neural inducing molecule
remains poorly understood, as are the mechanisms that lead to permanent,
transcription-mediated changes downstream of BMP inhibition in the ectoderm.
Independently of its role in the TGFß pathway, Smad7 has also been shown
to activate the JNK pathway, in the absence of interaction with TGFß
receptors (Mazars et al.,
2001
). Whether JNK activation through Smad7 activity plays a role
in neuralization remains to be addressed.
In this report, using a Xenopus laevis 5000-clone gastrula cDNA
microarray, we describe the first large-scale analysis of the transcriptional
changes in a neuralized ectodermal cell population following expression of
Smad7. We aim to understand patterns of gene expression that might be relevant
during neural induction as well as early neural development. Therefore, we
pursued genes that are expressed both during mid-gastrulation and
neurula-staged embryos, at the time when these important cell fate decisions
occur in response to signaling. Previous studies by Sasai's group and others
have identified a variety of genes in neuralized animal caps that have been
implicated in neural induction (Mizuseki
et al., 1998
; Song et al.,
1999
). However, our work represents the first example of a global
genomics approach to study neural induction. Overall, we have identified 142
different genes, the expression of which changed in response to neuralizing
signals mediated by Smad7. These studies can also be interpreted as global
transcriptional profiling in response to TGFß inhibition, and as such
expands beyond embryology. We report the initial characterization of some of
these genes, based on their expression profiles and sequence identity as
potential candidates in neural induction and early nervous system development.
As a first test of the involvement of selected clones during neural induction,
we performed gain-of-function experiments in ectodermal explants. We present
the results on several clones that display direct neural inducing activities.
This study highlights the prominent role of translational control of gene
expression during neural induction and the signaling integration of multiple
pathways after BMP inhibition in the ectoderm, mediated in part by the
regulation of the activity of the TGFß-activted kinase (TAK1) by a novel
TAK1 binding protein, TAB3.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Sequencing and sequence analysis
Clones identified by the array were sequenced on ABI 3700 sequencers using
Big Dye chemistry. Sequences were blasted against public and private
databases, and were analyzed and assembled using Auto Assembler software.
Reverse-transcriptase Polymerase-chain-reaction (RT-PCR)
analysis
The RT-PCRs on isolated animal cap explants were performed according to
previous protocols (Wilson and
Hemmati-Brivanlou, 1997
). Primers were designed encompassing
either the 5' or 3' UTRs. Amplification was performed for 21 or 25
cycles, depending on the primers and transcript abundance. Primers used were
as follows (given 5' to 3'; S, sense primer; AS, antisense
primer):
Ornithine decarboxylase (ODC) was used as a loading control. Primers for
marker genes are as described
(Hemmati-Brivanlou and Melton,
1994
; Weinstein et al.,
1998
).
Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed with digoxigenin labeled
probes (DIG-UTP from Boehringer-Mannheim) as described by Harland
(Harland, 1991
). Embryos were
post-fixed in 4% PFA. Sectioned embryos were embedded in 20%gelatin/PBS and
cut at 50 µm or 100 µm.
Plasmid constructs
The long 3'UTR of clone 57-G10/TAB3 was deleted by cutting it with
KpnI. The xTAB3C construct was made in pCS2++ by conventional PCR
using Cloned Pfu PolymeraseTM (Clontech) with the following
primers: 5' CATCGAATTCCACCATGCGGGGAATACCTACCCA-ACC 3' and 5'
CATGCTCGAGTCATGTGAATCGTGGCATCTC 3'.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
Sequence-based classification of the clones identified in the Smad7
array
Initially, we grouped the different genes according to the functional
classifications outlined in EGAD (Expressed Gene Anatomy Database, TIGR)
(Altmann et al., 2001
)
(Fig. 3), to gain a global
appreciation of the types of molecules implicated in the earliest steps of
neural development. The challenge remains to distinguish clones that act in a
mechanistic fashion after BMP inhibition from those whose expression
correlates with intrinsic differences among ectodermal fates. Importantly, the
neural ectoderm in Xenopus shows a higher mitotic index (twofold)
than does the non-neural ectoderm during early neurulation
(Saka and Smith, 2001
),
although this alone cannot account for the differences observed in transcript
abundance, nor the restricted nervous system expression of the genes thus far
characterized.
|
Overall, we find that the majority of the genes encode proteins belonging
to four main groups (Figs
2,3,4):
(1) predicted, hypothetical proteins (19%); (2) post-transcriptional and
translational control (18%); (3) signal transduction (18%); and (4)
transcription/chromatin remodeling (9%). In addition, there are a number of
clones with no hits in database searches (15.5%), which are likely to be
partial cDNAs. Smaller subsets of genes are implicated in cell structure,
cellular processes, nucleotide metabolism, transport and binding, DNA
metabolism and amino acid biosynthesis
(Fig. 2 and complete list of
clones). A few of the upregulated genes have been previously identified in a
microarray-based analysis of neural progenitors in mice
(Geschwind et al., 2001
), such
as hnRNP-D-like (clone 51-E6), thymosin (45-H5), histone H2A.Z (clone 57-D10),
and ubiquitin-like genes (clones 45-D7 and 48-D6).
Surprisingly, we found a higher percentage of differentially regulated
genes implicated in post-transcriptional and translational control than genes
acting in transcriptional regulation of gene expression
(Fig. 2). This finding suggests
that post-transcriptional mechanisms play a critical role during neurulation.
Among these factors are several initiation factors previously linked to fate
decisions in vertebrate development, such as clone 51-D5/eIF4-AIII
(Weinstein et al., 1997
) and
clone 52-G7/eIF4-AII (Morgan and Sargent,
1997
). Additionally, other RNA-binding proteins not previously
implicated in developmental processes show restricted nervous system
expression, such as clone 46-E2 (FUSE-binding protein-2)
(Fig. 4A). We also identified a
variety of presumed ubiquitous factors, such as hnRNP and snRNP proteins
(clones 13-A10/hnRNP A/B; 46-B2/snRNP B; 54-G3/RNA helicase;
Table 2). Among these latter
clones, a large subset display neuralizing activities in our assays.
Among the genes implicated in transcription, we have identified a variety
of chromatin-remodeling, HMG-containing genes
(Fig. 2 and
Table 2) with nervous system
expression. Several HMG-containing genes have previously been described in
Xenopus nervous system development
(Konig et al., 2000
;
Liu et al., 2001
), supporting
their putative role in neuronal fate acquisition.
We also identified several molecules belonging to various signaling pathways not previously linked to neural induction. Among these are those known to participate in TGFß signaling, such as activin B, Alk5, clone 51-F6/MARCKS-related and 57-G10/TAB3 (Table 2). Among the secreted factors is a distantly related member of the cerberus/gremlin family of BMP inhibitors (clone 51-B6), suggesting that Smad7 also promotes the negative regulation of the BMP pathway by inducing the expression of an extracellular BMP inhibitor. In addition, several clones are part of the NFkB or JNK pathways (see list), implicating these pathways in early neural development. Additional molecules implicated in signaling are the small GTPases, G-proteins and plexin-like receptors (clones 53-E12, 51-E10, 47-B11 and 47-E8).
A large proportion of genes share homology to predicted, hypothetical proteins (n=27/142; 19%; see Fig. 4). Some are remarkably conserved in protein-coding regions, and they probably play fundamental roles in metabolism or basic signaling processes. A third of all the hypothetical proteins within the first two sets have homologs in Drosophila or C. elegans (n=9/27), and many share homologies to S. pombe or S. cerevisiae (n=5/27; 19%). For a full description of these genes, see http//xenopus.rockefeller.edu/smad7/Development_supplement.htm.
Analysis of the temporal and spatial expression patterns of the array
clones by whole mount in situ hybridization
As a second means to assess the array results, and to characterize the
expression patterns of clones identified in the array, we determined their
mRNA distribution during development by whole-mount in situ hybridization
(Fig. 4). Overall, all the
upregulated genes had neural expression domains
(Fig. 4A-H) and those
downregulated were excluded from the neural plate
(Fig. 4I). Smad7 mRNA
expression is widespread in gastrula embryos, although is restricted to the
nervous system, the heart and ventral-most mesoderm at neural plate and
tadpole stages (Casellas and Brivanlou,
1998
). Similarly, the clones analyzed were expressed in the animal
pole and the mesoderm of the dorsal marginal zone (DMZ) and ventral marginal
zone (VMZ) of gastrula-stage embryos, as detected by in situ hybridization
(Fig. 4A-E and G-I, left
panels) and RT-PCR (not shown).
All of the clones analyzed were strongly expressed at gastrula (Fig. 4A-E,G-I left panels). For example: clone 45-H5/prothymosin is expressed throughout the outer epithelial layer but not within the sensorial layer or deep zone cells by the dorsal blastopore lip (Fig. 4B); clone 47-B11, a plexin-like molecule (Fig. 4C), and 47-G3, a hypothetical gene (Fig. 4E), were highly expressed within the blastopore lip (see asterisks in Fig. 4); by contrast, clone 47-F3, a novel hypothetical gene (Fig. 4D), and 47-G6/DG42 (a downregulated clone; Fig. 4G), were weakly expressed in the dorsal lip. Both clones 51-D6/RNA-binding protein EWS and 57-G10/TAB3 are also expressed at very high levels in the animal pole (Fig. 4G,H).
Among the upregulated genes, most had general neural expression domains. However, some genes showed more restricted expression patterns in neurula (4B,C,E-H, middle panels; Fig. 4F, left panel) and tadpole-staged (right panels) embryos. Interestingly, few of these genes had expression domains that overlapped with Smad7 mRNA expression outside of the nervous system, suggesting that these genes might be regulated by Smad7 only in the context of ectodermal patterning. Together, and in a manner consistent with their regulation, this analysis has shown that the majority of clones have overlapping expression domains with Smad7 in the gastrulating embryo, as well as during early neural development.
Functional characterization of identified clones in ectodermal
explants
Transcriptional profiling represents a powerful tool in the identification
of genes potentially implicated in a particular process. The challenge remains
to address whether these genes play a functional role in neural induction. A
major advantage of performing these experiments in Xenopus is the
combination of array technologies with gain-of-function studies, in order to
assay the functional involvement of identified genes. To this aim, we
microinjected RNAs encoding selected clones into animal caps at the two-cell
stage, and tested for their ability to promote cell-fate changes, as judged by
a variety of markers (Figs 5
and 6). We have analyzed the
involvement of the RNA-binding proteins identified in the array, and showed
that clones 56-G6/HMG-X, and 57-G10/TAB3 display direct neuralizing
activities.
|
|
Of the factors involved in post-transcriptional regulation not previously
linked to fate decisions in vertebrates, 12 were full-length and their RNAs
were injected alone or in the presence of low doses of noggin in the caps (15
pg). Of these, four clones displayed neuralizing activities: 46-B2/snRNP-D;
54-G3/putative DECD-box RNA-helicase; 47-C4/ribosomal protein XL1a, and
51-D6/RNA-bp EWS (Fig. 5). Only
51-D6/RNA-bp EWS can act as a direct neural inducer, as judged by the
expression of NCAM, NRP1, Otx2, Pax6 and XAG
(Fig. 5). The product of this
gene has been implicated in the aetiology of Ewing's familial tumours
(Arvand and Denny, 2001
). The
remaining clones lacked neuralizing activity on their own, although they
synergized with noggin to promote anterior neural fates, as judged by the lack
of expression of the spinal cord marker HoxB9
(Fig. 5). By contrast, hnRNP-A1
did not induce neural markers when co-injected with noggin. We never observed
posterior neural marker expression in this assay, consistent with neural fate
acquisition mediated by BMP inhibition.
Within the genes in the transcription category, clone 56-G6/HMG-X encodes
an HMG1/2 homolog previously identified as a gene induced during neurogenesis
(Kinoshita et al., 1994
). In
animal caps, 56-G6/HMG-X displayed direct neuralizing activity, as judged by
the expression of NCAM and Otx (Fig.
6A). In a second set of experiments, we found that 56-G6/HMG-X
enhanced the expression of the neural markers NCAM and Sox2 induced by low
levels of Smad7 RNA (5 pg; Fig.
6B), while it inhibited expression of the cement gland markers XAG
and CG. Development of the cement gland is sensitive to levels of BMP
signaling (Hemmati-Brivanlou and Melton,
1994
; Wilson et al.,
1997
; Gammill and Sive,
2000
), and cement gland markers can be induced following a partial
inhibition of BMP signaling in the ectoderm. The type of neural tissue induced
by 56-G6/HMG-X was anterior in character, as judged by the lack of expression
of En2 (mid/hindbrain marker), Krox20 (hindbrain), Hoxb9 (neural tube) and
Twist (neural crest). This anterior neural tissue can be converted to
posterior one upon exposure to bFGF (not shown), similar to what has been
reported after BMP inhibition (Cox and
Hemmati-Brivanlou, 1995
). To confirm the results obtained in the
explant experiments, we injected 56-G6/HMG-X RNA in the ectoderm
(Fig. 6C-H). Overexpression of
56-G6/HMG-X leads to hyperplasia of the anterior neural plate
(Fig. 6C-H), and to ectopic
expression of anterior markers, such as Pax6
(Fig. 6F-H).
Among the genes implicated in TGFß signaling, clone 57-G10 encodes the
Xenopus ortholog of a novel TGFß-activating kinase (TAK1)
binding protein, which we have termed TAB3
(Fig. 7). The TAK1 kinase and
binding partners have been shown to play crucial roles in signaling crosstalk
between various pathways, including the p38 MAP kinase pathway
(Kimura et al., 2000
;
Goswami et al., 2001
;
McDermott and O'Neill, 2002
),
the JNK pathway (Takaesu et al.,
2000
; Wang et al.,
2001
), the NFkB pathway (Wang
et al., 2001
) and the Wnt pathway
(Ishitani et al., 1999
;
Meneghini et al., 1999
). The
activity of TAK1 and its coupling to downstream signaling pathways is largely
modulated by the TAK-binding proteins, or TABs
(Takaesu et al., 2000
). In
Xenopus, TAK1 can be activated downstream of the BMP receptor, where
it can promote ventral fates in association with TAB1
(Shibuya et al., 1998
;
Goswami et al., 2001
).
57-G10/TAB3 is the ortholog of a recently identified mouse and human TAB,
which we have termed TAB3 (60% identity at the amino acid level) and is also
closely related to TAB2 (35% identity; Fig.
7A). Interestingly, as in the case of TAB2, 57-G10/TAB3 contains a
ubiquitin ligase-binding domain (Fig.
7B) suggesting that it might also activate TAK1 through a
ubiquitination step (Wang et al.,
2001
). Because the different TAB proteins appear to modulate the
specificity of the kinase activity, and because of its similarity to TAB2, we
tested whether 57-G10/TAB3 could play a role in neural induction, promoting
neural fates in contraposition to the role of TAB1 in the establishment of
ventral fates downstream of BMP signaling.
|
In animal cap explants, 57-G10/TAB3 induced expression of Otx1/2 and XAG,
and weakly of NRP1 (a pan-neural marker) and En2
(Fig. 6A). Interestingly, as
with 56-G6/HMG-X, 57-G10/TAB3 also weakly induced the expression of Nkx2.5, a
marker of heart tissue, although we failed to detect other markers of mesoderm
in these explants. The expression of Nkx2.5 in the explants might suggest that
57-G10/TAB3 could inhibit the Wnt pathway, which has been shown to regulate
Nkx2.5 expression (Bouwmeester et al.,
1996
). The neuralizing activity of 57-G10/TAB3 prompted us to
speculate that TAB3 might form a complex with TAK1/TAB1 and switch the
specificity of TAK1 to promote neural versus epidermal fates. In order to test
this idea, we made a dominant-negative C-terminal construct of 57-G10/TAB3
(TAB3C; Fig. 7), based on the
approach taken by Takaesu et al. (Takaesu
et al., 2000
) with TAB2. When we injected low doses (250-400 pg)
of xTAB3C in the animal caps, there was an increase in epidermal keratin
expression in gastrula and tadpole stage caps
(Fig. 7C,H), suggesting that
xTAB3C can promote BMP signaling. Higher doses of xTAB3C induced apoptosis in
the ectoderm, consistent with the activation of TAK1/TAB1 activity in
Xenopus (Goswani et al., 2001) (not shown). In order to test whether
xTAB3C could prevent neuralization, we co-injected it together with 50 pg of
either Smad7 or noggin (Fig.
7D-G,H). Explants expressing Smad7 form neural and cement gland
tissue (Fig. 7E). The heavily
pigmented cement gland tissue does not form in Smad7 caps co-injected with
xTAB3C (Fig. 7F). When the caps
were analyzed by RT-PCR, we observed a marked inhibition of neural genes
normally induced by BMP inhibitors (Fig.
7H). Altogether, these results strongly suggest that TAB3 acts in
the neural plate to promote neural fates, and supports the notion that TAK1
complexes might be crucial in the establishment of neural fates.
| DISCUSSION |
|---|
|
|
|---|
From this information, we suggest potential mechanisms by which permanent
neural fate acquisition might be imparted on the ectoderm by direct
neuralizing agents (Fig. 8).
Although the mechanism of action of Smad7 in preventing BMP and TGFß
signaling can explain the final outcome of neural fate acquisition in the
developing ectoderm, the molecular mechanisms that promote the differentiation
of neural tissue are not clear. Previous studies have suggested that the
period of competence during which neural inducing molecules act to prevent BMP
is defined (Wilson and Hemmati-Brivanlou,
1997
), the outcome being dependent on the total levels of BMP
exposure or the intracellular effectors Smad1 and Smad5
(Suzuki et al., 1997
;
Wilson and Hemmati-Brivanlou,
1997
). Fate acquisition appears to be dependent on the
concentration and length of exposure to BMP signals, in a mechanism that is
seemingly conserved in different vertebrates
(Wilson et al., 1997
;
Barth et al., 1999
). Therefore,
the morphogenic effects of BMPs in ectodermal fates may be modulated at the
level of transcriptional regulation of gene expression
(Wilson et al., 1997
).
However, for permanent neural acquisition, BMP inhibition must be sustained
(Hartley et al., 2001
).
|
Role of prolonged BMP inhibition in neural specification
BMP inhibitors have been characterized mostly in the context of the
organizer, which acts to impart dorsal/anterior fates in the surrounding germ
layers, and neural fates in the overlaying ectoderm
(Harland and Gerhart, 1997
;
Weinstein and Hemmati-Brivanlou,
1999
). However, the potential involvement of neural progenitors in
promoting neuralization of the ectoderm has not been addressed. The phenomenon
of homeogenetic induction (neural tissue induces neuralization in non-neural
ectoderm in recombination experiments)
(Spemann and Mangold, 1924
;
De Robertis et al., 1989
;
Servetnick and Grainger, 1991
)
can be explained if neural tissue itself produces inhibitors of BMP signaling.
In the ectoderm, BMPs activate two biochemical pathways, one mediated by Smads
(Wilson et al., 1997
) and a
second mediated by the p38/MAP kinase pathway downstream of TAK1
(Shibuya et al., 1998
;
Goswami et al., 2001
)
(Fig. 7). Our preliminary
analysis suggests that Smad7-mediated neural induction operates through an
inhibition of both branches of BMP signaling. First, we have identified a
secreted factor with weak homology to the cerberus and gremlin-families of BMP
inhibitors, expressed in gastrulastage embryos, with an ability to inhibit BMP
and TGFß ligands (E. B., I. M.-S., C. R. A. and A. H. B., unpublished).
This, together with the broad expression of Smad7 itself in the prospective
neural plate (Casellas and Brivanlou,
1998
) suggests that prolonged BMP inhibition is a requirement for
neural development.
We have also shown that a novel TAK1-binding protein (TAB3) is upregulated
after Smad7 expression and can induce neural marker expression in isolated
explants. TAK1/TAB1 complexes have been shown to promote epidermal fates
downstream of BMPs in Xenopus ectoderm
(Shibuya et al., 1998
;
Goswami et al., 2001
) and
inhibition of TAK1 induces neural gene expression in animal caps
(Goswami et al., 2001
). There
is presently little known about how neuralizing molecules modulate TAK1
activity during neural induction, or whether any other TABs associated with
TAK1 in the emerging neural plate. This remains an important point, as
associated TABs might switch the specificity of TAK1/TAB1 complexes during
neural induction, hence effectively blocking BMP inputs. For example, TAB2 has
been identified as a key effector in the activation of the NFkB and JNK
pathways (Takaesu et al.,
2000
; Wang et al.,
2001
). In this report, we have shown that TAB3 can promote neural
fates and that a C-terminal dominant-negative form of TAB3 can inhibit neural
induction downstream of BMP inhibition. Because a C-terminal dominant negative
TAB2 has been shown to bind TAK1, it is likely that TAB3C also acts by binding
TAK1 (Takaesu et al., 2000
).
xTAB3C lacks the ubiquitin ligase-binding domain, and therefore it is likely
that signaling through TAB3 is mediated by ubiquitination of TAK1. Therefore,
we propose that the activation of TAB3 by neural inducers might be a mechanism
for inhibiting epidermal fates mediated by TAK1/TAB1
(Fig. 8). This latter point is
important because pathways other than BMP inhibition have been implicated in
neural induction, namely the FGF and Wnt pathways
(Harland, 2000
;
Wilson and Edlund, 2001
).
Whether BMP inhibition is sufficient for neuralization or whether it acts in
synergy or in parallel with FGFs and Wnts remains a highly debated issue. Of
particular importance is the modulation of p38 MAPK pathways by TAK1.
Therefore, the regulation of TAK1 probably plays a role in signaling crosstalk
between BMPs and FGFs, and might reconcile some findings in Xenopus
and chick embryos about the involvement of both BMP inhibition and FGF
signaling during neural induction (Wilson
and Edlund, 2001
).
Whether TAB3 links TAK1 activity to NFkB or JNK instead of p38 pathways
remains to be addressed. However, the activation of the JNK pathway downstream
of Smad7 has been demonstrated in epithelial cells
(Lallemand et al., 2001
;
Mazars et al., 2001
) and NFkB
homologs have been implicated in early dorsoventral patterning in
Xenopus (Kao and Lockwood,
1996
; Yang et al.,
1998
; Lake et al.,
2001
). Intriguingly, we also identified in the array several genes
associated with NFkB and interleukin-related pathways, such as IkB-
,
cyclophilin-binding protein, interleukin enhancer binding factor 2 and
interferon-related regulator. Whether these genes will be implicated in neural
fate acquisition downstream or in parallel with BMP inhibition, and whether
JNK or NFkB pathways are regulated by TAK1/TAB3 complexes remains to be
explored. However, the regulation of TAK1 activity by Smad7 and possibly other
BMP inhibitors suggests that TAK1 might be at the center of signaling
crosstalk between BMP inputs and other pathways that may play additional roles
during early neural fate acquisition.
Role of post-transcriptional control
A surprising result is the remarkably high number of RNA-binding proteins
identified in the array, which are thought to play a role in
post-transcriptional control. A few of these genes have been shown to modulate
embryonic fate decisions, such as eIF4AI and eIF4AIII in neural and epidermal
fate specification, respectively (Morgan
and Sargent, 1997
; Weinstein
et al., 1997
). We have extended these observations and
demonstrated that a number of RNA-binding proteins can act as direct neural
inducers or work in synergy with BMP antagonists to neuralize the
ectoderm.
These proteins could form a complex to regulate the translation of neural
genes or, alternatively, regulate BMP signaling at the post-transcriptional
level. Further work should discern between these possibilities. Regardless of
their mode of action during neural development, it is notable that these
previously thought `ubiquitous' factors show neural-specific patterns of
expression, suggesting that they have specific targets during neural
specification. In Drosophila, translational repression plays a
crucial role in nervous system specification downstream of Notch signaling
(Okabe et al., 2001
) and it is
likely that similar mechanisms operate in vertebrate neural specification.
This regulation might be crucial in the post-transcriptional regulation of the
pro-neural genes, most of which show an initial broad RNA expression in the
ectoderm that becomes restricted to the emerging neural territory
(Bertrand et al., 2002
).
Therefore, there must be a tight regulation at the level of RNA stability,
degradation or translational efficiency. Given the activity of the genes
isolated in the array, our work strongly suggests that post-transcriptional
control of gene expression is critical for neural fate acquisition.
Additional pathways implicated in early nervous system
development
Cell-fate acquisition must extend from signaling to its overall
transcriptional response in order to promote and maintain cell-fate decisions.
It is not well understood whether permanent changes at the chromatin
remodeling level are connected to fate decisions during embryogenesis. For
example, the fate competence of the ectoderm to mesoderm-inducing signals is
regulated by histone acetylation
(Steinbach et al., 1997
), and
therefore global chromatin remodeling is likely to modulate fate decisions in
other contexts as well. A variety of HMG-containing proteins have been
implicated in fate changes (Meneghini et
al., 1999
; Decoville et al.,
2001
), although their regulation and mechanism of action is poorly
understood. We have shown that the HMG-X gene can induce neural tissue
downstream of BMP inhibition. Interestingly, cement gland fates are inhibited
when HMG-X is co-expressed with Smad7, and therefore HMG-X might function in
the patterning of the anterior ectoderm. Consistent with this idea, the
expression of HMG-X is confined to the neural plate, and is absent from the
cement gland (Kinoshita et al.,
1994
). In support of our model, we identified another
HMG-containing protein (Baf57) (Domingos
et al., 2002
) that synergized with Smad7 in promoting neural fates
in an expression cloning screen. Similarly, expression of Baf57 enhanced
neural fates at the expense of cement gland fates
(Domingos et al., 2002
).
Interestingly, a large number of clones encode hypothetical proteins or have no matches in database searches, several of which are extremely conserved from C. elegans to humans. The high frequency of genes of unknown function, coupled to our preliminary analysis of their expression in the developing nervous system, highlights the gap existing in our knowledge of how early neural fate specification and induction is mediated. Overall, we have presented an initial analysis of the global changes in gene expression that occur after exposure to a neural inducer. This analysis has identified potential target genes and pathways implicated in the earliest specification of the nervous system, and highlighted the importance of post-transcriptional control during neural induction. Ongoing and future work will extend the microarray analysis of neural induction in a variety of conditions to refine our understanding of this complex embryological decision.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
* These authors contributed equally to this work ![]()
| REFERENCES |
|---|
|
|
|---|
Altmann, C. R., Bell, E., Sczyrba, A., Pun, J., Bekiranov, S., Gaasterland, T. and Brivanlou, A. H. (2001). Microarray-based analysis of early development in Xenopus laevis. Dev. Biol. 236,64 -75.[CrossRef][Medline]
Arvand, A. and Denny, C. T. (2001). Biology of EWS/ETS fusions in Ewing's family tumors. Oncogene 20,5747 -5754.[CrossRef][Medline]
Baker, J. C., Beddington, R. S. and Harland, R. M.
(1999). Wnt signaling in Xenopus embryos inhibits bmp4 expression
and activates neural development. Genes Dev.
13,3149
-3159.
Barth, K. A., Kishimoto, Y., Rohr, K. B., Seydler, C., Schulte-Merker, S. and Wilson, S. W. (1999). Bmp activity establishes a gradient of positional information throughout the entire neural plate. Development 126,4977 -4987.[Abstract]
Bertrand, N., Castro, D. S. and Guillemot, F. (2002) Proneural genes and the specification of neural cell types. Nat. Rev. Neurosci. 3, 517-530.[CrossRef][Medline]
Bouwmeester, T., Kim, S., Sasai, Y., Lu, B. and de Robertis, E. M. (1996). Cerberus is a head-inducing secreted factor expressed in the anterior endoderm of Spemann's organizer. Nature 382,595 -601.[CrossRef][Medline]
Brizuela, B. J., Wessely, O. and de Robertis, E. M. (2001). Overexpression of the Xenopus tight-junction protein claudin causes randomization of the left-right body axis. Dev. Biol. 230,217 -229.[CrossRef][Medline]
Casellas, R. and Brivanlou, A. H. (1998). Xenopus Smad7 inhibits both the activin and BMP pathways and acts as a neural inducer. Dev. Biol. 198,1 -12.[CrossRef][Medline]
Cox, W. G. and Hemmati-Brivanlou, A. (1995). Caudalization of neural fate by tissue recombination and bFGF. Development 121,4349 -4358.[Abstract]
De Robertis, E. M., Oliver, G. and Wright, C. V. (1989). Determination of axial polarity in the vertebrate embryo: homeodomain proteins and homeogenetic induction. Cell 57,189 -191.[CrossRef][Medline]
Decoville, M., Giacomello, E., Leng, M. and Locker, D.
(2001). DSP1, an HMG-like protein, is involved in the regulation
of homeotic genes. Genetics
157,237
-244.
Domingos, P. M., Obukhanych, T. V., Altmann, C. R. and Hemmati-Brivanlou, A. (2002) Cloning and developmental expression of Baf57 in Xenopus laevis. Mech. Dev. 116,177 -181.[CrossRef][Medline]
Ebisawa, T., Fukuchi, M., Murakami, G., Chiba, T., Tanaka, K.,
Imamura, T. and Miyazono, K. (2001). Smurf1 interacts with
transforming growth factor-beta type I receptor through Smad7 and induces
receptor degradation. J. Biol. Chem.
276,12477
-12480.
Gammill, L. S. and Sive, H. (2000). Coincidence of otx2 and BMP4 signaling correlates with Xenopus cement gland formation. Mech. Dev. 92,217 -226.[CrossRef][Medline]
Geschwind, D. H., Ou, J., Easterday, M. C., Dougherty, J. D., Jackson, R. L., Chen, Z., Antoine, H., Terskikh, A., Weissman, I. L., Nelson, S. F. and Kornblum, H. I. (2001). A genetic analysis of neural progenitor differentiation. Neuron 29,325 -339.[CrossRef][Medline]
Goswami, M., Uzgare, A. R. and Sater, A. K. (2001). Regulation of MAP kinase by the BMP-4/TAK1 pathway in Xenopus ectoderm. Dev. Biol. 15,259 -270.
Hansen, C. S., Marion, C. D., Steele, K., George, S. and Smith, W. C. (1997). Direct neural induction and selective inhibition of mesoderm and epidermis inducers by Xnr3. Development 124,483 -492.[Abstract]
Harland, R. (1991). In situ hybridization: an improved wholemount method for Xenopus embryos. Methods Cell Biol. 36,675 -678.[Medline]
Harland, R. and Gerhart, J. (1997). Formation and function of Spemann's organizer. Annu. Rev. Cell Dev. Biol. 13,611 -667.[CrossRef][Medline]
Harland, R. (2000). Neural induction. Curr. Opin. Genet. Dev. 10,357 -362.[CrossRef][Medline]
Hartley, K. O., Hardcastle, Z., Friday, R. V., Amaya, E. and Papalopulu, N. (2001). Transgenic Xenopus embryos reveal that anterior neural development requires continued suppression of BMP signaling after gastrulation. Dev. Biol. 238,168 -184.[CrossRef][Medline]
Hata, A., Lagna, G., Massague, J. and Hemmati-Brivanlou, A.
(1998). Smad6 inhibits BMP/Smad1 signaling by specifically
competing with the Smad4 tumor suppressor. Genes Dev.
12,186
-197.
Hayashi, H., Abdollah, S., Qiu, Y., Cai, J., Xu, Y. Y., Grinnell, B. W., Richardson, M. A., Topper, J. N., Gimbrone, M. A., Jr, Wrana, J. L. and Falb, D. (1997). The MAD-related protein Smad7 associates with the TGFbeta receptor and functions as an antagonist of TGFbeta signaling. Cell 89,1165 -1173.[CrossRef][Medline]
Heller, R. A., Schena, M., Chai, A., Shalon, D., Bedilion, T.,
Gilmore, J., Woolley, D. E. and Davis, R. W. (1997).
Discovery and analysis of inflammatory disease-related genes using cDNA
microarrays. Proc. Natl. Acad. Sci. USA
94,2150
-2155.
Hemmati-Brivanlou, A. and Melton, D. A. (1994). Inhibition of activin receptor signaling promotes neuralization in Xenopus. Cell 77,273 -281.[CrossRef][Medline]
Hemmati-Brivanlou, A., Kelly, O. G. and Melton, D. A. (1994). Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity. Cell 77,283 -295.[CrossRef][Medline]
Ishitani, T., Ninomiya-Tsuji, J., Nagai, S., Nishita, M., Meneghini, M., Barker, N., Waterman, M., Bowerman, B., Clevers, H., Shibuya, H. and Matsumoto, K. (1999). The TAK1-NLK-MAPK-related pathway antagonizes signalling between ß-catenin and transcription factor TCF. Nature 399,798 -802.[CrossRef][Medline]
Kao, K. R. and Lockwood, A. (1996). Negative regulation of dorsal patterning in early embryos by overexpression of XrelA, a Xenopus homologue of NF-kappa B. Mech. Dev. 58,129 -139.[CrossRef][Medline]
Kavsak, P., Rasmussen, R. K., Causing, C. G., Bonni, S., Zhu, H., Thomsen, G. H. and Wrana, J. L. (2000). Smad7 binds to Smurf2 to form an E3 ubiquitin ligase that targets the TGF beta receptor for degradation. Mol. Cell 6,1365 -1375.[CrossRef][Medline]
Kimura, N., Matsuo, R., Shibuya, H., Nakashima, K. and Taga,
T. (2000). BMP2-induced apoptosis is mediated by activation
of the TAK1-p38 kinase pathway that is negatively regulated by Smad6.
J. Biol. Chem. 275,17647
-17652.
Kinoshita, M., Hatada, S., Asashima, M. and Noda, M. (1994). HMG-X, a Xenopus gene encoding an HMG1 homolog, is abundantly expressed in the developing nervous system. FEBS Lett. 352,191 -196.[CrossRef][Medline]
Konig, A., Gradl, D., Kuhl, M. and Wedlich, D. (2000). The HMG-box transcription factor XTcf-4 demarcates the forebrain-midbrain boundary. Mech. Dev. 93,211 -214.[CrossRef][Medline]
Lake, B., Ford, R. and Kao, K. R. (2001). Xrel3 is required for head development in Xenopus laevis. Development 128,263 -273.[Abstract]
Lallemand, F., Mazars, A., Prunier, C., Bertrand, F., Kornprost, M., Gallea, S., Roman-Roman, S., Cherqui, G. and Atfi, A. (2001). Smad7 inhibits the survival nuclear factor kappaB and potentiates apoptosis in epithelial cells. Oncogene 20,879 -884.[CrossRef][Medline]
Lamb, T. M., Knecht, A. K., Smith, W. C., Stachel, S. E.,
Economides, A. N., Stahl, N., Yancopolous, G. D. and Harland, R. M.
(1993). Neural induction by the secreted polypeptide noggin.
Science 262,713
-718.
Liu, F., Chau, K. Y., Arlotta, P. and Ono, S. J. (2001). The HMG I proteins: dynamic roles in genes activation, development, and tumorigenesis. Immunol. Res. 24, 13-29.[CrossRef][Medline]
Massague, J. and Chen, Y. (2000). Controling
TGF-ß signaling. Genes Dev.
14,627
-644.
Mazars, A., Lallemand, F., Prunier, C., Marais, J., Ferrand, N.,
Pessah, M., Cherqui, G. and Atfi, A. (2001). Evidence for a
role of the JNK cascade in Smad7-mediated apoptosis. J. Biol.
Chem. 276,36797
-36803.
McDermott, E. P. and O'Neill, L. A. (2002). Ras
participates in the activation of p38 MAPK by interleukin-1 by associating
with IRAK, IRAK2, TRAF6, and TAK-1. J. Biol. Chem.
277,7808
-7815.
Meneghini, M. D., Ishitani, T., Carter, J. C., Hisamoto, N., Ninomiya-Tsuji, J., Thorpe, C. J., Hamill, D. R., Matsumoto, K. and Bowerman, B. (1999). MAP kinase and Wnt pathways converge to downregulate an HMG-domain repressor in Caenorhabditis elegans. Nature 399,793 -797.[CrossRef][Medline]
Miyata, S. and Kubo, T. (1997). Inhibition of gastrulation in Xenopus embryos by an antibody against a cathepsin L-like protease. Dev. Growth Differ. 39,111 -115.[CrossRef][Medline]
Mizuseki, K., Kishi, M., Matsui, M., Nakanishi, S. and Sasai, Y. (1998). Xenopus Zic-related-1 and Sox-2, two factors induced by chordin, have distinct activities in the initiation of neural induction. Development 125,579 -587.[Abstract]
Morgan, R. and Sargent, M. G. (1997). The role in neural patterning of translation initiation factor eIF4AII; induction of neural fold genes. Development 124,2751 -2760.[Abstract]
Nakao, A., Afrakhte, M., Moren, A., Nakayama, T., Christian, J. L., Heuchel, R., Itoh, S., Kawabata, M., Heldin, N. E., Heldin, C. H. and ten Dijke, P. (1997). Identification of Smad7, a TGF beta-inducible antagonist of TGF-beta signalling. Nature 389,631 -635.[CrossRef][Medline]
Nakayama, T., Gardner, H., Berg, L. K. and Christian, J. L. (1998). Smad6 functions as an intracellular antagonist of some TGF-beta family members during Xenopus embryogenesis. Genes Cells 3,387 -934.[Abstract]
Okabe, M., Imai, T., Kurusu, M., Hiromi, Y. and Okano, H. (2001). Translational repression determines a neuronal potential in Drosophila asymmetric cell division. Nature 411, 94-98.[CrossRef][Medline]
Rosa, F., Sargent, T. D., Rebbert, M. L., Michaels, G. S., Jamrich, M., Grunz