|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00173
DEVELOPMENT AND DISEASE |
1 Genetics Division, Brigham and Women's Hospital, Harvard Medical School,
Boston, MA, USA
2 Renal Unit, Massachusetts General Hospital, Boston, MA, USA
3 Whitehead Institute for Biomedical Research/MIT Center for Genome Research,
Cambridge, MA, USA
* Author for correspondence (e-mail: beier{at}rascal.med.harvard.edu
Accepted 23 September 2002
| SUMMARY |
|---|
|
|
|---|
Key words: PKD, mouse models, zebrafish, Nek kinase
| INTRODUCTION |
|---|
|
|
|---|
Genetic analysis of epithelial cyst formation in animal models will
facilitate the molecular characterization of novel genes required for normal
epithelial function and will contribute to understanding the cellular
pathology of cystic disease. The juvenile cystic kidney (jck)
mutation is a model of autosomal recessive PKD
(Atala et al., 1993
). The
jck mutation was initially mapped to a 1.5 cM interval on mouse
chromosome 11 (Iakoubova et al.,
1995
), and modifying loci affecting progression of PKD in this
system have been identified (Iakoubova et
al., 1999
; Kuida and Beier,
2000
). We describe the positional cloning of the gene mutated in
jck, and the characterization of this defect using both in vitro
analysis and a test of gene function in zebrafish embryos.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Genomic analysis
BAC clones were screened from RPCI-23 Segment I mouse BAC library (BACPAC
Resource,
http://www.chori.org/bacpac/)
using overlap oligos hybridization on high-density DNA filters
(Ross et al., 1999
). BAC DNA
was isolated using anion-exchange columns (Qiagen) and BAC end sequence was
obtained by ABI-377 sequencer (Applied Bioysytems). Overlap oligonucleotide
probes were designed from BAC end sequence using online software Overgo Maker
(http://genome.wustl.edu/gsc/overgo/overgo.html).
For each BAC end sequence, a pair of oligonucleotides whose 3' ends were
complementary by eight bases was labeled with 32P dATP and
32P dCTP by a Klenow fill-in reaction and used to probe the
high-density DNA filters. One set of five high-density filters (22x22
cm) were prehybridized for 4 hours and hybridized for 16 hours at 60°C.
The hybridization was performed in 50 ml hybridization solution which
containing 1% BAS, 1 mM EDTA, 7% SDS and 0.5 M sodium phosphate. After
hybridization, the filters were washed in 1.5xSSC, 0.1% SDS and
0.5xSSC, 0.1% SDS solution at 58°C for 1 hour. Positive clones were
identified by autoradiogram. Sixteen STS markers were developed from published
sequences, as well as end sequences of YAC clones and 129/Sv BAC clones we
have previously localized to this region (data not shown). Hybridization with
a pooled set of overlapping oligonucleotides identified 31 clones. These were
then ordered based on their STS content, which was determined by hybridization
using individual oligonucleotides. These clones covered the full length of the
proximal region of the interval, with a minimal tiling path of 7 BACs
(Fig. 1).
|
Cloning
Kidney total RNA (3 µg) poly(A) RNA (1 µg) was reverse transcribed
with Superscript II RNase H- Reverse Transcriptase
(Gibco/BRL) in 20 µl reaction mixture followed by a treatment of 1 µl
RNase H (Gibco/BRL) at 37°C for 20 minutes. From this mixture, 1-2 µl
was used as template for PCR using primers distributed across the presumptive
Nek8 transcript. The PCR products were resolved on an agarose gel,
purified by QIAquick Gel Extract Kit (Qiagen), and sequenced. 5' RACE
and 3' RACE were carried out using the Marathon cDNA Amplification Kit
(Clontech) according to the manufacturer's instructions. Sequence analysis was
carried out using Sequencher 3.1 software (Gene Codes) and the PFAM search
server:
http://pfam.wustl.edu/index.html.
The GenBank Accession numbers of the sequences are AF407579 (mouse) and
AF407580 (zebrafish). Analysis of the Multiple Choice Northern Blot (OriGene
Technologies) was carried out by hybridization of an overgo-oligonucleotide
derived from the 3' domain of Nek8 corresponding to the
sequence 5'-GGGCAGCGTGCGCATGCGGAGGGCAGAGAAGTCCCTGACC-3'.
In vitro analysis
Wild-type and jck Nek8 cDNAs were amplified using primers
containing 5' terminal EcoRI sites and cloned into the
HA-epitope-containing vector PuHD-P2 (kindly provided by Dr Kun-Ping Lu).
Fragments from plasmids containing cDNA cloned in-frame after the HA epitope
tag were transferred to the pcDNA3 mammalian expression vector (Invitrogen). A
kinase-defective HA-tagged Nek8 clone carrying a Lys-to-Met mutation
at amino acid 33 was generated using the strategy described by Cormack
(Cormack, 1998
). Cos7, MDCK and
Swiss 3T3 cells were cultured as monolayers in Dulbecco's Modified Eagle's
Medium (Gibco/BRL) supplemented with 10% fetal bovine serum and antibiotic.
Cells were maintained in a humid incubator at 37°C in a 5% CO2
environment. Cells were transfected using SuperFect Transfection Reagent
(Qiagen) according to the manufacturer's protocol. For transient gene
expression study, transfected cells were fixed for immunostaining after a
further culture of 1-3 days; For the establishment of stable transfected cell
lines, cells were passed at 1:10 or 1:15 into selective medium containing 400
µg/ml G418 1-2 days after transfection and single colonies were picked up
and split into fresh selective medium. For immunohistochemistry cells were
fixed with 3.7% formaldehyde in PBS for 10-30 minutes, washed with PBS for 5
minutes, and permealized and blocked in blocking buffer [2% normal goat serum
(Sigma). 0.4% Triton X-100 (Sigma) in PBS] for 15 minutes at room temperature.
Cells were incubated with an appropriate dilution of primary antibody in
blocking buffer for 2 hours at room temperature or at 4°C overnight. Cells
were washed three times with washing buffer (0.2% Triton X-100 and 0.2% BSA in
PBS) for 20 minutes each time, incubated with a proper dilution of
fluorochrome-conjugated secondary antibody and DAPI in PBS containing 0.1%
Triton X-100 at room temperature for 1 hour, and then washed twice with
washing buffer for 20 minutes each time. Coverslips with stained cells were
mounted in Vectashield (Vector Laboratories) and sealed with nailpolish.
Primary antibodies used for immunostaining cultured cells included mouse
anti-HA monoclonal antibody clone 12CA5 (Boehringer Mannheim) (1:1,000
dilution of 0.4 mg/ml stock solution); mouse monoclonal anti-
-tublin
FITC-conjugated antibody (Sigma) (1:50 dilution); and rabbit
anti-
-tubulin antibody (Sigma) (1:1000 dilution). Secondary antibodies
included Cy3-conjugated goat anti-mouse IgG (Jackson ImmunoResearch
Laboratories) (1:100 dilution of 0.7 mg/ml stock stock solution) and
FITC-conjugated goat anti-rabbit IgG (Sigma) (1:80 dilution), Other
histochemical reagents included 0.1 mg/ml FITC-labeled phalloidin (Sigma) used
at 1:20 dilution and 1 mg/ml DAPI (Sigma) used at 1:1000 dilution. Images were
aquired at the Brigham and Women's Confocal and Multiphoton Imaging facility,
using a BioRad 1024 MP confocal system.
Antibody synthesis and analysis
A DNA fragment carrying the Nek8 C-terminal RCC domain (285-698
amino acids) was amplified using primer pair pET-BamHI-F:
CGGGATCCCGCCTATAGCCTCTGGCAGCAC and pET-EcoRI-R:
CGGAATTCCCATTGACGACACAATCCAG and cloned into vector pET-30c after digestion
with BamHI and EcoRI. This was transformed it into
BL21(DE3)PlysS competent cells. IL cultures were grown, induced with IPTG (1
mM), spun down and frozen overnight. BugBuster Protein Extraction Reagent
(Novagen) was used to to purify inclusion bodies and the expressed protein
purified using His-Bind Purification Kit (Novagen). Serum from rabbits
immunized with purified protein was obtained from a commercial provider
(ProSci). The antibody was affinity-purified using the His-tagged protein
bound to an AminoLink Plus Coupling Gel (Pierce Biotechnology). Western
analysis with affinity-purified antibody identifies a single 75 kDa band in
cells transiently or stably transfected with a Nek8 expression vector
(data not shown). Two-week-old wild-type and mutant mice were sacrificed and
tissues fixed by perfusion with 4% paraformaldehyde. Frozen sections (5 µm)
were incubated briefly in 1% SDS/PBS to enhance antigenicity followed by
washing and incubation for 1 hour at room temperature with affinity-purified
Nek8 antibody (1:1000 dilution). As a secondary antibody, Cy3-conjugated Goat
anti-Rabbit IgG (1:1000; Jackson immunochemicals) was used and microscopy was
performed using a BioRad Radiance 2000 confocal microscope.
Microscopy
Two-week-old juvenile kidneys were fixed overnight at 4°C in 2%
glutaraldehyde/0.1 M sodium cacodylate (pH 7.2). For light microscopy, kidneys
were embedded in glycol methacrylate, sectioned at 4 µm, stained using
methylene blue/azure II (Humphrey and
Pittman, 1974
) and observed on a Nikon 800 microscope. For
electron microscopy, kidneys were embeded in Epon using standard procedures
(Majumdar and Drummond, 1999
),
sectioned and stained with uranyl acetate and lead citrate. Sections were
observed and photographed using a Phillips CM10 electron microscope.
Zebrafish analysis
Zebrafish Nek8 was mapped on the T51 radiation hybrid map by the
RH Mapping Service of The Children's Hospital Zebrafish Genome Initiative,
under the direction of DrYi Zhou
(http://zfrhmaps.tch.harvard.edu/ZonRHmapper/Default.htm#index).
Two primer pairs were tested: Zfishnek1 (forward, CCCTGTTGGATGAGGACACT;
reverse, GTGCTTGTCCAGGAGGATGT) and Zfishnek2 (forward, CAGCTCAGAATGAATGCCAA;
reverse, TTGCGATCATTAGTGCCTTG). Both were most tightly linked with the marker
fj44a05.x1 on Linkage Group 15. Zebrafish embryos from wild-type pair matings
(TL strain) were injected at the two-cell stage with a solution containing 0.2
mM Nek8 antisense morpholino oligonucleotides (Gene-Tools LLC) in 200
mM KCl, and 0.1% Phenol Red. High doses of Nek8 antisense oligos
caused developmental arrest at the tail bud stage, implying a role for
Nek8 in early development; five-fold less oligo injection allowed for
bypassing early arrest and the analysis of organogenesis phenotypes. Final
oligonucleotide concentration in the cytoplasm was estimated to be between 200
and 500 nM. The sequence of the translation blocking oligo was
5'-CTTCTCATACTTCTCCATGTTTTCG-3' (control); that of the randomized
oligonucleotide (control) was 5'-CCTCTTACCTCAGTTACAATTTATA-3'; and
that of the splice donor blocking oligonucleotide was
5'-CTAGGAGGCACACCTGTTAGGCAGG-3' (splice junction at nt. 1281 of
Nek8, GenBank AF407580). Injection of control oligo showed no effect
on development. Control and experimental embryos were maintained at 28.5°C
in egg water (46) and allowed to develop to 48-60 hours post fertilization
(hpf). Embryos were fixed and processed for histology or for purification of
total RNA. Nested RT-PCR primers in exons flanking the blocked splice donor
site were used to confirm oligo efficacy and characterize the altered mRNA
splicing product (final forward primer,
5'-CTACACCTGGGGCAGTGGCATTT-3'; final reverse primer,
5'-TGGCTATCCTGAGTGGCCAAACC-3'). Amplification of ß-actin was
performed as a control for semi-quatitative RT-PCR and showed equal
amplification in all samples.
| RESULTS |
|---|
|
|
|---|
The utility of the recombinants previously identified between D11Mit116 and D11Mit117 was limited because of the lack of informative markers between inbred laboratory strains in this region. We therefore initiated a cross between C57BL/6J jck mice and Mus castaneus, and identified one recombinant between D11Mit116 and D11Mit117 in 283 F2 progeny. Analysis of the recombinant using informative SSLPs from BAC end sequences narrowed the interval containing jck. Three BACs covering the jck interval and extending to the previously sequenced region were identified (Fig. 1) and sequenced.
BLAST homology searches identified several genes on these BACs, including
one with homology to the Nek (NIMA-related) family of serine-threonine
kinases. This was of note because a mutation in a different family member,
Nek1, has been shown to cause a similar polycystic kidney phenotype
in the kat mutant mouse (Upadhya
et al., 2000
). Nek family members 1-7 have been previously
described; we have therefore named this novel family member Nek8. The
full-length sequence of the mouse Nek8 mRNA was determined using
RT-PCR and 5' and 3' RACE. Nek8 mRNA contains a 698 amino
acid open reading frame that encodes both an N-terminal Nek kinase domain and
C-terminal domains homologous to repeated motifs found in the regulator of
chromatin condensation (RCC) gene (Fig.
2). Northern expression analysis of mouse Nek8
demonstrated the expected approximately 3 kb transcript present most
abundantly in kidney and liver, and a larger transcript present in testes
(Fig. 2).
|
Sequence comparison of the Nek8 transcripts in wild-type and jck mice revealed two sequence changes; both are mutations of guanine nucleotides to thymidine, at bp 1346 and 1348, respectively (Fig. 2). The former nucleotide change is silent, while the latter results in a non-conservative substitution of valine for glycine. This sequence variation is not present in wild-type C57BL/6J genomic DNA, which is the parental strain in which the spontaneous jck mutation occurred. The mutated glycine is strictly conserved in all other vertebrate Nek8 homologs (Fig. 2).
An affinity-purified polyclonal antibody generated against a peptide derived from the C-terminal 413 amino acids of Nek8 reveals that it is specifically located in the apical cytoplasm of collecting duct epithelial cells (Fig. 3). In jck mutant kidneys this localization is lost, even prior to the formation of overt kidney cysts (Fig. 3) and instead, Nek8 is localized diffusely in the cytoplasm.
|
To assess the functional consequences of the amino acid substitution, we
made epitope-tagged wild-type and jck mutant Nek8 constructs
for expression in cell culture (see Materials and Methods). We also generated
a kinase-defective Nek8 construct containing a substitution of
methionine for lysine at amino acid 33, a mutation of the ATP binding loop
that abrogates function of the homologous NIMA kinase
(Lu and Means, 1994
).
Transient transfection of these constructs into Cos7, 3T3 and MDCK cells had
dramatic consequences: although cells expressing wild-type Nek8
appeared normal, cells expressing the jck mutant or kinase-defective
Nek8 became enlarged and multinucleated
(Fig. 4). The effect of the
jck mutant Nek8 gene is equally severe as that of the
kinase-mutant construct. In all cases the epitopetagged Nek8 protein
appeared localized in the cytoplasm, although low levels of expression in the
nucleus cannot be excluded. Expression of an appropriate size protein in the
transfected populations was confirmed by western blot analysis (data not
shown). Expression of the jck and kinase-defective mutant forms had
similar but less severe effects in stably transfected cells, although the
expression of the protein was significantly lower. Given its effect in
transient expression assays, it is likely there is selection against cells
that express high levels of abnormal Nek8 protein.
|
The enlarged and multinucleated appearance of cells expressing jck
mutant and kinase-defective Nek8 proteins is similar to that
described for cells in which the actin or microtubule cytoskeletal networks
have been disrupted (Andreassen and
Margolis, 1994
; Court and
Moore, 1985
). Immunohistochemical analysis of MDCK cells
expressing jck mutant and kinase-defective Nek8 showed no
clear effect on microtubules (data not shown), but demonstrate a marked
reduction of actin stress fibers (Fig.
4).
Histological analysis of jck mutant kidney tubules showed no nuclear abnormalities, and immunohistochemical studies using antibodies against specifically apical or basolateral membrane proteins (aquaporin2, H+ ATPase, anion exchanger AE1/2, Na+K+ATPase and tubulin) showed no evidence of membrane protein mislocalization (data not shown). However, light and electron microscopy revealed a consistent defect in the tubular epithelia of mutant kidneys; specifically, the integrity and structure of basal membrane infoldings (i.e. the basal labyrinth) were disrupted and epithelial cells were in some cases observed to detach from the basement membrane (Fig. 5). These defects were specific to the connecting segment and collecting duct cells; proximal tubule cells appeared morphologically normal (data not shown). Cell membrane and cytoplasmic disruption could be observed in connecting segments and collecting ducts with normal lumen diameters from mutant mice 2-3 weeks of age, indicating that the cellular defects preceded overt cyst formation. Cell-cell junctions in jck cysts looked morphologically normal when examined by electron microscopy, indicating that the cyst phenotype is not primarily a consequence of disruption of adherens junction formation (data not shown).
|
To confirm that a defect in Nek8 can result in cystic disease we
took advantage of the observation that morpholino antisense oligonucleotides
(MO) can be used to abrogate gene function in zebrafish, resulting in several
cases in phenotypes indistinguishable from proven null mutations
(Nasevicius and Ekker, 2000
).
We identified an EST from zebrafish with significant homology to Nek8
(Accession Number, BG302641) and determined its full-length sequence, which
showed 72% amino acid identity and 84% similarity to murine Nek8, and
also carried both the Nek and RCC domains in a single open reading frame.
Analysis of the T51 radiation hybrid panel
(Geisler et al., 1999
)
localized zebrafish nek8 to chromosome 15, which has conserved
synteny with mouse chromosome 11 and human chromosome 17
(Woods et al., 2000
), further
supporting this gene as the zebrafish ortholog of Nek8. Specifically,
zebrafish nek8 is tightly linked with the marker fj56h04.x1, which is
derived from an EST that has strong homology to the mouse gene Aldo3,
which maps within the recombinant interval containing jck
(Segre et al., 1995
).
Morpholino antisense oligonucleotides were designed to interfere with
Nek8 translation (by binding to the initiation ATG codon) or mRNA
splicing (by blocking splice donor sites). Microinjection of both translation
blocking and splice donor blocking antisense oligos into two-cell stage
embryos resulted in the development of severe pronephric cysts as early as 48
hours post fertilization (Fig.
6). This stage of development corresponds to the onset of kidney
function at hatching (Drummond et al.,
1998
). The timing and morphology of pronephric cyst formation in
Nek8 MO-injected embryos closely resembles cyst formation in a
previously characterized group of pronephric kidney mutants
(Drummond et al., 1998
). In
some cases, pronephric duct cells could be observed detached from the basement
membrane and present in pronephric duct lumens (data not shown), a phenotype
similar to the cysts seen in the jck mouse collecting ducts.
|
| DISCUSSION |
|---|
|
|
|---|
The Nek protein kinase family is defined by their similarity to the NIMA
(never in mitosis A) kinase found in Aspergillis nidulans. Although
overexpression of mutant NIMA kinase in mammalian cells also disrupts the cell
cycle (Lu and Hunter, 1995
),
none of the mammalian Nek genes has been shown to have a similar effect,
suggesting that the function of the Nek family of kinases is broadly
diversified. A striking aspect of the Nek family is that, while their kinase
domains show significant amino acid similarity, many (but not all) of these
family members have distinctive, presumptive regulatory, C-terminal domains.
The C-terminal domain of Nek8 has multiple repeats of a protein motif
found in RCC1, a protein that is required for normal chromosome condensation
in yeast. Drosophila appears to have only two Nek family protein
kinases. One is CG10951 (33% identity and 48% similarity), which contains both
the Nek and RCC domains. The second, CG17256, has an N-terminal Nek domain but
has a C-terminal region that is not conserved in mammals. Recently, a human
Nek family member with a high degree of homology to Nek8 has been
characterized (Holland et al.,
2002
). This protein, which localizes to human chromosome 14q24
(AC007055; BAC clone 201F1), is not the ortholog of mouse Nek8; the
true ortholog is in the appropriate region of conserved synteny on chromosome
17q11 (AC010761; BAC clone RP11-386F9). Analysis of this Nek-family kinase,
which has been assigned the name Nek9, in transient expression assays
suggests that it interacts with BICD2, the mammalian homolog of
Drosophila Bicaudal D. Mutations in Bicaudal D affect the
organization and polarization of the microtubule network during oogenesis
(Mach and Lehmann, 1997
;
Theurkauf et al., 1993
) and
BICD2 co-localizes with microtubule-associated proteins
(Hoogenraad et al., 2001
).
Nek9 has also been found to bind the Ran GTPase when
co-expressed in cultured cells (Roig et
al., 2002
). Whether this interaction occurs in vivo has not yet
been addressed.
Our results suggest that an essential function of Nek8 may be to
regulate local cytoskeletal structure in kidney tubule epithelial cells.
Wild-type Nek8 is localized specifically to the apical cytoplasm of
collecting duct epithelial cells. When mutated, Nek8 is mislocalized
diffusely in the cytoplasm, often appearing in a perinuclear ring, while
cytoskeletal organization is grossly disorganized and apical cytoplasmic
protrusions are observed. Overexpression of mutated Nek8 in cultured
cells results in multinucleation, cell enlargement and a loss of actin stress
fibers, further suggesting a failure to properly regulate the actin
cytoskeleton. Tubule cells in jck mutant mice are not multinucleated;
however, given the importance of the cytoskeleton in cellular functions such
as the maintenance of polarity and cell adhesion, we speculate that a more
subtle defect of cytoskeletal regulation in these cells results in cyst
formation. Significantly, the kidney epithelial phenotype of the jck
mouse closely resembles the phenotype of a Rho GDI
knockout mouse. The
mutation in Rho GDI
results in disruption of the basal cytoplasmic
organization in connecting segment/collecting duct epithelial cells and cystic
dilation (Togawa et al.,
1999
). The Rho family of small GTPases has been shown to play a
central role in actin cytoskeletal regulation in general and in stress fiber
assembly specifically (Kaibuchi et al.,
1999
). Rho is also known to have a role in the regulation of
cytokinesis; for example, expression of a dominant-negative Rho-kinase mutant
in Xenopus embryos and mammalian cells inhibits this process and
results in multinucleated cells (Yasui et
al., 1998
).
Our observation that the jck mutation is in a kinase that may be
required for normal cytoskeletal function is of note in the context of a
growing body of evidence implicating defects in components of the cell-matrix
and cell-cell adhesion systems as a fundamental cause of cystic kidney disease
(Wilson, 2001
). Most notably,
the Pkd1 gene, which is the locus mutated in the most common form of
human PKD, encodes polycystin, a large transmembrane protein with multiple
extracellular domains implicated in cell-cell adhesion. Polycystin has been
localized to multiple sites involved in adhesion including adherens junctions,
desmosomes and focal adhesion complexes
(Geng et al., 2000
;
Huan and van Adelsberg, 1999
;
Scheffers et al., 2000
).
Defects in other protein components of the focal adhesion complex can result
in cystic disease; specifically,
-actinin (in human focal
glomerulosclerosis) (Kaplan et al.,
2000
), nephrocystin (in medullary cystic disease)
(Hildebrandt et al., 1997
) and
tensin (in targeted mutations in the mouse)
(Lo et al., 1997
).
Because we only have a single allele of jck, we chose to confirm
that Nek8 was the causal defect using a cross-species analysis in
zebrafish, and we recommend this as a general strategy for assessing gene
function. This is especially important given the resurgence of interest in
using ENU mutagenesis for generating novel murine models of disease and
development. While ENU mutagenesis is extremely efficient, the logistics of
this analysis in mice generally precludes reaching saturation, and it is
likely that many of the mutations identified by these screens will be single
alleles. Furthermore, treatment with ENU usually generates single nucleotide
changes, and, in the cases where they have been characterized, nearly
two-thirds of these were found to be missense changes
(Noveroske et al., 2000
), the
functional consequences of which may not necessarily be easily tested.
Analysis of candidate gene function in zebrafish represents an attractive
strategy because it is inexpensive, technically straightforward, and most
importantly, rapid; especially compared with murine transgenesis techniques,
which would require a minimum of two generations to confirm a functional
defect. We suggest that the combined forward and reverse genetic approaches
using the mouse and zebrafish can be a highly efficient method of determining
gene function.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
American PKD1 Consortium (1995). Analysis of
the genomic sequence for the autosomal dominant polycystic kidney disease
(PKD1) gene predicts the presence of a leucine-rich repeat. The American PKD1
Consortium (APKD1 Consortium). Hum. Mol. Genet.
4, 575-582.
Andreassen, P. R. and Margolis, R. L. (1994).
Microtubule dependency of p34cdc2 inactivation and mitotic exit in mammalian
cells. J. Cell Biol.
127,789
-802.
Atala, A., Freeman, M. R., Mandell, J. and Beier, D. R. (1993). Juvenile cystic kidneys (jck): a new mouse mutation which causes polycystic kidneys. Kidney Intl. 43,1081 -1085.[Medline]
Cormack, B. (1998). Current protocols in molecular biology. In Current Protocols in Molecular Biology, Vol. 1 (ed. F. Ausubel, R. Brent, R. Kingston, D. Moore, J. Seidman, J. Smith and K. Struhl). New York: John Wiley and Sons.
Court, J. B. and Moore, J. L. (1985). The survival of cytochalasin-induced multinucleation following irradiation of Chinese hamster ovary cells. Cell Biol. Int. Rep. 9, 219-227.[CrossRef][Medline]
Drummond, I. A., Majumdar, A., Hentschel, H., Elger, M., Solnica-Krezel, L., Schier, A. F., Neuhauss, S. C., Stemple, D. L., Zwartkruis, F., Rangini, Z. et al. (1998). Early development of the zebrafish pronephros and analysis of mutations affecting pronephric function. Development 125,4655 -4667.[Abstract]
European Polycystic Kidney Disease Consortium (1994). The polycystic kidney disease 1 gene encodes a 14 kb transcript and lies within a duplicated region on chromosome 16. Cell 77,881 -894.[CrossRef][Medline]
Geisler, R., Rauch, G. J., Baier, H., van Bebber, F., Brobeta, L., Dekens, M. P., Finger, K., Fricke, C., Gates, M. A., Geiger, H. et al. (1999). A radiation hybrid map of the zebrafish genome. Nat. Genet. 23,86 -89.[CrossRef][Medline]
Geng, L., Burrow, C. R., Li, H. P. and Wilson, P. D. (2000). Modification of the composition of polycystin-1 multiprotein complexes by calcium and tyrosine phosphorylation. Biochim. Biophys. Acta 1535,21 -35.[Medline]
Hildebrandt, F., Otto, E., Rensing, C., Nothwang, H. G., Vollmer, M., Adolphs, J., Hanusch, H. and Brandis, M. (1997). A novel gene encoding an SH3 domain protein is mutated in nephronophthisis type 1. Nat. Genet. 17,149 -153.[CrossRef][Medline]
Holland, P. M., Milne, A., Garka, K., Johnson, R. S., Willis, C. R., Sims, J. E., Rauch, C. T., Bird, T. A. and Virca, G. D. (2002). Purification, cloning and characterization of Nek8, a novel NIMA-related kinase, and its candidate substrate Bicd2. J. Biol. Chem. 25,25 .
Hoogenraad, C. C., Akhmanova, A., Howell, S. A., Dortland, B. R., de Zeeuw, C. I., Willemsen, R., Visser, P., Grosveld, F. and Galjart, N. (2001). Mammalian Golgi-associated Bicaudal-D2 functions in the dynein-dynactin pathway by interacting with these complexes. EMBO J. 20,4041 -4054.[CrossRef][Medline]
Huan, Y. and van Adelsberg, J. (1999). Polycystin-1, the PKD1 gene product, is in a complex containing E-cadherin and the catenins. J. Clin. Invest. 104,1459 -1468.[Medline]
Humphrey, C. and Pittman, F. (1974). A simple methylene blue-azure II-basic fuchsin stain for epoxy-embedded tissue sections. Stain Technol. 49, 9-14.[Medline]
Iakoubova, O., Dushkin, H. and Beier, D. (1995). Localization of a murine recessive polycystic kidney disease mutation and modifying loci which affect disease severity. Genomics 26,107 -114.[CrossRef][Medline]
Iakoubova, O., Dushkin, H., Pacella, L. and Beier, D. R.
(1999). Genetic analysis of modifying loci on mouse chromosome 1
that affect disease severity in a model of recessive PKD. Physiol.
Genomics 1,101
-105.
International PKD Consortium (1995). Polycystic kidney disease: the complete structure of the PKD1 gene and its protein. Cell 81,289 -298.[CrossRef][Medline]
Kaibuchi, K., Kuroda, S. and Amano, M. (1999). Regulation of the cytoskeleton and cell adhesion by the Rho family GTPases in mammalian cells. Annu. Rev. Biochem. 68,459 -486.[CrossRef][Medline]
Kaplan, J. M., Kim, S. H., North, K. N., Rennke, H., Correia, L. A., Tong, H. Q., Mathis, B. J., Rodriguez-Perez, J. C., Allen, P. G., Beggs, A. H. et al. (2000). Mutations in ACTN4, encoding alpha-actinin-4, cause familial focal segmental glomerulosclerosis. Nat. Genet. 24,251 -256.[CrossRef][Medline]
Kuida, S. and Beier, D. R. (2000). Genetic
localization of interacting modifiers affecting severity in a murine model of
polycystic kidney disease. Genome Res.
10, 49-54.
Lo, S. H., Yu, Q. C., Degenstein, L., Chen, L. B. and Fuchs,
E. (1997). Progressive kidney degeneration in mice lacking
tensin. J. Cell Biol.
136,1349
-1361.
Lu, K. P. and Hunter, T. (1995). Evidence for a NIMA-like mitotic pathway in vertebrate cells. Cell 81,413 -424.[CrossRef][Medline]
Lu, K. P. and Means, A. R. (1994). Expression of the noncatalytic domain of the NIMA kinase causes a G2 arrest in Aspergillus nidulans. EMBO J. 13,2103 -2113.[Medline]
Mach, J. M. and Lehmann, R. (1997). An
Egalitarian-BicaudalD complex is essential for oocyte specification and axis
determination in Drosophila. Genes Dev.
11,423
-435.
Majumdar, A. and Drummond, I. A. (1999). Podocyte differentiation in the absence of endothelial cells as revealed in the zebrafish avascular mutant, cloche. Dev. Genet. 24,220 -229.[CrossRef][Medline]
Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene `knockdown' in zebrafish. Nat. Genet. 26,216 -220.[CrossRef][Medline]
Nehls, M., Pfeifer, D., Schorpp, M., Hedrich, H. and Boehm, T. (1994). New member of the winged-helix protein family disrupted in mouse and rat nude mutations. Nature 372,103 -107.[CrossRef][Medline]
Noveroske, J. K., Weber, J. S. and Justice, M. J. (2000). The mutagenic action of N-ethyl-N-nitrosourea in the mouse. Mamm. Genome 11,478 -483.[CrossRef][Medline]
Roig, J., Mikhailov, A., Belham, C. and Avruch, J.
(2002). Nercc1, a mammalian NIMA-family kinase, binds the Ran
GTPase and regulates mitotic progression. Genes Dev.
16,1640
-1658.
Ross, M., LaBrie, S., McPherson, J. and Stanton, V. (1999). Screening large-insert libraries by hybridization. In Current Protocols in Human Genetics (ed. N. C. Dracopoli, J. L. Haines, B. R. Korf, D. T. Moir, C. C. Morton, C. E. Seidman, J. G. Seidman and D. R. Smith), pp. 5.6.1-5.6.52. New York, NY: John Wiley and Sons.
Scheffers, M. S., van der Bent, P., Prins, F., Spruit, L.,
Breuning, M. H., Litvinov, S. V., de Heer, E. and Peters, D. J.
(2000). Polycystin-1, the product of the polycystic kidney
disease 1 gene, co- localizes with desmosomes in MDCK cells. Hum.
Mol. Genet. 9,2743
-2750.
Segre, J. A., Nemhauser, J. L., Taylor, B. A., Nadeau, J. H. and Lander, E. S. (1995). Positional cloning of the nude locus: genetic, physical, and transcription maps of the region and mutations in the mouse and rat. Genomics 28,549 -559.[CrossRef][Medline]
Theurkauf, W. E., Alberts, B. M., Jan, Y. N. and Jongens, T. A. (1993). A central role for microtubules in the differentiation of Drosophila oocytes. Development 118,1169 -1180.[Abstract]
Togawa, A., Miyoshi, J., Ishizaki, H., Tanaka, M., Takakura, A., Nishioka, H., Yoshida, H., Doi, T., Mizoguchi, A., Matsuura, N. et al. (1999). Progressive impairment of kidneys and reproductive organs in mice lacking Rho GDIalpha. Oncogene 18,5373 -5380.[CrossRef][Medline]
Upadhya, P., Birkenmeier, E. H., Birkenmeier, C. S. and Barker,
J. E. (2000). Mutations in a NIMA-related kinase gene, Nek1,
cause pleiotropic effects including a progressive polycystic kidney disease in
mice. Proc. Natl. Acad. Sci. USA
97,217
-221.
Wilson, P. D. (2001). Polycystin: new aspects
of structure, function, and regulation. J. Am. Soc.
Nephrol. 12,834
-845.
Woods, I. G., Kelly, P. D., Chu, F., Ngo-Hazelett, P., Yan, Y.
L., Huang, H., Postlethwait, J. H. and Talbot, W. S. (2000).
A comparative map of the zebrafish genome. Genome Res.
10,1903
-1914.
Yasui, Y., Amano, M., Nagata, K., Inagaki, N., Nakamura, H.,
Saya, H., Kaibuchi, K. and Inagaki, M. (1998). Roles of
Rho-associated kinase in cytokinesis; mutations in Rho-associated kinase
phosphorylation sites impair cytokinetic segregation of glial filaments.
J. Cell Biol. 143,1249
-1258.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||