|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00150
1 Department of Medicine (Hematology Oncology) and Howard Hughes Medical
Institute, University of Pennsylvania School of Medicine, Philadelphia, PA
19104, USA
2 Department of Cell Biology, Weill Medical College of Cornell University, 1300
York Avenue, New York, NY 10021, USA
* Author for correspondence (e-mail: pklein{at}mail.med.upenn.edu)
Accepted 4 September 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Wnt, ß-catenin, Tcf, LEF, Midblastula transition, transcription, Xenopus embryo, Lithium
| INTRODUCTION |
|---|
|
|
|---|
Recently, maternal ß-catenin protein was depleted in Xenopus
embryos by the use of morpholino antisense oligonucleotides, which block
translation of the endogenous mRNA
(Heasman et al., 2000
). When
ß-catenin was depleted at the four-cell stage, dorsal development was
profoundly inhibited, similar to previous results depleting ß-catenin in
the oocyte (Heasman et al.,
1994
). However, when ß-catenin was depleted later, at the
eight-cell or 16-cell stage, dorsal development was only minimally inhibited.
These observations imply that ß-catenin functions in early embryos,
before the MBT and at a time when zygotic transcription is widely believed to
be repressed.
The MBT is an embryonic milestone that marks the transition from rapid,
synchronous cell divisions and minimal zygotic transcription to loss of
synchrony in cell divisions, a sudden burst of zygotic transcription and the
onset of cell motility. Elegantly characterized in Xenopus by the
landmark work of Newport and Kirschner, the MBT appears to be a general
phenomenon of metazoan development. In Xenopus, the transcriptional
apparatus is present in the pre-MBT embryo
(Newport and Kirschner, 1982b
;
Prioleau et al., 1994
), and
thus, as shown by Newport and Kirschner, the lack of zygotic gene expression
appears to be because of global repression of transcription through a still
uncharacterized mechanism that may in part involve regulated methylation of
DNA prior to MBT (Stancheva et al.,
2002
). Because of this, work on pre-MBT embryonic development has
focused primarily on post-transcriptional control mechanisms. Low-level
transcription has been detected before MBT in Xenopus and
Drosophila (Edgar and Schubiger,
1986
; Kimelman et al.,
1987
; Nakakura et al.,
1987
; Shiokawa et al.,
1989
; Yasuda and Schubiger,
1992
), but the significance of this early transcription is not
known. Nevertheless, regulated transcription of specific mRNAs has not been
described in vertebrate embryos and, except for Drosophila engrailed
(discussed below) (Karr et al.,
1989
), little attention has been given to zygotic transcription as
a regulatory mechanism in the pre-MBT embryo.
Because previous work in Xenopus has shown that the Wnt/ß-catenin pathway must be activated prior to MBT to initiate dorsal gene expression and ß-catenin functions as a transcriptional activator when it associates with Tcf, we have investigated whether ß-catenin and Tcf regulate transcription prior to the MBT. We demonstrate for the first time that regulated transcription occurs in pre-MBT Xenopus embryos and show that ß-catenin and Tcf specifically regulate pre-MBT transcription of the nodal genes Xnr5 and Xnr6 in dorsal blastomeres. We also provide evidence that pre-MBT ß-catenin/Tcf-dependent transcription regulates dorsal-ventral patterning and dorsal gene expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid construction
ßTGR was generated by cloning dn-Xtcf3 (lacking the first 87
amino acids) into the vector CS2-hGRN, which encodes the ligand-binding domain
of the human glucocorticoid receptor (residues 513-777) in pCS2. The resulting
fusion encodes an N-terminal glucocorticoid-binding domain and a
C-terminal dn-Xtcf3. The dn-Xtcf3 plasmid for this construct was provided by
Alin Vonica (Vonica et al.,
2000
).
In vivo labeling of RNA and oligo-dT chromatography
For in vivo labeling of RNA, embryos were injected at the two-cell stage
with 10
l of [32P]UTP (10 µCi µl-1; 3000 Ci
mmol-1) into each blastomere and cultured in medium with or without
ActD (10 µg mL-1) at 22-23°C. Embryos were harvested at the
128-, 512- or 2048-cell stages (corresponding to the seventh, ninth or
eleventh cell cycle, respectively). Total RNA was extracted according to
standard procedures; polyA+ RNA was purified using an oligo-dT kit from
Qiagen. Total RNA (5 µg) and polyA+ RNA were analyzed by 1.0% agarose gel
electrophoresis. Gels were then fixed in 10% methanol/10% acetic acid, dried
and exposed to a phosphorimager.
RT-PCR and luciferase assay
RNA extraction and RT-PCR methods were as described previously
(Deardorff et al., 1998
), using
30 cycles of PCR for detection of Siamois, Xnr3, Xnr5 and Xnr6.
Primers used were as follows: EF1-
(F, CAGATTGGTGCTGGATATGC,
R, ACTGCCTTGATGACTCCTAG); Siamois (F, AACTTTCTCCAGAACC; R,
GTCAGTGTGGTGATTC); Xnr3 (F, ATCCAACTAACTACATCG, R,
TAGTGGGACAAGAAGTGC); FGFR (F, AGTGCATCCACAGAGACC; R,
ACTCAGAGCAAGAATTCGG); ODC (F, AATGGATTTCAGAGACCA; R,
CCAAGGCTAAAGTTGCAG); Xnr5 (F, TCACAATCCTTTCACTAGGGC; R,
GGAACCTCTGAAAGGAAGGC); and Xnr6 (F, TCCAGTATGATCCATCTGTTGC; R,
TTCTCGTTCCTCTTGTGCCTT).
For the luciferase assay, 50 pg of Lef-fos plasmid [a
promoterreporter construct containing seven Lef binding sites, a
minimal promoter and the luciferase open reading frame
(Hsu et al., 1998
)] and 25 pg
of pRL-SV40 (a Renilla luciferase control for injection) were injected with
mRNAs as described in Results. Embryos were harvested at the indicated stages
(five embryos/group). Luciferase assay was performed with a dual luciferase
assay kit (Promega), according to the manufacturer's instructions. The results
are normalized to renilla luciferase activity.
| RESULTS |
|---|
|
|
|---|
|
These observations suggest that dn-Xtcf3 must be present during early
cleavages in order to block dorsal development. However, injection at
different stages, even separated by one cell division, could result in
different distribution of injected mRNA or different levels of dn-Xtcf3
protein in embryos. To test whether similar levels of functional dn-Xtcf3
protein are synthesized when RNA is injected at the four-cell or the 16-cell
stage, we co-injected dn-Xtcf3 mRNA with a Tcf/LEF luciferase reporter
(Hsu et al., 1998
) and found
that luciferase activity (measured after the onset of MBT) was reduced to a
similar extent whether RNA was injected at the four-cell or 16-cell stage
(Fig. 1E). Thus, the failure to
ventralize when dn-Xtcf3 was injected at the 16-cell stage is not because of
reduced dn-Xtcf3 activity at MBT (Fig.
1E). Furthermore, to avoid injecting embryos at different stages,
we used dn-Xtcf3 fused to the glucocorticoid receptor (
ßTGR),
which can be activated by addition of dex. RNA encoding
ßTGR was
injected into both dorsal blastomeres at the four-cell stage. Dex was then
added at various stages and removed at the gastrula stage. Under these
conditions, all embryos are injected in the same way, distribution of mRNA
should be similar among all samples, translation of mRNA begins at the same
time for all samples, and inhibition of endogenous Tcf activity depends only
on the time that dex is added.
The percentage of ventralized embryos was highest when dex was added early
and decreased when dex was added later
(Fig. 1F). Thus, 36% of
ßTGR-expressing embryos were completely ventralized when dex was
added at the four-cell stage, whereas 32% had trunk and tail or tail only
(group II phenotype), and 32% showed the group III phenotype. However, when
dex was added at the 128-cell stage, none of the embryos were completely
ventralized, and only 11% showed group II phenotype, whereas 89% showed
complete dorsal development with either normal or slightly reduced heads
(Fig. 1F). In the absence of
dex,
ßTGR-injected embryos showed a mildly ventralized phenotype,
indicating that
ßTGR has slightly leaky activity. Dex had no
visible effect on uninjected embryos (not shown).
Because Tcf family members are well-characterized DNA-binding proteins
that, upon interaction with ß-catenin, activate transcription of specific
target genes, one interpretation of these observations is that
ß-catenin/Tcf activates transcription during pre-MBT development. Thus
dn-Xtcf3 injected at the 16-cell stage does not block dorsal development
because sufficient ß-catenin/Tcf-dependent transcripts accumulate before
dn-Xtcf3 is introduced (see Fig.
6A). An alternative hypothesis is that the
ß-cateninTcf complex is assembled or modified during early
cleavage stages to become impervious to dn-Xtcf3, but does not activate
transcription until the MBT. Because dn-Xtf3 does not bind ß-catenin, and
functions by competing for Tcf/LEF-binding sites in target promoters, this
explanation would imply a complex involving Tcf and its DNA target sites (for
details, see Tutter et al.,
2001
). The critical distinguishing feature of these two hypotheses
is the time at which ß-catenin/Tcf-dependent transcription begins. Thus,
if ß-catenin/Tcf transcription begins in the pre-MBT embryo, the effect
of dn-Xtcf3 in cleavage-stage embryos should be sensitive to inhibition of
transcription during this early time; furthermore, transcription of
ß-catenin/Tcf-dependent target genes prior to MBT should be observed
directly and the transcriptional activity of endogenous Tcf should be required
during pre-MBT stages for dorsal development. Each of these predictions was
tested and the results support a role for pre-MBT ß-catenin/Tcf-regulated
transcription in dorsal development.
|
Tcf function in pre-MBT embryos is sensitive to a general inhibitor
of transcription
To address more directly whether transcription occurs in early cleavage
stages, we treated embryos at the two-cell stage with Actinomycin D (ActD), an
inhibitor of transcription that is membrane-permeable and reversible in
Xenopus embryos; ActD was removed at the eight- or 16-cell stage and
then dn-Xtcf3 mRNA was injected. If ß-catenin/Tcf-dependent transcription
occurs in early cleavage stages (two-cell to eight-or 16-cell stage), this
will be blocked by transient global inhibition of transcription during this
period. Injection of dn-Xtcf3 at the eight- or 16-cell stage should then
effectively inhibit dorsal development.
Indeed, ActD treatment strongly enhanced the ventralized phenotype caused
by dn-Xtcf3 RNA injection at the eight- or 16-cell stage, with 60%
(n=20 and 21, respectively) of embryos falling into group I, compared
with 9% for embryos not treated with ActD (n=21 and 22, respectively;
Fig. 2A). ActD alone from the
two- to the 16-cell stage had little, if any, effect on embryonic development
(Fig. 2A). These results were
confirmed by treating
ßTGR-injected embryos with ActD. Similar to
results in Fig. 1F, only weak
ventralization was observed when dex was added at the 32-cell stage; no
embryos developed the group I phenotype (n=21), compared with 35%
when dex was added at the four-cell stage for this set of embryos
(n=23). However, if transcription was blocked by ActD from the
four-cell to the 32-cell stage, and then dex was added, these embryos were
strongly ventralized, with 28% of embryos in group I, 50% in group II and only
22% in group III (n=18; Fig.
2B). RNA-injected embryos treated with ActD, but not dex, from the
four-cell to 32-cell stage did not show the group I phenotype (n=25;
Fig. 2B). As previously
reported, a morpholino antisense oligonucleotide against ß-catenin caused
strong ventralization when injected at the four-cell stage, but not at the
eight-cell stage (Heasman et al.,
2000
); we found that treatment with ActD from the two-cell to the
eight-cell stage enhanced ventralization caused by injection of this antisense
oligonucleotide at the eight-cell stage (data not shown).
|
Transcription of heterogeneous polyadenylated RNAs in intact embryos
prior to MBT
Although it is generally believed that minimal transcription occurs prior
to MBT, detection of high molecular weight RNA synthesized prior to MBT in
dissociated or cleavage-arrested embryos has been reported
(Kimelman et al., 1987
;
Nakakura et al., 1987
;
Shiokawa et al., 1989
).
However, this RNA had not been shown to be polyadenylated, a feature of most
mRNAs, and had not been described in intact embryos. To confirm that
polyadenylated RNA is transcribed prior to MBT in intact embryos,
[32P]UTP was injected into each blastomere of two-cell stage
embryos, which were then cultured in the presence or absence of ActD. Total
RNA was prepared from 128-cell (seventh-cell cycle), 512-cell (ninth-cell
cycle), or approximately 2000-cell (eleventh-cell cycle) embryos and was
analyzed by agarose gel electrophoresis and autoradiography. Newly synthesized
high molecular weight RNA was readily observed as early as the 512-cell stage
(the ninth-cell cycle) and increased at early stage eight, prior to MBT
(Fig. 3A). ActD reduced RNA
synthesis at all stages. This newly transcribed RNA included a heterogeneous
population of high molecular weight polyadenylated RNA, as determined by
oligo-dT affinity chromatography followed by agarose gel electrophoresis
(Fig. 3B). Furthermore, this
polyadenylated material was sensitive to treatment with RNaseA. Although the
identity of these [32P]-labeled species is unknown, (the discrete
bands in Fig. 3B could
represent mitochondrial mRNA), the incorporation of 32P-UTP into
heterogeneous high molecular weight species that are blocked by an RNA
polymerase inhibitor, bind to oligo-dT, and are degraded by RNaseA suggests
that this material is newly synthesized mRNA. It is also possible that mRNA is
synthesized prior to the 512-cell stage but falls below the level of detection
by our methods.
|
ß-Catenin and Tcf regulate the pre-MBT transcription of nodal
genes Xnr5 and Xnr6 in dorsal blastomeres
Several genes have been identified as targets of ß-catenin/Tcf and are
expressed at or soon after the MBT in Xenopus. These include
Siamois, Twin and nodal-related 1, 2, 3, 5 and 6
(Xnr1, 2, 3, 5 and 6)
(Brannon et al., 1997
;
Fan et al., 1998
;
Hyde and Old, 2000
;
Jones et al., 1995
;
Laurent et al., 1997
;
Lemaire et al., 1995
;
McKendry et al., 1997
;
Takahashi et al., 2000
). We
therefore re-examined the expression of these genes at stages prior to MBT by
RT-PCR. Consistent with published work, Xsia
(Fig. 4A), Xnr2 and
Xnr3 (not shown) were not detectable (after 30 cycles of PCR) prior
to stage 8.5; Xnr1 was detectable at a low level in maternal RNA but
did not change during pre-MBT stages (data not shown). Weak expression of
Twin was observed at the 1000-cell stage, but not earlier, in some
experiments (data not shown). However, using the same PCR conditions, we
detected Xnr5 and Xnr6 transcription as early as the
256-cell stage, and their expression levels continued to increase during
pre-MBT stages (Fig. 4A). To
address whether ß-catenin/Tcf signaling is involved in the pre-MBT
transcription of Xnr5 and Xnr6, we either activated or
inhibited ß-catenin/Tcf signaling and then measured Xnr5 and
Xnr6 mRNA levels as above. To increase ß-catenin activity, mRNA
encoding ß-catenin was injected into two ventral blastomeres at the
four-cell stage, or embryos were treated at the 32-cell stage with LiCl, which
stabilizes ß-catenin through inhibition of GSK-3ß
(Klein and Melton, 1996
;
Stambolic et al., 1996
). To
interfere with ß-catenin/Tcf function, a morpholino antisense
oligonucleotide against ß-catenin
(Heasman et al., 2000
) or mRNA
encoding dn-Xtcf3 (Molenaar et al.,
1996
) was injected into two dorsal blastomeres at the four-cell
stage. Injected embryos were harvested at the 1000-cell stage (prior to MBT)
and RT-PCR was performed. Expression of Xnr5 and Xnr6 was
enhanced by ventral injection of ß-catenin or exposure to LiCl
(Fig. 4B, lanes 2 and 3; see
also Fig. 4D, lane 6), and
markedly reduced by dorsal injection of the ß-catenin morpholino or
dn-Xtcf3 (Fig. 4B, lanes 4 and
5). The regulation of Xnr5 and Xnr6 is because of new
transcription, not changes in polyadenylation of the respective mRNAs, because
RT-PCR results were similar with either oligo-dT primed or random primed cDNA
(data not shown). Similar regulation by ß-catenin/Tcf was detectable for
Xnr5 at the 500-cell stage and for Xnr6 as early as the
256-cell stage (data not shown). Because pre-MBT Xnr5 and
Xnr6 expression was blocked by injection of ß-catenin antisense
morpholino or dn-Xtcf3 mRNA specifically into dorsal blastomeres, this
suggests that the pre-MBT transcription of these two targets is localized to
the dorsal blastomeres; to confirm this, embryos at the 500-cell stage were
dissected into dorsal and ventral halves and Xnr5 and Xnr6
mRNAs were detected in each half by RT-PCR. As shown in
Fig. 4C, pre-MBT transcription
of these two nodal genes is detected almost exclusively in dorsal blastomeres.
These findings demonstrate directly and for the first time that
ß-catenin/Tcf activates dorsal-specific transcription during pre-MBT
stages.
|
To test whether RNA polymerase inhibitors block pre-MBT transcription
activated by ß-catenin/Tcf, embryos were treated with ActD from the
four-cell to the 1000-cell stage and harvested for analysis of Xnr5
and Xnr6 expression. ActD reduced the pre-MBT transcription of
Xnr5 and Xnr6 (Fig.
4D, lane 4). Because ActD is a general inhibitor of transcription
that functions by intercalating into double-stranded DNA, we also tested two
specific inhibitors of RNA polymerase II, which function through mechanisms
that are distinct from ActD. Thus, we tested
5,6-dichloro-1-ß-D-ribofuranosylbenzimidazole (DRB), which specifically
inhibits transcription elongation by RNA polymerase II
(Chodosh et al., 1989
), and
-amanitin, which binds and specifically inhibits RNA polymerase II at
doses between 0.3 µg ml-1 and 1 µg ml-1 in
Xenopus embryos (Newport and
Kirschner, 1982a
). Embryos were injected with DRB or
-amanitin at the one-cell stage and harvested at the 1000-cell stage.
Both DRB and
-amanitin markedly reduced the pre-MBT transcription of
Xnr5 and Xnr6, although DRB showed a weaker activity in this
assay (comparing Fig. 4D, lanes
2 to 3). As a positive control, LiCl increased the expression of Xnr5
and Xnr6 (Fig. 4D,
lane 6; as in Fig. 4B). These
observations, based on the effects of three distinct inhibitors of
transcription, strongly support the conclusion that the early expression of
Xnr5 and Xnr6 requires RNA polymerase II-dependent
transcription prior to MBT.
ß-Catenin-dependent transcription is required prior to MBT for
dorsal development
These observations show that ß-catenin-dependent transcription occurs
during pre-MBT stages. To test whether ß-catenin-dependent transcription
is specifically required prior to MBT for dorsal development, we blocked
ß-catenin-dependent transcriptional activation, and then restored it at
various stages prior to and after MBT. Embryos were ventralized by injection
of mRNA encoding axin, a well-characterized inhibitor of ß-catenin
signaling that potently blocks dorsal development
(Zeng et al., 1997
), into both
dorsal blastomeres at the four-cell stage. To restore Tcf activation, we used
a hormone-inducible, activated form of Xtcf3 (TVGR), in which the
ß-catenin-binding site has been replaced with the VP16 transcription
activation domain (Darken and Wilson,
2001
). This construct was shown previously to induce dorsal axis
duplication if activated at the four-cell stage, but not if activated in the
gastrula stage, even though it is functional when activated at the gastrula
stage (Darken and Wilson,
2001
). TVGR mRNA was co-injected with axin, dex was added at
various stages to restore ß-catenin/Tcf-dependent transcription, and the
phenotype of manipulated embryos was scored at the tadpole stage.
Activation of TVGR prior to MBT (at the four-cell or the 500-cell stage) rescues dorsal development in ventralized embryos (Fig. 5A) and also rescues pre-MBT transcription of Xnr5 and Xnr6 (Fig. 5C). However, activation of TVGR at MBT or later does not rescue dorsal development, even though TVGR is transcriptionally active when dex is added after MBT. Thus, 92% of axin-injected embryos were completely ventralized (n=36) and this did not change significantly when TVGR mRNA was co-injected (83% group I embryos, n=23). The addition of hormone at the four-cell stage significantly rescued the phenotype, with only 36% of embryos showing the group I phenotype (n=33). Similar results were obtained when injected embryos were exposed to hormone at the 500-cell stage, with dorsal rescue in 58% of embryos (n=33). No rescue was observed when dex was added at MBT (n=40) or at late blastula (stage 9; n=41). To address the concern that activation of TVGR by dex might be too slow to induce dorsal gene expression when it is added at the onset of MBT or later, we used the Tcf/luciferase reporter construct described in Fig. 1E to measure the time required for TVGR to respond to dex. When dex was added at the onset of MBT, a robust increase in luciferase activity was observed within 90 minutes (Fig. 5B), indicating that TVGR-regulated transcription was induced well before this time point. Interestingly, when dex was added at the 128-cell stage, elevated reporter activity was also first detected 90 minutes after MBT, similar to addition of dex at MBT, indicating that this LEF promoter construct is not active prior to MBT, similar to most zygotic genes, and that pre-MBT activation of gene expression by ß-catenin is highly promoter-specific. Thus, we conclude that the activation of TVGR by dex is a rapid response.
|
To confirm that TVGR can activate transcription during pre-MBT stages
(Fig. 5C), Xnr5 and
Xnr6 expression was measured in ventralized embryos at the 1000-cell
stage. In axin-injected embryos, expression of Xnr5 and Xnr6
is markedly reduced, but their expression is rescued by activation of TVGR at
the four-cell stage (Fig. 5C,
compare lanes 2 and 4), confirming that TVGR can activate transcription prior
to MBT. (Similarly, dn-Xtcf3 inhibits pre-MBT transcription of Xnr5
and Xnr6, as described above.) Furthermore, although TVGR cannot
rescue dorsal development when it is activated after MBT, and does not rescue
expression of Siamois or Xnr3, it can still induce
transcription of selected endogenous targets when it is activated after MBT,
including engrailed (Darken and
Wilson, 2001
) and Xnr6
(Fig. 5D), confirming that the
construct is active after MBT. Because TVGR can activate transcription before
and after MBT but rescues dorsal development only when activated before MBT,
these findings strongly support the conclusion that
ß-catenin/Tcf-dependent transcription prior to MBT is required for dorsal
development.
| DISCUSSION |
|---|
|
|
|---|
To explain these findings, we propose that the ß-cateninTcf
complex activates transcription essential for dorsal-ventral axis
specification beginning in early cleavage stages of development. Once this
transcription reaches a sufficient level during pre-MBT stages, dorsal
development is no longer sensitive to loss of ß-catenin or dn-Xtcf3
(Fig. 6A). This conclusion is
supported by several observations presented here: (1) dn-Xtcf3 effectively
blocks dorsal development only when present at the earliest cleavage stages
(Fig. 1D,E), similar to the
ß-catenin morpholino results (Heasman
et al., 2000
). (2) Transient, global inhibition of transcription
during early pre-MBT stages extends the period of sensitivity to loss of Tcf
or ß-catenin activity (Fig.
2, Fig. 6B). (3)
ß-catenin and Tcf induce pre-MBT transcription of specific target genes
(Fig. 4). Interestingly, this
pre-MBT transcription of Xnr5 and Xnr6 is localized to
dorsal blastomeres. (4) Dorsal development is rescued only if Tcf-dependent
transcription is restored during pre-MBT stages
(Fig. 5,
Fig. 6C). To our knowledge,
this is the first characterization of a pathway that regulates pre-MBT
transcription.
How dorsal genes such as Siamois are activated by ß-catenin
remains unclear. Our observations, as well as recently published work from
other laboratories, raise the possibility that ß-catenin signaling may
activate post-MBT dorsal genes indirectly. Although the Siamois
promoter contains three functional Tcf/Lef binding sites, a Siamois
promoter construct lacking these sites (S24) is as active as the wild-type
promoter in dorsal blastomeres (Brannon et
al., 1997
), suggesting that these Tcf binding sites are not
required for the activation of Siamois in vivo. Furthermore, S24
activity is significantly higher than the wild-type Siamois promoter
in ventral blastomeres, indicating these Tcf binding sites repress
Siamois expression. Consistent with this view, depletion of maternal
Xtcf3 results in ectopic expression of Siamois and Xnr3 in
ventral blastomeres, as well as dorsalization of embryos, suggesting Xtcf3
primarily functions as a repressor
(Houston et al., 2002
).
Interaction between the ß-cateninLef-1 complex and the TGF-ß
transducing proteins Smad3 and Smad4 has been reported to play a role in the
regulation of twin expression
(Labbe et al., 2000
;
Nishita et al., 2000
). Whether
pre-MBT expression of Xnr5 and Xn6 promotes this
interaction, or whether SmadLEF interactions also regulate
Siamois transcription is not currently known. Thus, it will be
interesting to analyze how ß-catenin activates Siamois
expression.
An alternative explanation for the loss of sensitivity to ß-catenin
depletion or dn-Xtcf3 by the 16-cell stage is that ß-catenin and Tcf form
a stable complex (for details, see Tutter
et al., 2001
) or are otherwise modified in early cleavage stages,
but this complex does not activate transcription until MBT. However, we
demonstrate directly that ß-catenin/Tcf-dependent transcription begins
long before MBT. Thus, although ß-catenin and Tcf complexes that form
during pre-MBT stages may function in post-MBT stages, these complexes are
clearly also functional before MBT. Furthermore, the transcriptional activity
of Tcf is required prior to MBT in order to rescue dorsal development in
ventralized embryos, as activation at the onset of MBT or later fails to
rescue.
The midblastula transition, which is observed in diverse metazoan
organisms, marks a fundamental change in embryonic cells that includes the
beginning of large-scale zygotic transcription, slowing and loss of synchrony
in the cell cycle, and an increase in cell motility
(Newport and Kirschner,
1982a
). The mechanism by which transcription is repressed prior to
MBT has not been fully defined; however, the transcriptional machinery is
clearly present prior to MBT, as pre-MBT Xenopus extracts contain
active transcription factors and exogenous genes can be transcribed
transiently prior to MBT (Newport and
Kirschner, 1982b
; Prioleau et
al., 1994
). Newport and Kirschner also showed that injection of
plasmid DNA (pBR322) causes precocious transcription of endogenous genes,
indicating that endogenous genes can be transcribed if an inhibitor(s) is
titrated out by increased DNA. In addition, a plasmid containing the
c-myc gene is transiently transcribed in pre-MBT embryos when the
plasmid is pre-incubated with TATA binding protein (TBP)
(Prioleau et al., 1994
). These
observations have led to the proposal that the repression of transcription in
pre-MBT embryos is closely associated with assembly into chromatin
(Newport and Kirschner, 1982b
;
Prioleau et al., 1994
;
Stancheva et al., 2002
).
However, low-level pre-MBT transcription has been reported in
Xenopus and Drosophila
(Edgar and Schubiger, 1986
;
Nakakura et al., 1987
;
Shiokawa et al., 1989
;
Yasuda and Schubiger, 1992
).
For the most part, the importance of this early transcription has not been
established; however, engrailed RNA begins to accumulate well before
MBT in Drosophila and, most interestingly, loss of zygotic
engrailed expression leads to loss of mitotic synchrony as early as
the sixth cell cycle (Karr et al.,
1989
). These findings clearly indicate that pre-MBT transcription
is also required for normal development of Drosophila, and is likely
to be required for the development of diverse organisms.
On closer inspection, several Xenopus genes proposed to function
in dorsal-ventral patterning show an apparent increase in expression during
pre-MBT stages; in addition to Xnr5 and Xnr6, these include
Msx1 (Suzuki et al.,
1997
) and RGS4 (Wu et
al., 2000
). It is not clear why these genes are transcribed during
pre-MBT stages when most zygotic genes are repressed. Pre-MBT transcription
appears to be highly context-specific, as both ß-catenin and VegT are
required for the expression of Xnr5 and Xnr6
(Takahashi et al., 2000
), yet
not all ß-catenin and VegT targets are transcribed before MBT begins; one
possibility is that specific cis-elements in the promoters of pre-MBT genes
recruit chromatin remodeling complexes that allow pre-MBT genes to escape the
global inactivation of the genome during pre-MBT stages. Future work will
include the identification of other zygotic genes transcribed prior to MBT,
exploration of the mechanism that allows these genes to escape pre-MBT
transcriptional repression, and characterization of the roles of pre-MBT
transcription during development.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Brannon, M., Gomperts, M., Sumoy, L., Moon, R. T. and Kimelman,
D. (1997). A beta-catenin/XTcf-3 complex binds to the
siamois promoter to regulate dorsal axis specification in
Xenopus. Genes Dev. 11,2359
-2370.
Chodosh, L. A., Fire, A., Samuels, M. and Sharp, P. A.
(1989). 5,6-Dichloro-1-beta-D-ribofuranosylbenzimidazole inhibits
transcription elongation by RNA polymerase II in vitro. J. Biol.
Chem. 264,2250
-2257.
Christian, J. L. and Moon, R. T. (1993).
Interactions between Xwnt-8 and Spemann organizer signaling pathways generate
dorsoventral pattern in the embryonic mesoderm of Xenopus. Genes
Dev. 7,13
-28.
Darken, R. S. and Wilson, P. A. (2001). Axis induction by wnt signaling: target promoter responsiveness regulates competence. Dev. Biol. 234, 42-54.[CrossRef][Medline]
Deardorff, M. A., Tan, C., Conrad, L. J. and Klein, P. S. (1998). Frizzled-8 is expressed in the Spemann organizer and plays a role in early morphogenesis. Development 125,2687 -2700.[Abstract]
Edgar, B. A. and Schubiger, G. (1986). Parameters controlling transcriptional activation during early Drosophila development. Cell 44,871 -877.[CrossRef][Medline]
Fan, M. J., Gruning, W., Walz, G. and Sokol, S. Y.
(1998). Wnt signaling and transcriptional control of
Siamois in Xenopus embryos. Proc. Natl. Acad.
Sci. USA 95,5626
-5631.
Fredieu, J. R., Cui, Y., Maier, D., Danilchik, M. V. and Christian, J. L. (1997). Xwnt-8 and lithium can act upon either dorsal mesodermal or neurectodermal cells to cause a loss of forebrain in Xenopus embryos. Dev. Biol. 186,100 -114.[Medline]
Gerhart, J., Danilchik, M., Doniach, T., Roberts, S., Rowning, B. and Stewart, R. (1989). Cortical rotation of the Xenopus egg: consequences for the anteroposterior pattern of embryonic dorsal development. Development 107 (Suppl.),37 -51.
Hamilton, F. S., Wheeler, G. N. and Hoppler, S.
(2001). Difference in XTcf-3 dependency accounts for change in
response to beta-catenin-mediated Wnt signalling in Xenopus blastula.
Development 128,2063
-2073.
Harland, R. and Gerhart, J. (1997). Formation and function of Spemann's organizer. Annu. Rev. Cell Dev. Biol. 13,611 -667.[CrossRef][Medline]
Heasman, J., Crawford, A., Goldstone, K., Garner-Hamrick, P., Gumbiner, B., McCrea, P., Kintner, C., Noro, C. Y. and Wylie, C. (1994). Overexpression of cadherins and underexpression of beta-catenin inhibit dorsal mesoderm induction in early Xenopus embryos. Cell 79,791 -803.[CrossRef][Medline]
Heasman, J. (1997). Patterning the Xenopus blastula. Development 124,4179 -4191.[Abstract]
Heasman, J., Kofron, M. and Wylie, C. (2000). ß-catenin signaling activity dissected in the early Xenopus embryo: a novel antisense approach. Dev. Biol. 222,124 -134.[CrossRef][Medline]
Houston, D. W., Kofron, M., Resnik, E., Langland, R., Destree,
O., Wylie, C. and Heasman, J. (2002). Repression of organizer
genes in dorsal and ventral Xenopus cells mediated by maternal XTcf3.
Development 129,4015
-4025.
Hsu, S. C., Galceran, J. and Grosschedl, R.
(1998). Modulation of transcriptional regulation by LEF-1 in
response to Wnt-1 signaling and association with beta-catenin. Mol.
Cell. Biol. 18,4807
-4818.
Huelsken, J., Vogel, R., Brinkmann, V., Erdmann, B., Birchmeier,
C. and Birchmeier, W. (2000). Requirement for beta-catenin in
anterior-posterior axis formation in mice. J. Cell
Biol. 148,567
-578.
Hyde, C. E. and Old, R. W. (2000). Regulation of the early expression of the Xenopus nodal-related 1 gene, Xnr1. Development 127,1221 -1229.[Abstract]
Jones, C. M., Kuehn, M. R., Hogan, B. L., Smith, J. C. and Wright, C. V. (1995). Nodal-related signals induce axial mesoderm and dorsalize mesoderm during gastrulation. Development 121,3651 -3662.[Abstract]
Kao, K. R., Masui, Y. and Elinson, R. P. (1986). Lithium-induced respecification of pattern in Xenopus laevis embryos. Nature 322,371 -373.[CrossRef]
Kao, K. R. and Elinson, R. P. (1988). The entire mesodermal mantle behaves as Spemann's organizer in dorsoanterior enhanced Xenopus laevis embryos. Dev. Biol. 127, 64-77.[CrossRef][Medline]
Karr, T. L., Weir, M. P., Ali, Z. and Kornberg, T.
(1989). Patterns of engrailed protein in early
Drosophila embryos. Development
105,605
-612.
Kimelman, D., Kirschner, M. and Scherson, T. (1987). The events of the midblastula transition in Xenopus are regulated by changes in the cell cycle. Cell 48,399 -407.[CrossRef][Medline]
Klein, P. S. and Melton, D. A. (1996). A
molecular mechanism for the effect of lithium on development. Proc.
Natl. Acad. Sci. USA 93,8455
-8459.
Labbe, E., Letamendia, A. and Attisano, L.
(2000). Association of Smads with lymphoid enhancer binding
factor 1/T cell-specific factor mediates cooperative signaling by the
transforming growth factor-beta and wnt pathways. Proc. Natl. Acad.
Sci. USA 97,8358
-8363.
Larabell, C. A., Torres, M., Rowning, B. A., Yost, C., Miller,
J. R., Wu, M., Kimelman, D. and Moon, R. T. (1997).
Establishment of the dorsoventral axis in Xenopus embryos is presaged
by early asymmetries in betacatenin that are modulated by the Wnt signaling
pathway. J. Cell Biol.
136,1123
-1136.
Laurent, M. N., Blitz, I. L., Hashimoto, C., Rothbacher, U. and Cho, K. W. (1997). The Xenopus homeobox gene twin mediates Wnt induction of goosecoid in establishment of Spemann's organizer. Development 124,4905 -4916.[Abstract]
Lemaire, P., Garrett, N. and Gurdon, J. B. (1995). Expression cloning of Siamois, a Xenopus homeobox gene expressed in dorsal-vegetal cells of blastulae and able to induce a complete secondary axis. Cell 81, 85-94.[CrossRef][Medline]
McKendry, R., Hsu, S. C., Harland, R. M. and Grosschedl, R. (1997). LEF1/TCF proteins mediate wnt-inducible transcription from the Xenopus nodal-related 3 promoter. Dev. Biol. 192,420 -431.[CrossRef][Medline]
Miller, J. R., Rowning, B. A., Larabell, C. A., Yang-Snyder, J.
A., Bates, R. L. and Moon, R. T. (1999). Establishment of the
dorsal-ventral axis in Xenopus embryos coincides with the dorsal
enrichment of dishevelled that is dependent on cortical rotation.
J. Cell Biol. 146,427
-437.
Molenaar, M., van de Wetering, M., Oosterwegel, M., Peterson-Maduro, J., Godsave, S., Korinek, V., Roose, J., Destree, O. and Clevers, H. (1996). XTcf-3 transcription factor mediates ß-catenin-induced axis formation in Xenopus embryos. Cell 86,391 -399.[CrossRef][Medline]
Nakakura, N., Miura, T., Yamana, K., Ito, A. and Shiokawa, K. (1987). Synthesis of heterogeneous mRNA-like RNA and low-molecular-weight RNA before the midblastula transition in embryos of Xenopus laevis. Dev. Biol. 123,421 -429.[CrossRef][Medline]
Newport, J. and Kirschner, M. (1982a). A major developmental transition in early Xenopus embryos: 1. Characterization and timing of cellular changes at the midblastula transition. Cell 30,675 -686.[CrossRef][Medline]
Newport, J. and Kirschner, M. (1982b). A major developmental transition in early Xenopus embryos: II. Control of the onset of transcription. Cell 30,687 -696.[CrossRef][Medline]
Nishita, M., Hashimoto, M. K., Ogata, S., Laurent, M. N., Ueno, N., Shibuya, H. and Cho, K. W. (2000). Interaction between Wnt and TGF-beta signalling pathways during formation of Spemann's organizer. Nature 403,781 -785.[CrossRef][Medline]
Prioleau, M. N., Huet, J., Sentenac, A. and Mechali, M. (1994). Competition between chromatin and transcription complex assembly regulates gene expression during early development. Cell 77,439 -449.[CrossRef][Medline]
Schneider, S., Steinbeisser, H., Warga, R. M. and Hausen, P. (1996). ß-catenin translocation into nuclei demarcates the dorsalizing centers in frog and fish embryos. Mech. Dev. 57,191 -198.[CrossRef][Medline]
Shiokawa, K., Misumi, Y., Tashiro, K., Nakakura, N., Yamana, K. and Ohuchida, M. (1989). Changes in the patterns of RNA synthesis in early embryogenesis of Xenopus laevis. Cell Differ. Dev. 28,17 -25.[CrossRef][Medline]
Sive, H., Grainger, R. and Harland, R. (2000). Early Development of Xenopus Laevis: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Smith, W. C. and Harland, R. M. (1991). Injected Xwnt-8 RNA acts early in Xenopus embryos to promote formation of a vegetal dorsalizing center. Cell 67,753 -765.[CrossRef][Medline]
Stambolic, V., Ruel, L. and Woodgett, J. (1996). Lithium inhibits glycogen synthase kinase-3 activity and mimics wingless signalling in intact cells. Curr. Biol. 6,1664 -1668.[CrossRef][Medline]
Stancheva, I., El-Maarri, O., Walter, J., Niveleau, A. and Meehan, R. R. (2002). DNA methylation at promoter regions regulates the timing of gene activation in Xenopus laevis embryos. Dev. Biol. 243,155 -165.[CrossRef][Medline]
Suzuki, A., Ueno, N. and Hemmati-Brivanlou, A. (1997). Xenopus msx1 mediates epidermal induction and neural inhibition by BMP4. Development 124,3037 -3044.[Abstract]
Takahashi, S., Yokota, C., Takano, K., Tanegashima, K., Onuma, Y., Goto, J. and Asashima, M. (2000). Two novel nodal-related genes initiate early inductive events in Xenopus Nieuwkoop center. Development 127,5319 -5329.[Abstract]
Tutter, A. V., Fryer, C. J. and Jones, K. A.
(2001). Chromatin-specific regulation of LEF-1-beta-catenin
transcription activation and inhibition in vitro. Genes
Dev. 15,3342
-3354.
Vonica, A., Weng, W., Gumbiner, B. M. and Venuti, J. M. (2000). TCF is the nuclear effector of the beta-catenin signal that patterns the sea urchin animal-vegetal axis. Dev. Biol. 217,230 -243.[CrossRef][Medline]
Wu, C., Zeng, Q., Blumer, K. J. and Muslin, A. J. (2000). RGS proteins inhibit Xwnt-8 signaling in Xenopus embryonic development. Development 127,2773 -2784.[Abstract]
Yamaguchi, Y. and Shinagawa, A. (1989). Marked alteration at midblastula transition in the effect of lithium on formation of the larval body pattern of Xenopus laevis. Dev. Growth Diff. 31,531 -541.[CrossRef]
Yasuda, G. K. and Schubiger, G. (1992). Temporal regulation in the early embryo: is MBT too good to be true? Trends Genet. 8,124 -127.[Medline]
Zeng, L., Fagotto, F., Zhang, T., Hsu, W., Vasicek, T. J., Perry, W. L., Lee, J. J., Tilghman, S. M., Gumbiner, B. M. and Costantini, F. (1997). The mouse fused locus encodes Axin, an inhibitor of the Wnt signaling pathway that regulates embryonic axis formation. Cell 90,181 -192.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
G. Liao, Q. Tao, M. Kofron, J.-S. Chen, A. Schloemer, R. J. Davis, J.-C. Hsieh, C. Wylie, J. Heasman, and C.-Y. Kuan Jun NH2-terminal kinase (JNK) prevents nuclear beta-catenin accumulation and regulates axis formation in Xenopus embryos PNAS, October 31, 2006; 103(44): 16313 - 16318. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||