|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00154
Division of Molecular Embryology, Deutsches Krebsforschungszentrum, Im Neuenheimer Feld 280, D-69120 Heidelberg, Germany
* Author for correspondence (e-mail: niehrs{at}dkfz-heidelberg.de)
Accepted 9 September 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Anteroposterior patterning, Head induction, bf1, Wnt, Fz, Wnt/LRP signalling, Wnt/LRP inhibition, Dickkopf, Kremen, Xenopus
| INTRODUCTION |
|---|
|
|
|---|
We and others recently showed that a gradient of Wnt/ß-catenin
signalling regulates anteroposterior (AP) patterning of the entire neural
plate during Xenopus gastrulation
(Kiecker and Niehrs, 2001
;
Nordstrom et al., 2002
). This
gradient is high in posterior and low in anterior regions of the embryo, a
likely consequence of Wnt and Wnt inhibitor expression domains being
predominantly posterior and anterior, respectively. The anterior source of
secreted Wnt antagonists is formed in anterior endomesoderm with the
expression of cerberus
(Bouwmeester et al., 1996
),
sFRPs (Leyns et al.,
1997
; Rattner et al.,
1997
; Wang et al.,
1997
) and dkk1
(Glinka et al., 1998
). Indeed,
a distinguishing feature of organising centres involved in anterior neural
induction in vertebrates is their expression of Wnt antagonists. Three lines
of evidence support the theory that Wnt antagonism plays a central role in
anterior specification: (1) co-expression of Wnt and BMP antagonists induces
ectopic heads including anterior CNS while BMP antagonists alone induce only
trunk structures (Glinka et al.,
1997
; Glinka et al.,
1998
); (2) overexpression of Wnt inhibitors in Xenopus
and zebrafish embryos induces enlarged heads and forebrain
(Itoh et al., 1995
;
Hoppler et al., 1996
;
Pierce and Kimelman, 1996
;
Glinka et al., 1997
;
Leyns et al., 1997
;
Wang et al., 1997
;
Deardorff et al., 1998
;
Glinka et al., 1998
;
Hsieh et al., 1999
;
Fekany-Lee et al., 2000
;
Hashimoto et al., 2000
;
Heasman et al., 2000
;
Shinya et al., 2000
); (3) in
loss-of-function studies Wnt inhibitors were shown to be necessary for
formation of anterior neural structures. Inactivation of the secreted Wnt
antagonist Dickkopf1 (Dkk1) in Xenopus embryos using neutralising
antibodies (Glinka et al.,
1998
; Kazanskaya et al.,
2000
) or targeted deletion of the dkk1 gene in mouse
(Mukhopadhyay et al., 2001
),
as well as inactivation of the intracellular Wnt pathway inhibitors
tcf3 and axin1 in the zebrafish headless and
masterblind mutants, respectively
(Kim et al., 2000
;
Heisenberg et al., 2001
;
van de Water et al., 2001
),
all result in microcephalic embryos.
As regulation of Wnt/ß-catenin signalling is crucial for AP neural
patterning, it is important to understand the regulatory network interacting
with Wnt antagonists, because it will have a bearing on the AP patterning
process. We focus on the regulation of the Wnt antagonist Dickkopf1 (Dkk1),
member of a multigene family of secreted glycoproteins with at least four
different members in human (Glinka et al.,
1998
; Krupnik et al.,
1999
). Dkk1 is expressed in the Spemann organiser and the
presumptive prechordal plate and acts as a head inducer during vertebrate
gastrulation (Glinka et al.,
1998
; Hashimoto et al.,
2000
; Kazanskaya et al.,
2000
; Shinya et al.,
2000
; Mukhopadhyay et al.,
2001
). The mechanism of Dkk1 action is unlike that of other
extracellular Wnt inhibitors belonging to the sFRP
(Leyns et al., 1997
;
Rattner et al., 1997
;
Wang et al., 1997
), WIF
(Hsieh et al., 1999
) and
Cerberus (Glinka et al., 1997
;
Piccolo et al., 1999
) class,
which directly bind and inactivate Wnt proteins. Dkk1 neither interacts with
Wnts nor affects Wnt/Fz interactions. Instead, it binds as a high affinity
antagonist to Wnt receptors of the lipoprotein receptor-related protein (LRP)
5 and 6 class (Bafico et al.,
2001
; Mao et al.,
2001
; Semenov et al.,
2001
). Owing to its mechanism of action
(Wehrli et al., 2000
), Dkk1 is
a selective inhibitor of the Wnt/ß-catenin pathway, and it does not
affect the Wnt/planar cell polarity (PCP) pathway that drives convergent
extension movements in Xenopus
(Semenov et al., 2001
).
In addition to LRPs, Dkk1 interacts with another recently identified
receptor class, the transmembrane proteins Krm1 and Krm2, to synergistically
inhibit LRP6 (Mao et al.,
2002
). Mouse Krm1 (Kremen) had previously been
identified as a differentially expressed gene without known function
(Nakamura et al., 2001
).
Murine Krm proteins strongly cooperate with Dkk1 to inhibit Wnt signalling
both in the mammalian cell line HEK 293 as well as in Drosophila
wings, when expressed as heterologous transgenes. Upon binding to Dkk1, Krm
proteins are recruited into a complex with LRP6, which leads to rapid
endocytosis and removal of this Wnt receptor from the plasma membrane
(Mao et al., 2002
).
While this suggests that Krm proteins function in Dkk1-mediated Wnt inhibition, it is unknown what role these transmembrane receptors play physiologically, e.g. during embryogenesis. To investigate the physiological relevance of their interaction with Dkk1 and to study their role during embryogenesis, we have cloned and functionally characterised the Xenopus homologues of krm1 and krm2. We show that Krm proteins functionally interact with Dkk1 during Wnt inhibition in Xenopus embryos and that they are required for formation of the anterior CNS.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning of Xenopus Kremens and constructs
Xenopus krm1 and krm2 cDNA fragments were amplified by
RT-PCR using degenerate oligos (forward, AATGGNGCNGAYTAYMGAGG; reverse,
CCRCARAARCANGCRTAWCC) and mRNA from stage 18 Xenopus embryos. Two 400
bp krm1 and krm2 fragments were obtained and used as probes
to obtain full-length krm cDNAs (Accession Number, AY150813). These
were subcloned into pCS2+ to obtain pCS-Xkrm1 and pCS-Xkrm2.
C-terminal hemaglutinin-(HA) and V5-tagged pCS-Xkrm1HA and
pCS-Xkrm2V5, as well as N-terminal V5-tagged pCS-V5Xkrm2
were created by PCR.
Morpholino antisense oligonucleotides
The 5' nucleotide sequences of additional (pseudo-) alleles for both
Xenopus krm1 and krm2 genes were obtained using 5'
RACE (GeneRacer kit, Invitrogen). Based on these sequences, antisense
oligonucleotides with optimal complementary to both alleles around the ATG
start codon were designed: krm2, ACCACAGCATCTCCACCAACATTGT;
krm1, TGAAATTGTCCAAATATCCATCACC.
RNA synthesis and western blot analysis
Preparation of mRNA for Xenopus injections was carried out using
the MegaScript in vitro transcription kit (Ambion), according to
manufacturer's instructions. For western blot immunological detection of
tagged Krm proteins, either anti-hemagglutinin (HA) (1:10,000, Roche) or
anti-V5 (1:10,000, Invitrogen) monoclonal antibodies were used.
Chemiluminescence detection (SuperSignal® solution, Pierce) was carried
out according to manufacturer's instructions after incubation of blots with
anti-mouse IgG-HRP (1:10,000, Pierce).
RT-PCR
RT-PCR assays were carried out in the linear phase of amplification and
with primers as described (Glinka et al.,
1997
). Other primers were: mouse Krm1 (forward,
GTGCTTCACAGCCAACGGTGCA; reverse, ACGTAGCACCAAGGGCTCACGT); mouse Krm2
(forwards, AGGGAAACTGGTCGGCTC; reverse, AAGGCACGGAGTAGGTTGC); Xenopus
krm1 (forward, CACTAGATGGTGGGAAGCCTTGC; reverse, CCTCCAGCCCAGCTAGCTTGT);
and Xenopus krm2 (forward, CCCGACAATGTTGGTGGAGATGC; reverse,
GGTGCCTACGTCTGATGGATCGC).
| RESULTS |
|---|
|
|
|---|
|
Expression of Kremen genes in mouse and Xenopus embryos
In the mouse, both Krm1 and Krm2 are expressed in a
variety of adult tissues, particularly in heart, eye and reproductive organs
as seen by RT-PCR (Fig. 2A).
Krm1 and Krm2 transcripts were first detected at embryonic
day (E) 8 by RT-PCR (data not shown). At this time, which corresponds to early
headfold stages, Krm1 (Fig.
2B) and Krm2 (similar to Krm1 and therefore not
shown) are expressed predominantly in the early anterior neural ridge
(arrowheads). Krm1 and Krm2 show differential expression in
various neural and mesodermal derivatives in midgestation mouse embryos
(Fig. 2B) (Nakamura et al., 2001
). At
E10.5, prominent co-expression of Krm genes is evident in the branchial
arches, the apical epidermal ridge (AER) of limb buds and nasal placode, with
lower level co-expression seen in somites
(Fig. 2C). Additional
expression is seen in the forebrain and otic and optic vesicles
(Krm1) and mesonephros (Krm2)
(Fig. 2C).
|
In Xenopus, RT-PCR analysis shows that Krm mRNAs are present throughout embryogenesis, because of both maternal contribution (krm1) and zygotic expression (Fig. 3A). Zygotic expression starts at early (krm2) and late gastrula (krm1) and remains relatively constant throughout neurulation and organogenesis (Fig. 3A).
|
By whole-mount in situ hybridisation, krm2 expression is observed in the gastrula marginal zone (both deep and superficial, not shown) with exception of the Spemann organiser (Fig. 3G). At early neurula stage, krm2 expression is seen in two longitudinal stripes along the lateral neural plate (Fig. 3H). Longitudinal (Fig. 3I) and sagittal (Fig. 3J) sections at these stages show staining in anterior mesoderm, but not anterior neuroectoderm. In mid neurulae neural tubes, expression is seen in the dorsal midline as well as two longitudinal stripes, and in sagittal sections prominent expression is observed in the prechordal plate (Fig. 3K,L). In tailbud embryos expression is seen in hatching gland, branchial arch, dorsal otic vesicle, fin mesenchyme and pronephric duct (Fig. 3M).
krm1 is first detected by in situ hybridisation at neurula stages, when it shows a similar expression pattern to krm2 (Fig. 3C-E). Staining in sections of early neurulae are similar to those shown for krm2 (Fig. 3I,J) and therefore not shown. At tailbud stage, as for krm2, expression is seen in hatching gland and fin mesenchyme, but krm1 shows additionally expression in notochord and weakly in somites (Fig. 3F).
Kremens inhibit Wnt signalling in Xenopus embryos
We previously showed that dkk1 and Krms synergise to inhibit Wnt
signalling in HEK 293 cells and in the Drosophila wing
(Mao et al., 2002
). To test if
they also functionally interact in Xenopus embryos, we carried out
axis duplication assays with dkk1 and krm. In these assays,
Wnt signalling is read during a period when both endogenous Krm and LRP6 are
present (because of maternal contribution), but when Dkk1 is absent.
Xwnt8 mRNA injection induces about 60% secondary embryonic axes and
this is effectively inhibited by co-injection of dkk1 mRNA
[Fig. 4A,B,G (columns 1 and
2)], but not krm1 or krm2 (data not shown). It is thus
unlikely that Krm can function without Dkk1. In contrast to its inhibition of
Wnt8-induced axis duplication, dkk1 fails to inhibit
Xwnt8/Lrp6 induced axis duplication
[Fig. 4C,D,G (column 3)].
However, co-injection of krm2 and dkk1 mRNAs, but not
krm2 alone, leads to complete inhibition of
Wnt8/Lrp6-induced axis duplication
[Fig. 4E,F,G (columns 4 and
5)]. We conclude that Dkk1 and Krm proteins can functionally synergise during
inhibition of Wnt signalling in Xenopus embryos.
|
A hallmark of Dkk1 is its ability to induce enlarged head structures in
Xenopus embryos when overexpressed. This is because Dkk1 functions to
induce head formation by interfering with posteriorising Wnt signals during
gastrulation (Niehrs, 1999
).
Thus, if Dkk1 acts via Krm to affect Wnt signalling, then Krm overexpression
itself may mimic the effects of Dkk1. To test this, krm2 mRNA was
microinjected into four to eight-cell stage embryos. This resulted in
anteriorised embryos, with large heads and cement glands, similar to what is
observed after dkk1 overexpression
(Fig. 4H-J). Consistent with
the anteriorised phenotype, animal caps from krm2 mRNA injected
embryos, like those injected with dkk1 mRNA, show upregulation of the
anterior neural markers otx2
(Blitz and Cho, 1995
) and
XAG1 (Sive et al.,
1989
), and the pan neural marker NCAM
(Tonissen and Krieg, 1993
)
(Fig. 4K). To test if this
anteriorisation is due to inhibition of posteriorising Wnt signalling, embryos
were microinjected with pCSKA-Xwnt8 DNA, which induces microcephalic
embryos, lacking eyes and cement gland
(Christian and Moon, 1993
)
(Fig. 4L,M). When
pCSKA-Xwnt8 is co-injected with krm2, normal head formation
is restored (Fig. 4N). Thus,
similar to dkk1, krm2 overexpression dorsoanteriorises early
Xenopus embryos and it does so by inhibiting posteriorising Wnt
signals.
If Krm proteins act as receptors for Dkk1 to inhibit Wnt/LRP signalling in Xenopus, one would expect excess Krm to compensate for a reduction in Dkk1 activity. This is indeed the case, as shown by the ability of injected krm2 mRNA to rescue embryos posteriorised by inhibitory anti-Dkk1 antibody (Fig. 4O-Q). krm1 mRNA also rescues this Dkk1 loss-of-function phenotype (data not shown). In the reverse situation, dkk1 overexpression shows partial rescue of the phenotype elicited by krm1/2 antisense morpholino (Mo) (see below) injected embryos (data not shown).
Kremens are required for anterior neural development
Dkk1 is essential for formation of the anterior CNS, both in
Xenopus and mouse (Glinka et al.,
1998
; Mukhopadhyay et al.,
2001
). To test if Krms are likewise required for Xenopus
anterior CNS development we first injected mRNA encoding a soluble form of
Krm2, containing all extracellular domains but lacking transmembrane and
intracellular regions, as we reasoned it might function as a dominant
negative. However, this was not the case (data not shown), suggesting that
membrane attachment of Krm proteins is important for mediating Wnt/LRP
inhibition by Dkk1.
We therefore injected morpholino-antisense oligonucleotides (Mo), which
function as specific translational inhibitors in both Xenopus and
zebrafish embryos (Heasman et al.,
2000
; Nasevicius and Ekker,
2000
; Heasman,
2002
). When co-injected into Xenopus embryos,
krm1 and krm2 Mo specifically inhibited translation of their
cognate mRNA target without affecting translation of the respective orthologue
(Fig. 5A). Phenotypically,
krm1-Mo injection has no effect, and krm2-Mo injection
yields mild anterior defects (not shown). However, as krm1 and
krm2 are co-expressed during early Xenopus embryogenesis,
they may function redundantly. Indeed, co-injection of krm1 and
krm2-Mo (krm1/2-Mo) results in microcephaly
(Fig. 5B,C). In addition, axial
malformations such as bent and shortened trunks were observed. These defects
could be partially rescued by co-injection of plasmid DNA encoding
N-terminally modified krm2 DNA (lacking the antisense-Mo target
sequence; Fig. 5D), indicating
that the phenotype was specific. Krm1/2-Mo injected embryos showed
reduced expression of the forebrain marker bf1
(Bourguignon et al., 1998
)
(Fig. 5E-H), but the midbrain
marker en2 appeared normal (Fig.
5G,H).
|
If Krms function downstream of Dkk1 to inhibit Wnt signalling during head
induction, krm1/2-Mo should enhance the phenotype produced by a
reduction of Dkk1 activity. This is indeed the case
(Fig. 5I-P). Co-injection of
limiting amounts of an inhibitory anti-Dkk1 antibody
(Glinka et al., 1998
) with
krm1/2-Mo results in embryos with head defects far more severe than
seen in either krm1/2-Mo or anti-Dkk1 antibody-injected embryos. In
situ hybridisation for bf1 shows that reduction of prospective
forebrain territory in these embryos at neurula stage parallels the phenotypic
deficiencies (Fig. 5Q-T).
Together, these data indicate that Krm proteins functionally interact with
Dkk1 to inhibit posteriorising Wnts during embryonic head development.
| DISCUSSION |
|---|
|
|
|---|
To address these questions, we have isolated and characterised Xenopus Krm genes, and have shown that they functionally interact with dkk1 in vivo. Furthermore we provide evidence that this interaction is required for the formation of the anterior CNS. In axis duplication assays krm2 synergises with dkk1 in inhibiting Wnt/LRP6 signalling. In these experiments, the inability of dkk1 to inhibit Wnt/LRP6 signalling is overcome by co-expression of krm2, suggesting that endogenous Krm proteins become limiting. By themselves, Krm1 and Krm2 are unable to inhibit Wnt signalling in these assays, when no endogenous Dkk1 is present. This suggests that Krm and Dkk1 are required equally to block Wnt/LRP signalling. This conclusion is also supported by the findings that both the Dkk1 antibody and krm1/2 Mo phenotypes can be rescued by overexpressed krm and dkk1, respectively. Furthermore, the synergistic effect of combined Krm and Dkk1 loss-of-function indicate that Krm proteins are physiologically relevant receptors that mediate Dkk1 inhibition of Wnt/ß-catenin signalling.
Krm1 and Krm2 are thus transmembrane inhibitors of a Wnt/ß-catenin
signalling pathway, the significance of which in vertebrate AP patterning is
emerging. Highlighting the role of Wnt/ß-catenin signalling in posterior
specification, inactivation of members of the Wnt1 class of ligands, both in
the mouse (Takada et al.,
1994
) and zebrafish (Erter et
al., 2001
; Levken et al.,
2001
), as well as of the murine Wnt/ß-catenin specific
transducer Lrp6 (Pinson et al.,
2000
), leads to posterior defects. In addition, combined loss of
the murine Tcf1 and Lef1 transcription factor genes, which
mediate downstream Wnt/ß-catenin target gene activation, results in
similar posterior deficiencies (Galceran
et al., 1999
). In contrast to mutations in stimulatory components
of the Wnt/ß-catenin pathway, mutations in both zebrafish axin
(masterblind) and tcf3 (headless) genes, which
encode intracellular inhibitory components of the Wnt/ß-catenin pathway,
result in anterior neural deficiencies limited to the forebrain and its
derivatives (Kim et al., 2000
;
Heisenberg et al., 2001
;
van de Water et al., 2001
).
The latter mutant phenotypes are similar to the loss-of-function of Dkk1 in
frog and mouse (Glinka et al.,
1998
; Mukhopadhyay et al.,
2001
). Thus, studies from loss-of-function mutations provides
substantial genetic evidence to support a conserved and essential role for
Wnt/ß-catenin signalling in vertebrate AP patterning and inhibition of
this pathway during anterior CNS formation. The data presented here are
consistent with the proposal that Krm proteins are required co-receptors for
Dkk1 to inhibit Wnt/LRP signalling and apparently independent of Dishevelled
(Dsh) (Li et al., 2002
),
thereby promoting anterior CNS formation
(Fig. 6).
|
Role of Kremen in embryonic development
krm1 is expressed maternally, and in both mouse and frog it is
expressed in early anterior neural folds. Furthermore, both Xenopus
krm1 and krm2 are co-expressed with dkk1 in the
prechordal plate underlying the anterior neurectoderm. These expression
domains are consistent with a role of Krm proteins during early anterior
development. Maternal krm1 mRNA suggests that there is also maternal
protein which would not be affected by morpholino knockdown. Hence, the
observed phenotype may be hypomorphic. Similar to the loss-of-function of Dkk1
in frog and mouse (Glinka et al.,
1998
; Mukhopadhyay et al.,
2001
), the observed neural deficiencies are limited to the
forebrain and its derivatives, as in cases of mutations of intracellular Wnt
inhibitors (Kim et al., 2000
;
Heisenberg et al., 2001
;
van de Water et al., 2001
).
Conversely, zebrafish wnt8 mutants show expanded forebrain
(Levken et al., 2001
),
indicating that this region of the CNS is most sensitive to Wnt/ß-catenin
signalling, while more posterior CNS structures may become affected only in
compound mutants of Wnt inhibitors.
At tadpole stages, dkk1, krm1 and krm2 show complex
expression patterns, with co-expression observed in the otic vesicle, fin
mesenchyme and proctodeum, where the genes may interact. During mouse
organogenesis, dkk1, krm1 and krm2 are co-expressed in the
apical ectodermal ridge of mouse limb buds
(Monaghan et al., 1999
;
Nakamura et al., 2001
) (and
results presented here). As Dkk1 is required for limb formation
(Mukhopadhyay et al., 2001
),
it may interact with Krm proteins in this context to inhibit the Wnt receptor
LRP6, which is ubiquitously expressed during embryogenesis
(Pinson et al., 2000
).
However, although there are several sites of dkk1/krm co-expression,
it cannot be excluded that Dkk1 can also function independently of Krm1 and
Krm2, e.g. by recruiting yet unknown co-receptors. Likewise, their multidomain
ECDs and the intracellular domain raise the likely possibility that Krm
proteins have functions in addition to mediating Dkk1 action. The prominent
expression, e.g. in trunk mesoderm, where Dkk genes are not expressed and mild
trunk defects observed following morpholino knockdown would be consistent with
such additional functions. One other potentially relevant, high-affinity
ligand for Krm1 and Krm2 is Dkk2, which is co-expressed with krm1 in
branchial arch, otic and optic vesicles and limb bud
(Monaghan et al., 1999
;
Wu et al., 2000
;
Nakamura et al., 2001
).
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bachiller, D., Klingensmith, J., Kemp, C., Belo, J. A., Anderson, R. M., May, S. R., McMahon, J. A., McMahon, A. P., Harland, R. M., Rossant, J. et al. (2000). The organizer factors Chordin and Noggin are required for mouse forebrain development. Nature 403,658 -661.[CrossRef][Medline]
Bafico, A., Liu, G., Yaniv, A., Gazit, A. and Aaronson, S. A. (2001). Novel mechanism of Wnt signalling inhibition mediated by Dickkopf-1 interaction with LRP6/Arrow. Nat. Cell Biol. 3,683 -686.[CrossRef][Medline]
Blitz, I. L. and Cho, K. W. Y. (1995). Anterior neuroectoderm is progressively induced during gastrulation: the role of the Xenopus homeobox gene orthodenticle. Development 121,993 -1004.[Abstract]
Bork, P. and Beckmann, G. (1993). The CUB domain. A widespread module in developmentally regulated proteins. J. Mol. Biol. 231,539 -545.[CrossRef][Medline]
Bourguignon, C., Li, J. and Papalopulu, N. (1998). XBF-1, a winged helix transcription factor with dual activity, has a role in positioning neurogenesis in Xenopus competent ectoderm. Development 125,4889 -4900.[Abstract]
Bouwmeester, T., Kim, S.-H., Sasai, Y., Lu, B. and de Robertis, E. M. (1996). Cerberus is a head-inducing secreted factor expressed in the anterior endoderm of Spemann's organizer. Nature 382,595 -601.[CrossRef][Medline]
Castellino, F. J. and McCance, S. G. (1997). The kringle domains of human plasminogen. Ciba Found. Symp. 212,46 -60.[Medline]
Chang, C. and Hemmati-Brivanlou, A. (1998). Cell fate determination in embryonic ectoderm. J. Neurobiol. 36,128 -151.[CrossRef][Medline]
Chapman, S. C., Schubert, F. R., Schoenwolf, G. C. and Lumsden, A. (2002). Analysis of spatial and temporal gene expression patterns in blastula and gastrula stage chick embryos. Dev. Biol. 245,187 -199.[CrossRef][Medline]
Christian, J. L. and Moon, R. T. (1993).
Interactions between Xwnt-8 and Spemann organizer signaling pathways generate
dorsoventral pattern in the embryonic mesoderm of Xenopus. Genes
Dev. 7,13
-28.
Church, W. R., Ouellette, L. A. and Messier, T. L.
(1991). Modulation of human prothrombin activation on
phospholipid vesicles and platelets using monoclonal antibodies to prothrombin
fragment 2. J. Biol. Chem.
266,8384
-8391.
Deardorff, M. A., Tan, C., Conrad, L. J. and Klein, P. S. (1998). Frizzled-8 is expressed in the Spemann organizer and plays a role in early morphogenesis. Development 125,2687 -2700.[Abstract]
Doniach, T. and Musci, T. J. (1995). Induction of anteroposterior neural pattern in Xenopus: evidence for a quantitative mechanism. Mech. Dev. 53,403 -413.[CrossRef][Medline]
Dupe, V. and Lumsden, A. (2001). Hindbrain
patterning involves graded responses to retinoic acid signalling.
Development 128,2199
-2208.
Erter, C. E., Wilm, T. P., Basler, N., Wright, C. V. and
Solnica-Krezel, L. (2001). Wnt8 is required in lateral
mesendodermal precursors for neural posteriorization in vivo.
Development 128,3571
-3583.
Fainsod, A., Deißler, K., Yelin, R., Marom, M., Epstein, M., Pillemer, G., Steinbeisser, H. and Blum, M. (1997). The dorsalizing and neural inducing gene follistatin is an antagonist of Bmp-4. Mech. Dev. 63,39 -50.[CrossRef][Medline]
Fekany-Lee, K., Gonzalez, E., Miller-Bertoglio, V. and Solnica-Krezel, L. (2000). The homeobox gene bozozok promotes anterior neuroectoderm formation in zebrafish through negative regulation of BMP2/4 and Wnt pathways. Development 127,2333 -2345.[Abstract]
Galceran, J., Farinas, I., Depew, M. J., Clevers, H. and
Grosschedl, R. (1999). Wnt3a-/- like phenotype and
limb deficiency in Lef1-/-Tcf1-/- mice. Genes
Dev. 13,709
-717.
Gawantka, V., Delius, H., Hirschfeld, K., Blumenstock, C. and Niehrs, C. (1995). Antagonizing the Spemann organizer: role of the homeobox gene Xvent-1. EMBO J. 14,6268 -6279.[Medline]
Gilbert, S. F. and Saxen, L. (1993). Spemann's organizer: models and molecules. Mech. Dev. 41, 73-89.[CrossRef][Medline]
Glinka, A., Wu, W., Onichtchouk, D., Blumenstock, C. and Niehrs, C. (1997). Head induction by simultaneous repression of Bmp and wnt signalling in Xenopus. Nature 389,517 -519.[CrossRef][Medline]
Glinka, A., Wu, W., Delius, H., Monaghan, P. A., Blumenstock, C. and Niehrs, C. (1998). Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Nature 391,357 -362.[CrossRef][Medline]
Goretzki, L., Lombardo, C. R. and Stallcup, W. B.
(2000). Binding of the NG2 proteoglycan to kringle domains
modulates the functional properties of angiostatin and plasmin(ogen).
J. Biol. Chem. 275,28625
-28633.
Gschwend, T. P., Krueger, S. R., Kozlov, S. V., Wolfer, D. P. and Sonderegger, P. (1997). Neurotrypsin, a novel multidomain serine protease expressed in the nervous system. Mol. Cell. Neurosci. 9,207 -219.[CrossRef][Medline]
Harland, R. and Gerhart, J. (1997). Formation and function of Spemann's organizer. Annu. Rev. Cell Dev. Biol, 13,611 -667.[CrossRef][Medline]
Hashimoto, H., Itoh, M., Yamanaka, Y., Yamashita, S., Shimizu, T., Solnica-Krezel, L., Hibi, M. and Hirano, T. (2000). Zebrafish Dkk1 Functions in Forebrain Specification and Axial Mesendoderm Formation. Dev. Biol. 217,138 -152.[CrossRef][Medline]
Heasman, J. (2002). Morpholino oligos: making sense of antisense? Dev. Biol. 243,209 -214.[CrossRef][Medline]
Heasman, J., Kofron, M. and Wylie, C. (2000). Beta-catenin signaling activity dissected in the early Xenopus embryo: a novel antisense approach. Dev. Biol. 222,124 -134.[CrossRef][Medline]
Heisenberg, C. P., Houart, C., Take-Uchi, M., Rauch, G. J.,
Young, N., Coutinho, P., Masai, I., Caneparo, L., Concha, M. L., Geisler, R.
et al. (2001). A mutation in the Gsk3-binding domain of
zebrafish Masterblind/Axin1 leads to a fate transformation of telencephalon
and eyes to diencephalon. Genes Dev.
15,1427
-1434.
Hemmati-Brivanlou, A., Kelly, O. G. and Melton, D. A. (1994). Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity. Cell 77,283 -295.[CrossRef][Medline]
Hongo, I., Kengaku, M. and Okamoto, H. (1999). FGF signaling and the anterior neural induction in Xenopus. Dev Biol. 216,561 -581.[CrossRef][Medline]
Hoppler, S., Brown, J. D. and Moon, R. T.
(1996). Expression of a dominant-negative wnt blocks induction of
MyoD in Xenopus embryos. Genes Dev.
10,2805
-2817.
Hsieh, J. C., Kodjabachian, L., Rebbert, M. L., Rattner, A., Smallwood, P. M., Samos, C. H., Nusse, R., Dawid, I. B. and Nathans, J. (1999). A new secreted protein that binds to Wnt proteins and inhibits their activities. Nature 398,431 -436.[CrossRef][Medline]
Itoh, K., Tang, T. L., Neel, B. G. and Sokol, S. Y. (1995). Specific modulation of ectodermal cell fates in Xenopus embryos by glycogen synthase kinase. Development 121,3979 -3988.[Abstract]
Kazanskaya, O., Glinka, A. and Niehrs, C. (2000). The role of Xenopus dickkopf1 in prechordal plate specification and neural patterning. Development 127,4981 -4992.[Abstract]
Kiecker, C. and Niehrs, C. (2001). A morphogen gradient of Wnt/beta-catenin signaling regulates anteroposterior neural patterning in Xenopus. Development (in press).
Kim, C.-H., Oda, T., Itoh, M., Jiang, D. I., Artinger, K., Chandrasekharappa, S. C., Driever, W. and Chitnis, A. B. (2000). Repressor activity of Headless/Tcf3 is essential for vertebrate head formation. Nature 407,916 -920.[CrossRef][Medline]
Koop, K. E., MacDonald, L. M. and Lobe, C. G. (1996). Transcripts of Grg4, a murine groucho-related gene, are detected in adjacent tissues to other murine neurogenic gene homologues during embryonic development. Mech. Dev. 59, 73-87.[CrossRef][Medline]
Krupnik, V. E., Sharp, J. D., Jiang, C., Robison, K., Chickering, T. W., Amaravadi, L., Brown, D. E., Guyot, D., Mays, G., Leiby, K. et al. (1999). Functional and structural diversity of the human Dickkopf gene family. Gene 238,301 -313.[CrossRef][Medline]
Kurosky, A., Barnett, D. R., Lee, T. H., Touchstone, B., Hay, R.
E., Arnott, M. S., Bowman, B. H. and Fitch, W. M. (1980).
Covalent structure of human haptoglobin: a serine protease homolog.
Proc. Natl. Acad. Sci. USA
77,3388
-3392.
Levken, A. C., Thorpe, C. J., Waxman, J. S. and Moon, R. T. (2001). Zebrafish wnt8 encodes two proteins on a bicistronic transcript and is required for mesoderm and neurectoderm patterning. Dev. Cell 1,103 -114.[CrossRef][Medline]
Leyns, L., Bouwmeester, T., Kim, S.-H., Piccolo, S. and de Robertis, E. M. (1997). Frzb-1 is a secreted antagonist of wnt-signals expressed in the Spemann organizer. Cell 88,747 -756.[CrossRef][Medline]
Li, L., Mao, J., Sun, L., Liu, W. and Wu, D.
(2002). Second cysteine-rich domain of Dickkopf-2 activates
canonical Wnt signaling pathway via LRP-6 independently of dishevelled.
J. Biol. Chem. 277,5977
-5981.
Lodder, A. L., Lee, T. K. and Ballester, R.
(1999). Characterization of the Wsc1 protein, a putative receptor
in the stress response of Saccharomyces cerevisiae.
Genetics 152,1487
-1499.
Lumsden, A. and Krumlauf, R. (1996). Patterning
the vertebrate neuraxis. Science
274,1109
-1115.
Mao, B., Wu, W., Davidson, G., Marhold, J., Li, M., Mechler, B. M., Delius, H., Hoppe, D., Stannek, P., Walter, C. et al. (2002). Kremen proteins are Dickkopf receptors that regulate Wnt/B-catenin signalling. Nature 417,664 -667.[CrossRef][Medline]
Mao, B., Wu, W., Li, Y., Hoppe, D., Stannek, P., Glinka, A. and Niehrs, C. (2001). LDL-receptor-related protein 6 is a receptor for Dickkopf proteins. Nature 411,321 -325.[CrossRef][Medline]
McGrew, L. L., Lai, C. J. and Moon, R. T. (1995). Specification of the anteroposterior neural axis through synergistic interaction of the Wnt signaling cascade with noggin and follistatin. Dev. Biol. 172,337 -342.[CrossRef][Medline]
Meno, C., Gritsman, K., Ohishi, S., Ohfuji, Y., Heckscher, E., Mochida, K., Shimono, A., Kondoh, H., Talbot, W. S., Robertson, E. J. et al. (1999). Mouse Lefty2 and zebrafish antivin are feedback inhibitors of nodal signaling during vertebrate gastrulation. Mol. Cell 4,287 -298.[CrossRef][Medline]
Monaghan, A. P., Kioschis, P., Wu, W., Zuniga, A., Bock, D., Poustka, A., Delius, H. and Niehrs, C. (1999). Dickkopf genes are co-ordinately expressed in mesodermal lineages. Mech. Dev. 87,45 -56.[CrossRef][Medline]
Mukhopadhyay, M., Shtrom, S., Rodriguez-Esteban, C., Chen, L., Tsuku, T., Gomer, L., Dorward, D. W., Glinka, A., Grinberg, A., Huang, S.-P. et al. (2001). Dickkopf1 is required for embryonic head induction and limb morphogenesis in the mouse. Dev. Cell 1,423 -434.[CrossRef][Medline]
Nakamura, T., Aoki, S., Kitajima, K., Takahashi, T. and Matsumoto, K. (2001). Molecular cloning and characterization of Kremen, a novel kringle-containing transmembrane protein. Biochim. Biophys. Acta 1518,63 -72.[Medline]
Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene `knockdown' in zebrafish. Nat. Genet. 26,216 -220.[CrossRef][Medline]
Niehrs, C. (1999). Head in the Wnt- the molecular nature of Spemann's head organizer. Trends Genet. 15,314 -319.[CrossRef][Medline]
Nieuwkoop, P. D. (1997). Short historical survey of pattern formation in the endo-mesoderm and the neural anlage in the vertebrates: the role of vertical and planar inductive actions. Cell Mol. Life Sci. 53,305 -318.[CrossRef][Medline]
Nordstrom, U., Jessell, T. M. and Edlund, T. (2002). Progressive induction of caudal neural character by graded Wnt signaling. Nat. Neurosci. 13, 13.
Patthy, L., Trexler, M., Vali, Z., Banyai, L. and Varadi, A. (1984). Kringles: modules specialized for protein binding. Homology of the gelatin-binding region of fibronectin with the kringle structures of proteases. FEBS Lett. 171,131 -136.[CrossRef][Medline]
Pera, E. M., Wessely, O., Li, S. Y. and de Robertis, E. M. (2001). Neural and head induction by insulin-like growth factor signals. Dev. Cell 1,655 -665.[CrossRef][Medline]
Piccolo, S., Agius, E., Leyns, L., Bhattacharyya, S., Grunz, H., Bouwmeester, T. and de Robertis, E. M. (1999). The head inducer Cerberus is a multifunctional antagonist of Nodal, BMP and Wnt signals. Nature 397,707 -710.[CrossRef][Medline]
Pierce, S. B. and Kimelman, D. (1996). Overexpression of Xgsk-3 disrupts anterior ectodermal patterning in Xenopus. Dev. Biol. 175,256 -264.[CrossRef][Medline]
Pinson, K. I., Brennan, J., Monkley, S., Avery, B. J. and Skarnes, W. C. (2000). An LDL-receptor-related protein mediates Wnt signalling in mice. Nature 407,535 -538.[CrossRef][Medline]
Rattner, A., Hsieh, J.-C., Smallwood, P. M., Gilbert, D.,
Copeland, N. G., Jenkins, N. A. and Nathans, J. (1997). A
family of secreted proteins contains homology to the cysteine-rich ligand
binding domain of frizzled receptors. Proc. Natl. Acad. Sci.
USA 94,2859
-2863.
Richard-Parpaillon, L., Heligon, C., Chesnel, F., Boujard, D. and Philpott, A. (2002). The IGF pathway regulates head formation by inhibiting Wnt signaling in Xenopus. Dev. Biol. 244,407 -417.[CrossRef][Medline]
Sasai, Y. and de Robertis, E. M. (1997). Ectodermal patterning in vertebrate embryos. Dev. Biol. 182,5 -20.[CrossRef][Medline]
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and de Robertis, E. M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79,779 -790.[CrossRef][Medline]
Schier, A. F. and Shen, M. M. (2000). Nodal signalling in vertebrate development. Nature 403,385 -389.[CrossRef][Medline]
Semenov, M. V., Tamai, K., Brott, B. K., Kuhl, M., Sokol, S. and He, X. (2001). Head inducer Dickkopf-1 is a ligand for Wnt coreceptor LRP6. Curr. Biol. 11,951 -961.[CrossRef][Medline]
Shanmugalingam, S., Houart, C., Picker, A., Reifers, F., Macdonald, R., Barth, A., Griffin, K., Brand, M. and Wilson, S. W. (2000). Ace/Fgf8 is required for forebrain commissure formation and patterning of the telencephalon. Development 127,2549 -2561.[Abstract]
Shimamura, K., Hartigan, D. J., Martinez, S., Puelles, L. and Rubenstein, J. L. (1995). Longitudinal organization of the anterior neural plate and neural tube. Development 121,3923 -3933.[Abstract]
Shinya, M., Eschbach, C., Clark, M., Lehrach, H. and Furutani-Seiki, M. (2000). Zebrafish Dkk1, induced by the pre-MBT Wnt signaling, is secreted from the prechordal plate and patterns the anterior neural plate. Mech. Dev. 98, 3-17.[CrossRef][Medline]
Shinya, M., Koshida, S., Sawada, A., Kuroiwa, A. and Takeda,
H. (2001). Fgf signalling through MAPK cascade is required
for development of the subpallial telencephalon in zebrafish embryos.
Development 128,4153
-4164.
Sive, H., Hattori, K. and Weintraub, H. (1989). Progressive determination during formation of the anteroposterior axis in Xenopus laevis. Cell 58,171 -180.[CrossRef][Medline]
Smith, W. C. and Harland, R. M. (1992). Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos. Cell 70,829 -840.[CrossRef][Medline]
Stern, C. D. (2001). Initial patterning of the central nervous system: How many organizers? Nat. Rev. Neurosci. 2,92 -98.[CrossRef][Medline]
Streit, A., Berliner, A. J., Papanayotou, C., Sirulnik, A. and Stern, C. D. (2000). Initiation of neural induction by FGF signalling before gastrulation. Nature 406, 74-78.[CrossRef][Medline]
Streit, A. and Stern, C. D. (1999). Neural induction. A bird's eye view. Trends Genet 15, 20-24.[CrossRef][Medline]
Takada, S., Stark, K. L., Shea, M. J., Vassileva, G. and
McMahon, J. A. (1994). Wnt-3a regulates somite and tailbud
formation in the mouse embryo. Genes Dev.
8, 174-189.
Thery, C. and Stern, C. D. (1996). Roles of kringle domain-containing serine proteases in epithelial-mesenchymal transitions during embryonic development. Acta Anat. 156,162 -172.[Medline]
Thisse, B., Wright, C. V. and Thisse, C. (2000). Activin- and Nodal-related factors control antero-posterior patterning of the zebrafish embryo. Nature 403,425 -428.[CrossRef][Medline]
Thisse, C. and Thisse, B. (1999). Antivin, a novel and divergent member of the TGFbeta superfamily, negatively regulates mesoderm induction. Development 126,229 -240.[Abstract]
Tonissen, K. F. and Krieg, P. A. (1993). Two neural-cell adhesion molecule (NCAM)-encoding genes in Xenopus laevis are expressed during development and in adult tissues. Gene 127,243 -247.[CrossRef][Medline]
van de Water, S., van de Wetering, M., Joore, J., Esseling, J.,
Bink, R., Clevers, H. and Zivkovic, D. (2001). Ectopic Wnt
signal determines the eyeless phenotype of zebrafish masterblind mutant.
Development 128,3877
-3888.
Wang, S., Krinks, M., Lin, K., Luyten, F. P. and Moos, M. (1997). Frzb, a secreted protein expressed in the Spemann organizer, binds and inhibits Wnt-8. Cell 88,757 -766.[CrossRef][Medline]
Wehrli, M., Dougan, S. T., Caldwell, K., O'Keefe, L., Schwartz, S., Vaizel-Ohayon, D., Schejter, E., Tomlinson, A. and DiNardo, S. (2000). arrow encodes an LDL-receptor-related protein essential for Wingless signalling. Nature 407,527 -530.[CrossRef][Medline]
Wilson, S. I., Graziano, E., Harland, R., Jessell, T. M. and Edlund, T. (2000). An early requirement for FGF signalling in the acquisition of neural cell fate in the chick embryo. Curr. Biol. 10,421 -429.[CrossRef][Medline]
Wu, W., Glinka, A., Delius, H. and Niehrs, C. (2000). Mutual antagonism between dickkopf1 and -2 regulates Wnt/beta-catenin signalling. Curr. Biol. 10,1611 -1614.[CrossRef][Medline]
| ||||||||||