|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
Departments of Pathology and Pediatric Surgery Research, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114, USA
*Author for correspondence (e-mail: robertsd{at}helix.mgh.harvard.edu)
Accepted 11 November 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Hoxa13, Tail, Endoderm, Gut, HFG, Chick
| INTRODUCTION |
|---|
|
|
|---|
Tail growth is a function of a specialized region of ectoderm, the ventral ectodermal ridge (VER), which acts analogously to the apical ectodermal ridge (AER) of the limb bud. Both the AER and VER signal adjacent mesodermal tissues to maintain an undifferentiated state, facilitating growth and elongation (Goldman et al., 2000
; Saunders, 1948
). The VER forms before morphological tail development [stage 18 in chick (Mills and Bellairs, 1989
) and E10 or 35+ somites in the mouse (Gruneberg, 1956
)] from the cloacal membrane posterior to the tailbud where ecotoderm and endoderm are juxtaposed (Gruneberg, 1956
). During the ensuing gastrulation events, the tailgut develops anterior to the cloacal membrane and elongates in close association with the tail and in close proximity to its ectoderm. Apoptotic degeneration of the tailgut endoderm and VER heralds completion of tail growth (Fallon and Simandl, 1978
; Miller and Briglin, 1996
; Mills and Bellairs, 1989
).
Despite common tail formation in early vertebrate development, tail growth ceases at different developmental time points in a species specific manner. Tail length is a characteristic phenotype among species, yet its molecular controls are unknown. Molecular candidates include the Hox genes [homeobox-containing transcription factors that function in many aspects of pattern formation during development (Krumlauf, 1994
)]. In vertebrates, the Hox genes are expressed in a characteristic spatial and temporal pattern mirroring their physical location in the chromosome. The most 5' Hox genes are expressed in the posterior body region including the posterior mesodermal regions of the gut (Roberts et al., 1995
; Yokouchi et al., 1995b
). These play an important role in patterning the gut along the anteroposterior axis (AP) (Roberts et al., 1995
; Roberts et al., 1998
; Warot et al., 1997
). Hoxa13 and Hoxd13 are expressed specifically in the cloacal mesoderm and also uniquely in the hindgut and cloacal endoderm (Roberts et al., 1995
; Yokouchi et al., 1995b
). Their endodermal function is unknown.
Mutations in Hoxa13, both spontaneous and transgenic, exist in mice (Goodman and Scambler, 2001
). The mutant phenotypes show both limb and GGU anomalies. Spontaneous murine Hoxa13 mutant, hypodactyly (hd), has a 50 base deletion within the first exon of Hoxa13, resulting in a mutant fusion protein (Mortlock et al., 1996
). Although these mice suffer a high perinatal mortality, some homozygotes survive but are infertile because of hypoplasia of distal reproductive structures (Warot et al., 1997
). As the Hoxa13-null mice are early perinatal lethal (Fromental-Ramain et al., 1996
), Hoxa13 protein may act as a gain-of-function mutant.
Murine Hoxd13/ males show subtle GU anomalies (Dolle et al., 1993
; Kondo et al., 1996
; Podlasek et al., 1997
) and have abnormalities of the lowest sacral vertebra (Dolle et al., 1993
). Hoxd13/+ embryos crossed with Hoxa13-null heterozygotes, have more severe GGU anomalies than the Hoxd13/ alone, suggesting that cooperation and redundancy between Hoxa13 and Hoxd13 exists in their function in GGU development (Warot et al., 1997
).
Missense and nonsense mutations of one allele of HOXA13 cause hand-foot-genital (HFG) syndrome (Goodman and Scambler, 2001
), a rare, dominantly inherited human disease {OMIM 140000}. Affected individuals have mild, fully penetrant, symmetrical and bilateral hand and foot anomalies. Affected individuals also exhibit incompletely penetrant and variably severe GU tract abnormalities, including hypospadias in males and Müllerian duct fusion abnormalities in females. Both sexes show abnormalities in ureter/bladder placement. The variety of mutations described includes deletions, truncations of the protein, or amino acid substitutions within the conserved homeodomain. The resulting proteins are thought to act either as a gain-of-function mutation or as a possible competitor of the wild-type protein.
Mutations in human HOXD13 cause a severe distal limb phenotype termed synpolydactyly (SPD) {OMIM 186000}. This rare, dominantly inherited syndrome is caused by mutations in a polyalanine repeat within the coding region of HOXD13, including expansions and intragenic deletions (Goodman and Scambler, 2001
). Affected males often demonstrate GU abnormalities (Goodman and Scambler, 2001
).
The manner in which these HOXA13 and HOXD13 mutations and nulls lead to these specific GGU malformations is unknown and may be due to mesodermal and/or endodermal effect of the mutation. To date, murine models have failed to address their possible tissue-specific functions.
To study the role of Hoxa13 in GGU development we have used chick embryos. We have studied the specific endodermal role of Hoxa13 using the avian specific retroviral expression system and in ovo electroporation to overexpress wild-type and mutant forms of Hoxa13 in the chick hindgut endoderm in ovo. We constructed a chick Hoxa13 homolog of one of the specific mutations that causes HFG (HFGa13). We chose the originally described Hoxa13 mutation in which a small deletion in the C-terminal domain results in truncation of the protein (Morlock and Innis, 1997
). When the truncated protein is expressed in the chick posterior endoderm, a dramatic GGU and tail malformation results. We show that this effect is specific to endodermal HFGa13 expression. We show that HFGa13 probably acts by interfering with the normal function of endogenous Hoxa13 and Hoxd13.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Constructs
Isolation of chicken Hoxa13 gene has been previously described (Nelson et al., 1996
). Although this clone was thought to be a full-length cDNA, a recent manuscript described evolutionarily conserved 3' sequence which was not present in our original clone (Mortlock et al., 2000
). We isolated this N-terminal sequence by RT-PCR on E6 hindgut total RNA with a primer designed to amplify the conserved 3' sequence (ATGTTCCTCTACGACAACAGC). After sequence verification and subcloning we verified the full-length chick Hoxa13 cDNA. By PCR, we mutated chick Hoxa13 to produce a truncation similar to a specific human mutation (HFGa13). The mutated reverse oligonucleotide (TCAGATTGTGACCTGTCGC) produced a premature stop codon as described by Mortlock and Innis (Mortlock and Innis, 1997
).
Wild-type Hoxa13 and HFGa13 cDNAs RCAS(A) or RCAS(B) viruses, and a Hoxd13 RCAS(A) virus were produced as described (Morgan and Fekete, 1996
). We found no difference in any of the experimental results described below using either the short or long form Hoxa13 or HFGa13, and therefore we have not distinguished between them. Similarly, 3' long and short forms of RCAS(A)Hoxd13 acted equivalently in a chick limb bud overexpression study (Goff and Tabin, 1997
). We found no difference in the infectivity of either A or B envelope coats of RCAS; both acted equivalently.
Constructs for electroporation were prepared with wild-type Hoxa13 and HFGa13 cDNAs cloned into pCDNA3 (Invitrogen). An N-Flag epitope oligonucleotide was inserted in frame with the GAL4 DNA-binding domain (Sadowski and Ptashne, 1989
). All sequences were confirmed before use in experiments.
Transfection studies and western blots
Plasmids used for transfections were purified using the maxiprep reagent system (Qiagen). COS-7 cells at 60-80% confluence were washed twice with serum-free medium and then co-transfected with 100 ng of reporter plasmid [pG5luc containing 5 GAL4-binding sites (Promega)], 10 ng of Renilla luciferase promoter vector (Promega) and 100 ng of different Hoxa13 plasmids with 3 µl of LipofectAMINE (Life Technologies) in 200 µl of serum-free medium. After 30 minutes of incubation, 500 µl of medium supplemented with 10% serum was added. Cells were harvested after 36 hours in culture. Luciferase assays were checked with the Dual-LuciferaseTM Reporter Assay (Promega). Promoter activities were expressed as relative luciferase activity (units/Renilla units) and each value represents the mean of six separate wells. Relative expression of the GAL4 fusion proteins was assessed by western blot analysis of COS-7 extracts. Transfections with wild-type Hoxa13 and HFGa13 constructs fused to GAL4 DNA-binding domain (DBD) were as described previously (Sadowski and Ptashne, 1989
). GAL4 DBD antibody (Santa Cruz Biotech) was used as described by the manufacturer.
Cells were fixed 24 hours after transfection for 30 minutes in 4% paraformaldehyde in 0.1 M phosphate-buffered saline (PBS), permeabilized with PBS containing 0.02% Triton X-100, and incubated in 10% normal goat serum in PBS for 30 minutes at room temperature. Cells were then incubated with an anti-FLAG M5 monoclonal antibody (Kodak; 1:500) for 2 hours at room temperature, followed by incubation with secondary antibody. Images were collected and processed on a Microphot Nikon microscope.
Viral infection
This technique has been previously described (Morgan and Fekete, 1996
). Embryos at stage 8-10 were used for experiments of the posterior endoderm, stage 18 for experiments in the limb. Approximately 1-5 µl of freshly defrosted virus dyed with Fast Green was injected per embryo. For hindgut experiments, the virus was injected into the region lateral and posterior to the tailbud after a published fate map (Matsushita, 1999
). Double injections were performed by mixing equal volumes of each viral aliquot before injection, as previously described (Bendall et al., 1999
). In all cases, the HFGa13 virus was cloned in RCAS(B) and the wild-type viruses were in RCAS(A). For limb injections, the right hindlimb bud was viewed at stage 18. Approximately 1-5 µl of virus was injected, filling the entire limb bud. Eggs were then placed at 38°C until harvested. Injected viral constructs included short and long forms (see above) of wild-type Hoxa13, HFGa13 and, as controls, wild-type Hoxd13 and GFP. More than 10 dozen embryos were injected with each construct.
Electroporation
This technique was adapted to a technique previously published (Grapin-Botton et al., 2001
). E2.5 (stage 11-14) embryos were used for electroporation, at CIP invagination and tailbud formation. Plasmids were diluted to a final concentration of 2 µg/ml in PBS adding 1 µM MgCl2. To facilitate viewing of the viral aliquot and to slow diffusion, 50 µg/ml Nile Blue sulfate, 3 mg/ml carboxymethylcellulose was added to the construct liquid. This solution (5-10 µl) was deposited using a microcapillary pulled micropipette positioned under embryo at the posterior most endoderm layer (just caudal to the tailbud). Quickly after injection, a cathode was positioned on the dorsal surface of the embryo at the level of the injected construct. The anode was placed parallel to the cathode under the embryo (about 3 mm deep) at the level of the injected construct. Neither electrode touched the embryo. Three square pulses of 17 Volts and 50 mseconds each were applied to the embryo (BTX T-280 square wave electroporator generously lent to us by the Melton Lab under supervision of Anne Grapin-Botton) to allow vector integration into the endodermal layer. Eggs were incubated at 38°C until embryonic death or harvest. Controls included solution with all components except the vector, empty vector, vector constructed with wild-type Hoxa13 or with vector constructed with GFP. Approximately three dozen eggs were electroporated in experimental and control groups.
Whole embryo explants
The technique was adapted from that of Chapman et al. (Chapman et al., 2001
). Dissected stage 9-13 embryos were placed ventral side up in a freshly made thin layer of albumin/agarose (Chapman et al., 2001
). Using a dissecting microscope (Olympus SZH10), the posterior endoderm covering the tailbud and posterior was removed using one of these techniques: dissection alone using pulled glass needles and fine forceps, enzymatic digestion using 0.03% collagenase in PBS dropped on the embryo over the tailbud and allowed to sit for 15 minutes at 37°C and washed with five drop/aspirate cycles using PBS+10% chick serum followed by five drop/aspirate cycles using PBS+pen/strep or a combination of both techniques. Controls had no manipulation. Transplanted embryos had caudal endoderm removed as above. Donor endoderm was removed from donor stage 17 embryos (for facility and to ensure good Hoxa13 expression by the posterior endoderm) by sharp dissection, kept oriented and divided into thirds along the AP axis. The anterior endoderm and posterior endoderm were isolated and transplanted to host embryos (separately) by transfer pipette and forceps. Embryos were harvested immediately after manipulation, and at 24 and 48 hours. For each condition, at least 12 embryos were used over five separate experiments.
Analysis
Embryos were harvested and fixed in freshly made 4% paraformaldehyde in PBS for 4-20 hours. Fixed embryos were washed in PBS and then either taken through a graded series of methanol-PBS washes and kept at 20°C in methanol until used for whole-mount in situ hybridization studies or for cyrosections. Whole-mount in situ hybridization studies followed our published technique (Roberts et al., 1998
). Cryosections (10 µm) on Superfrost Plus slides (Fisher Scientific) were air dried for 4-18 hours and kept at 20°C until used. Some fixed, in situ hybridized embryos were embedded in paraffin and sectioned at 5 µm for histological analysis. Hematoxylin and Eosin staining was performed using standard techniques. Section in situ hybridization was performed using published techniques (Smith et al., 2000
). Immunohistochemical stains were performed using standard techniques and the Vectastain ABC detection system (Vector Laboratories) following the manufacturers directions. Hoxa13 antibody was a generous gift from A. Kuroiwa and used as previously described (Yokouchi et al., 1995a
). 3C2 antibody specific to RCAS GAG protein has been published before (Smith et al., 2000
). Ribroprobes were transcribed using Roche ribroprobe synthesis kits as per the manufacturers directions. All riboprobes used herein have been previously published (Nielsen et al., 2001
; Roberts et al., 1995
; Roberts et al., 1998
; Smith et al., 2000
; Vogel et al., 1996
).
Accession numbers
GenBank Accession Number for Gallus gallus Hoxa13 is AY030050.
| RESULTS |
|---|
|
|
|---|
|
|
In order to test our hypothesis, we first misexpressed HFGa13 in the hindlimb, and we were able to produce a severe morphological change reminiscent of the limb defect described in HFG syndrome (Fig. 2A). The HFGa13-expressing hindlimb showed a specific malformation characterized by a substantial reduction in limb size in both the anteroposterior and dorsoventral axes compared with the uninfected contralateral control limb. HFGa13 E6 infected hindlimbs revealed a specific skeletal hypoplasia of the fibula (without changes in the tibia) and a reduction of the entire autopod area (Fig. 2A,B). This phenotype suggested a late disruption of the apical ectodermal ridge (AER). Consistent with this, Fgf8 mRNA expression (Vogel et al., 1996
) was not detectable in the distal hindlimb AER of the HFGa13 hindlimbs (Fig. 2C). The distal fibular cartilage fails to properly develop and remains undifferentiated. Expression of Bapx1 was decreased only in the malformed fibula (Fig. 2D). No AER disruption or fibula maldevelopment were observed with the wild-type Hoxa13 overexpression (data not shown). These results suggest that HFGa13 interferes with the maintenance of the AER in the hindlimb and with formation of the fibula. We conclude that our construct functions to give a chick phenocopy of the human HFG syndrome.
|
|
To determine if endodermal expression of HFGa13 is sufficient to obtain these posterior defects we used an in ovo electroporation technique (Grapin-Botton et al., 2001
). Three groups of E2.5 (stage 11-16) embryos were electroporated: a control group with empty vector or a GFP-containing vectors, a group with the wild-type Hoxa13 construct and a group with HFGa13. In E5 survivors, posterior short tail/hindgut atresia was present only in the HFGa13 electroporated embryos, whereas electroporation of control constructs produced no defects (data not shown). The mutant phenotype was restricted to those embryos with hindgut epithelial expression of HFGa13 [electroporations restricted to the midgut endoderm failed to produce the posterior phenotype (data not shown)]. Survival was about 80% for all groups. The posterior endodermal HFGa13 expressing embryos show similar, albeit more severe, defects as those obtained using the injection/infection technique (Fig. 3E). Confirmation of tissue integration and endodermal tissue survival were performed by tag immunostaining on all embryos (Fig. 3F). Sections of experimental embryos confirmed an intact endoderm and a histologically normal neural tube and notochord (Fig. 4).
|
HFGa13 affects expression of Hoxd13, Fgf8 and Bapx1
Molecular analyses of HFGa13 mutant embryos were made with specific dorsoventral (DV), anteroposterior (AP) and cytodifferentiation markers. Strong downregulation was observed with VER marker Fgf8 (ectoderm and mesoderm) and with AP marker Hoxd13 (mesoderm and endoderm) (Fig. 5A and Fig. 5D, respectively). Bapx1 shows a diminished expression in the short tail (Fig. 5B). No change was noted in the expression of ventral mesodermal markers Wnt5a (Fig. 5C) and Bmp4 (data not shown), and there was normal expression of Shh (Fig. 5E).
|
|
HFGa13 interferes with the cellular functions of Hoxa13 and Hoxd13 proteins
To investigate the molecular pathway by which HFG Hoxa13 mutation functions, transactivation activities of wild-type Hoxa13 and HFGa13 were first analyzed in heterologous COS-7 cell line by luciferase assay using the synthetic GAL4 reporter system. Constructions for transfection studies were prepared using the pSG424 vector that contains the GAL4 DNA-binding domain. Wild-type Hoxa13, HFGa13 and Hoxd13 cDNAs were subcloned into pSG424 vector in frame with the GAL4 DBD. We show that wild-type Hoxa13 protein fused to the GAL4 DNA-binding domain is able to activate transcription of this synthetic reporter (Fig. 7A). The HFGa13 construct is not able to activate the synthetic GAL4 promoter but we did notice a decrease in the basal activity using this construct. To verify expression and protein stability, we performed western blot analysis on whole COS-7 cell extracts of transfected cells using a specific GAL4 DBD antibody. We show that all these proteins were expressed at comparable levels, as assayed by western blotting, indicating that the inability to activate transcription is not linked to a lack of expression or instability of the HFGa13 proteins (data not shown). To determine whether a difference in intracellular localization of HFGa13 proteins could affect transcriptional activity, localization of N-flag-tagged proteins within transfected COS-7 cells was examined by immunostaining (Fig. 7C,D). Strong signals for wild-type Hoxa13 and HFGa13 proteins were observed in the nuclei of transfected COS-7 cells.
Using the same synthetic GAL4 reporter system, we investigated the possible interactions between Hoxa13 and HFGa13. We used the same conditions with a plasmid containing Hoxa13 and a GAL4 DBD, but added one plasmid containing HFGa13 cDNA without GAL4 DBD (unable to bind the 5 GAL4 DBD repeats). Using this competition assay with same molar ratio, we show that HFGa13 protein is able to decrease Hoxa13 transcriptional activity (Fig. 7B). Increased amounts of HFGa13 increase the strength of the repression (data not shown). Interestingly, HFGa13 protein is also able to act in a dominant negative fashion with Hoxd13 by repressing Hoxd13 transcriptional activity (Fig. 7B).
In order to determine if HFGa13 acts as a dominant negative in vivo we used a competitive assay taking advantage of an epithelial phenotype alteration induced by overexpression of the wild-type Hoxa13 in the midgut. At E18, epithelial differentiation is nearly complete. Midgut epithelium is characterized by long and thin villi (Fig. 7E), whereas hindgut epithelium shows wide and flat villi (Fig. 7F). We have previously shown that ectopic Hoxd13 expression in the midgut mesoderm causes the midgut epithelium to develop with a hindgut/cloacal phenotype (Roberts et al., 1998
). We now show that the same epithelial transformation occurs with Hoxa13 misexpression in the midgut mesoderm (Fig. 7H,J). However, infection of the midgut with HFGa13 did not transform the epithelium (Fig. 7G). If our HFGa13 acts as a dominant negative, then it should be able to repress the midgut epithelial transformation induced by ectopic midgut mesodermal Hoxa13 or Hoxd13 expression. In order to test our hypothesis, we co-infected mesodermal midgut with either RCAS(A)-Hoxa13 or Hoxd13 and RCAS(B)-HFGa13 in equal titer/volume. We used the different RCAS envelope proteins to facilitate cellular co-infection as previously described (Morgan and Fekete 1996
; Bendall et al., 1999
). To verify co-infection, we checked viral expression in the midgut mesoderm by 3c2 immunostaining, and we deduced co-expression of either Hoxa13 or Hoxd13 and HFGa13 by in situ hybridization probing with the wild-type probes (Fig. 7L). Co-expression of HFGa13 with Hoxa13 (Fig. 7I) or with Hoxd13 (Fig. 7K) was sufficient to inhibit the action of Hoxa13 or Hoxd13. As we found wild-type epithelium phenotype in the co-infected mesoderm midguts, we can deduce that HFGa13 must have acted as a dominant negative.
These experiments indicate that this HFG nonsense mutation probably functions as a dominant negative. HFGa13 may compete with the endogenous function of wild-type Hoxa13 and/or Hoxd13 proteins in vivo as a dominant-negative, as observed with humans heterozygous for this mutation, probably by interfering with protein partners and/or transcriptional machinery.
| DISCUSSION |
|---|
|
|
|---|
Tail development is universal among vertebrates, although the persistence of a tail is not. Tail length is a function of the developmental time point when tailgut and VER apoptosis occurs. We suggest a functional relationship between the caudal endoderm and the VER. Gruneberg suggested that the origin of the VER is from the cloacal membrane (Gruneberg, 1956
). Other experimental evidence supports the association between caudal endoderm and the VER. VER ablation causes a displacement of the tailgut dorsally, by increasing the number of cells between the VER and tailgut (Goldman et al., 2000
). In murine chimeras derived from wild-type and sd mutant ES cells, it was shown that the sd cells never populated the ventral hindgut or tailgut, suggesting a ventral signal from the gut endoderm is absent in the sd mutant mouse (Maatman et al., 1997
). It may be that the failure of heterozygous and homozygous sd mutant cells to colonize the ventral hindgut endoderm is the earliest manifestation of the sd phenotype (Maatman et al., 1997
).
The molecular controls of normal or abnormal tail/GGU are poorly understood, but VER function and signals have recently been described (Goldman et al., 2000
). Signals from specialized ectoderm in the limb (AER) and the tail (VER) direct elongation of their respective subjacent structures. The AER and VER do not appear to be functionally equivalent. In mice, both the AER and VER express a fibroblast growth factor and a bone morphogenic protein (Dudley and Tabin, 2000
; Maatman et al., 1997
). Although exogenous application of FGF or BMP to the AER rescues the limb phenotype in AER ablated embryos (Zuniga et al., 1999
), when these proteins were placed on VER ablated tails in vitro, they failed to rescue the blunted tail phenotype (Goldman et al., 2000
). Transplanting the AER to VER ablated tails also fails in rescuing growth (Goldman et al., 2000
). There are clearly other factors, either from the VER or other tail tissues, that are important in directing tail development. We conclude that signaling between the endoderm and ectoderm at this very early stage of development is critical and independent of notochord or neural tube related inductions. We suggest that one of these factors is Hoxa13 derived from the caudal endoderm.
Clearly, there are multiple factors involved in tail development. Many different model systems (genetic, mechanical and toxic) can result in the phenotype of blunted tail and cloacal anomalies. Classical anatomic literature has examples of toxic or pharmacological induction of blunted tail and ourenteric malformations in chick, including exposure to insulin (Moseley, 1947
), organophosphides (Wyttenbach and Thompson, 1985
) and retinoic acid (Griffith and Wiley, 1989
). Mechanical disruptions by transection or extirpation of the notochord, tailbud and hindgut endoderm, shaking, or placement of a conductive glass tube all result in blunted tail and ourentery (Moseley, 1947
; Hotary and Robinson, 1992
). The transgenic data in mice shows that pertubations in many different pathways result in blunted tails including FGF (Furthauer et al., 1997
), BMP (Brunet et al., 1998
), Wnt (Yamaguchi et al., 1999
) and retinoic acid (Abu-Abed et al., 2001
). What is common to these diverse methods of producing the combination of caudal tail/vertebrae and gut defects? We suggest one possibility may be interruption of caudal endoderm signaling needed for normal tail development.
A spontaneous genetically dominant chicken mutation resembles the phenotype of our HFGa13 embryos. Dominant rumpless chicks develop a truncated tail and abnormal cloaca, and often show ourentery (Zwilling, 1942
). It would be very interesting to determine if Hoxa13 is mutated or if abnormalities in this pathway are present in this strain. We are currently studying dominant rumpless chick embryos for Hoxa13 mutations.
In the human syndrome HFG, no sacral or coccygeal anomalies have been reported. In the murine counterpart, hd shows anal stenosis but not caudal vertebrae or tail defects (Post and Innis, 1999
). Interestingly, caudal vertebrate malformations due to mutations in the paralog Hoxd13, though, have been reported both in human SPD syndrome (Akarsu et al., 1996
) and in homozygous Hoxd13 knockout mice (Dolle et al., 1993
). We show that our HFGa13 construct interferes with the normal expression and function of Hoxd13 (Fig. 5, Fig. 7). Our HFGa13 phenotype may be in part an indirect phenomenon that is due to downregulation of Hoxd13.
It is curious that the human, chick and murine phenotypes differ given the same genetic alteration. It may be that there are subtle vertebral defects in human individuals with HFG not described to date. Similarly, subtle murine lumbosacral or tail abnormalities may have escaped observation in the hd or Hoxa13/ mice. Our findings in chick may relate to the particular Hoxa13 mutation we constructed or to the relative levels of wild-type and mutant proteins in the transgenic embryos. Or, it may be due to a different function of Hoxa13 in avian species in the posterior vertebrae compared with that of mouse and human.
A theory derived from our results suggests that the presence of a tail structure in a vertebrate species may be related to persistence of the tailgut during development. In humans and avians the tailgut undergoes apoptotic regression relatively early in development (Fallon and Simandl, 1978
; Miller and Briglin, 1996
), whereas in rodents the tailgut persists over a much longer relative developmental time period (Goldman et al., 2000
). Although this study does not address the upstream controls of Hoxa13 expression in this caudal region, it follows that significant differences in this control should exists among species with different tail lengths.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abu-Abed, S., Dolle, P., Metzger, D., Beckett, B., Chambon, P. and Petkovich, M. (2001). The retinoic acid-metabolizing enzyme, CYP26A1, is essential for normal hindbrain patterning, vertebral identity, and development of posterior structures. Genes Dev. 15, 226-240.
Akarsu, A. N., Stoilov, I., Yilmaz, E., Sayli, B. S. and Sarfarazi, M. (1996). Genomic structure of HOXD13 gene: a nine polyalanine duplication causes synpolydactyly in two unrelated families. Hum. Mol. Genet. 5, 945-952.
Beals, R. K. and Rolfe, B. (1989). VATER association. A unifying concept of multiple anomalies. J. Bone Joint Surg. Am. 71, 948-950.
Bendall, A. J., Ding, J., Hu, G., Shen, M. M. and Abate-Shen, C. (1999). Msx1 antagonizes the myogenic activity of Pax3 in migrating limb muscle precursors. Development 126, 4965-4976.[Abstract]
Brunet, L. J., McMahon, J. A., McMahon, A. P. and Harland, R. M. (1998). Noggin, cartilage morphogenesis, and joint formation in the mammalian skeleton. Science 280, 1455-1457.
Catala, M., Teillet, M. A. and Le Douarin, N. M. (1995). Organization and development of the tail bud analyzed with the quail- chick chimaera system. Mech. Dev. 51, 51-65.[Medline]
Chapman, S. C., Collignon, J., Schoenwolf, G. C. and Lumsden, A. (2001). Improved method for chick whole-embryo culture using a filter paper carrier. Dev. Dyn. 220, 284-289.[Medline]
Dolle, P., Dierich, A., LeMeur, M., Schimmang, T., Schuhbaur, B., Chambon, P. and Duboule, D. (1993). Disruption of the Hoxd-13 gene induces localized heterochrony leading to mice with neotenic limbs. Cell 75, 431-441.[Medline]
Dudley, A. T. and Tabin, C. J. (2000). Constructive antagonism in limb development. Curr. Opin. Genet. Dev. 10, 387-392.[Medline]
Dunn, L., Gluecksohn-Schoenheimer, S. and Bryson, V. (1940). A new mutation in the mouse affection spinal column and urogenital system. J. Hered. 31, 343-348.
Fallon, J. F. and Simandl, B. K. (1978). Evidence of a role for cell death in the disappearance of the embryonic human tail. Am. J. Anat. 152, 111-129.[Medline]
Fromental-Ramain, C., Warot, X., Messadecq, N., LeMeur, M., Dolle, P. and Chambon, P. (1996). Hoxa-13 and Hoxd-13 play a crucial role in the patterning of the limb autopod. Development 122, 2997-3011.[Abstract]
Furthauer, M., Thisse, C. and Thisse, B. (1997). A role for FGF-8 in the dorsoventral patterning of the zebrafish gastrula. Development 124, 4253-4264.[Abstract]
Gajovic, S., Kostovic-Knezevic, L. and Svajger, A. (1993). Morphological evidence for secondary formation of the tail gut in the rat embryo. Anat. Embryol. 187, 291-297.[Medline]
Goff, D. J. and Tabin, C. J. (1997). Analysis of Hoxd-13 and Hoxd-11 misexpression in chick limb buds reveals that Hox genes affect both bone condensation and growth. Development 124, 627-636.[Abstract]
Goldman, D. C., Martin, G. R. and Tam, P. P. (2000). Fate and function of the ventral ectodermal ridge during mouse tail development. Development 127, 2113-2123.[Abstract]
Goodman, F. R. and Scambler, P. J. (2001). Human HOX gene mutations. Clin. Genet. 59, 1-11.[Medline]
Grapin-Botton, A., Majithia, A. R. and Melton, D. A. (2001). Key events of pancreas formation are triggered in gut endoderm by ectopic expression of pancreatic regulatory genes. Genes Dev. 15, 444-454.
Griffith, C. M. and Wiley, M. J. (1989). Direct effects of retinoic acid on the development of the tail bud in chick embryos. Teratology 39, 261-75.[Medline]
Griffith, C. M., Wiley, M. J. and Sanders, E. J. (1992). The vertebrate tail bud: three germ layers from one tissue. Anat. Embryol. 185, 101-113.[Medline]
Gruneberg, H. (1956). A ventral ectodermal ridge of the tail in mouse embryos. Nature 177, 787-788.[Medline]
Hamburger, V. and Hamilton, H. L. (1951). A series of normal stages in the development of the chick embryo. J. Morphol. 88, 49-92.
Holmdahl, D. E. (1925). Experimentelle untersuchungen uber die lage der grenze zwischen primarer and sekundarer korperentwicklung beium huhn. Anat. Anz Bd 59, 393-396.
Hotary, K. B. and Robinson, K. R. (1992). Evidence of a role for endogenous electrical fields in chick embryo development. Development 114, 985-996.[Abstract]
Kluth, D., Hillen, M. and Lambrecht, W. (1995). The principles of normal and abnormal hindgut development. J. Pediatr. Surg. 30, 1143-1147.[Medline]
Knezevic, V., De Santo, R. and Mackem, S. (1998). Continuing organizer function during chick tail development. Development 125, 1791-1801.[Abstract]
Kondo, T., Dolle, P., Zakany, J. and Duboule, D. (1996). Function of Posterior HoxD genes in the morphogenesis of the anal sphincter. Development 122, 2651-2659.[Abstract]
Krumlauf, R. (1994). Hox genes in vertebrate development. Cell 78, 191-201.[Medline]
Loder, R. T. and Dayioglu, M. M. (1990). Association of congenital vertebral malformations with bladder and cloacal exstrophy. J. Pediatr. Orthop. 10, 389-393.[Medline]
Maatman, R., Zachgo, J. and Gossler, A. (1997). The Danforths short tail mutation acts cell autonomously in notochord cells and ventral hindgut endoderm. Development 124, 4019-4028.[Abstract]
Martinez-Frias, M. L., Bermejo, E. and Rodriguez-Pinilla, E. (2000). Anal atresia, vertebral, genital, and urinary tract anomalies: a primary polytopic developmental field defect identified through an epidemiological analysis of associations. Am. J. Med. Genet. 95, 169-173.[Medline]
Matsushita, S. (1999). Fate mapping study of the endoderm in the posterior part of the 1.5-day- old chick embryo. Dev. Growth Differ. 41, 313-319.[Medline]
Miller, S. A. and Briglin, A. (1996). Apoptosis removes chick embryo tail gut and remnant of the primitive streak. Dev. Dyn. 206, 212-218.[Medline]
Mills, C. L. and Bellairs, R. (1989). Mitosis and cell death in the tail of the chick embryo. Anat. Embryol. 180, 301-308.[Medline]
Morgan, B. A. and Fekete, D. M. (1996). Manipulating gene expression with replication-competent retroviruses. In Methods in Avian Embryology. Vol. 51 (ed. M. Bronner-Fraser), pp. 185-218. San Diego: Academic Press.
Mortlock, D. P. and Innis, J. W. (1997). Mutation of HOXA13 in hand-foot-genital syndrome. Nat. Genet. 15, 179-180.[Medline]
Mortlock, D. P., Post, L. C. and Innis, J. W. (1996). The molecular basis of hypodactyly (Hd): a deletion in Hoxa 13 leads to arrest of digital arch formation. Nat. Genet. 13, 284-289.[Medline]
Mortlock, D. P., Sateesh, P. and Innis, J. W. (2000). Evolution of N-terminal sequences of the vertebrate HOXA13 protein. Mamm. Genome 11, 151-158.[Medline]
Moseley, H. R. (1947). Insulin-induced remplessness of chickens IV. Early embryology. J. Exp. Zool. 105, 279-316.
Nelson, C. E., Morgan, B. A., Burke, A. C., Laufer, E., DiMambro, E., Murtaugh, L. C., Gonzales, E., Tessarollo, L., Parada, L. F. and Tabin, C. (1996). Analysis of Hox gene expression in the chick limb bud. Development 122, 1449-1466.[Abstract]
Nielsen, C., Murtaugh, L. C., Chyung, J. C., Lassar, A. and Roberts, D. J. (2001). Gizzard formation and the role of Bapx1. Dev. Biol. 231, 164-174.[Medline]
Pasteels, J. (1943). Proliférations et croissance dans la gastrulation et la formation de la queue des vertébrés. Arch. Biol. 54, 1-51.
Podlasek, C. A., Duboule, D. and Bushman, W. (1997). Male accessory sex organ morphogenesis is altered by loss of function of Hoxd-13. Dev. Dyn. 208, 454-465.[Medline]
Post, L. C. and Innis, J. W. (1999). Infertility in adult hypodactyly mice is associated with hypoplasia of distal reproductive structures. Biol. Reprod. 61, 1402-1408.
Raas-Rothschild, A., Goodman, R. M., Meyer, S., Katznelson, M. B., Winter, S. T., Gross, E., Tamarkin, M., Ben-Ami, T., Nebel, L. and Mashiach, S. (1988). Pathological features and prenatal diagnosis in the newly recognised limb/pelvis-hypoplasia/aplasia syndrome. J. Med. Genet. 25, 687-697.
Rabaud, E. (1900). Etude embryologique de lourentérie et de la cordentérie. J. LAnat. Physiol. 619-634.
Roberts, D. J., Johnson, R. L., Burke, A. C., Nelson, C. E., Morgan, B. A. and Tabin, C. (1995). Sonic hedgehog is an endodermal signal inducing Bmp-4 and Hox genes during induction and regionalization of the chick hindgut. Development 121, 3163-3174.[Abstract]
Roberts, D. J., Smith, D. M., Goff, D. J. and Tabin, C. J. (1998). Epithelial-mesenchymal signaling during the regionalization of the chick gut. Development 125, 2791-2801.[Abstract]
Sadowski, I. and Ptashne, M. (1989). A vector for expressing GAL4(1-147) fusions in mammalian cells. Nucleic Acids Res. 17, 7539.
Saunders, J. W. (1948). The proximo-distal sequence of the origin of the parts of the chick wing and the role of the ectoderm. J. Exp. Zool. 108, 363-403.[Medline]
Schoenwolf, G. C. (1977). Tail (end) bud contributions to the posterior region of the chick embryo. J. Exp. Zool. 201, 227-246.
Schoenwolf, G. C. (1978). Effects of complete tail bud extirpation on early development of the posterior region of the chick embryo. Anat. Rec. 192, 289-295.[Medline]
Schoenwolf, G. C. (1979). Histological and ultrastructural observations of tail bud formation in the chick embryo. Anat. Rec. 193, 131-147.[Medline]
Smith, D. M., Nielsen, C., Tabin, C. J. and Roberts, D. J. (2000). Roles of BMP signaling and Nkx2.5 in patterning at the chick midgut-foregut boundary. Development 127, 3671-3681.[Abstract]
van der Putte, S. C. (1986). Normal and abnormal development of the anorectum. J. Pediatr. Surg. 21, 434-440.[Medline]
Vogel, A., Rodriguea, C., Izpisua-Belmonte, J. C. (1996). Involvement of FGF-8 in initiation, outgrowth and patterning of the vertebrate limb. Development 122, 1737-1750.[Abstract]
Warot, X., Fromental-Ramain, C., Fraulob, V., Chambon, P. and Dolle, P. (1997). Gene dosage-dependent effects of the Hoxa-13 and Hoxd-13 mutations on morphogenesis of the terminal parts of the digestive and urogenital tracts. Development 124, 4781-4791.[Abstract]
Wyttenbach, C. R. and Thompson, S. C. (1985). The effects of the organophosphate insecticide malathion on very young chick embryos: malformations detected by histological examination. Am. J. Anat. 174, 187-202.[Medline]
Yamaguchi, T. P., Bradley, A., McMahon, A. P. and Jones, S. (1999). A Wnt5a pathway underlies outgrowth of multiple structures in the vertebrate embryo. Development 126, 1211-1223.[Abstract]
Yokouchi, Y., Nakazato, S., Yamamoto, M., Goto, Y., Kameda, T., Iba, H. and Kuroiwa, A. (1995a). Misexpression of Hoxa-13 induces cartilage homeotic transformation and changes cell adhesiveness in chick limb buds. Genes Dev. 9, 2509-2522.
Yokouchi, Y., Sakiyama, J. and Kuroiwa, A. (1995b). Coordinated expression of Abd-B subfamily genes of the HoxA cluster in the developing digestive tract of chick embryo. Dev. Biol. 169, 76-89.[Medline]
Zuniga, A., Haramis, A. P., McMahon, A. P. and Zeller, R. (1999). Signal relay by BMP antagonism controls the SHH/FGF4 feedback loop in vertebrate limb buds. Nature 401, 598-602.[Medline]
Zwilling, E. (1942). The development of dominant rumplessness in chick embryos. Genetics 27, 641-656.
This article has been cited by other articles:
![]() |
C L Noble, A R Abbas, J Cornelius, C W Lees, G-T Ho, K Toy, Z Modrusan, N Pal, F Zhong, S Chalasani, et al. Regional variation in gene expression in the healthy colon is dysregulated in ulcerative colitis Gut, October 1, 2008; 57(10): 1398 - 1405. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ohta, K. Suzuki, K. Tachibana, H. Tanaka, and G. Yamada Cessation of gastrulation is mediated by suppression of epithelial-mesenchymal transition at the ventral ectodermal ridge Development, December 15, 2007; 134(24): 4315 - 4324. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. van den Brink Hedgehog Signaling in Development and Homeostasis of the Gastrointestinal Tract Physiol Rev, October 1, 2007; 87(4): 1343 - 1375. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Haraguchi, J. Motoyama, H. Sasaki, Y. Satoh, S. Miyagawa, N. Nakagata, A. Moon, and G. Yamada Molecular analysis of coordinated bladder and urogenital organ formation by Hedgehog signaling Development, February 1, 2007; 134(3): 525 - 533. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Come, F. Magnino, F. Bibeau, P. De Santa Barbara, K. F. Becker, C. Theillet, and P. Savagner Snail and Slug Play Distinct Roles during Breast Carcinoma Progression. Clin. Cancer Res., September 15, 2006; 12(18): 5395 - 5402. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Moniot, S. Biau, S. Faure, C. M. Nielsen, P. Berta, D. J. Roberts, and P. de Santa Barbara SOX9 specifies the pyloric sphincter epithelium through mesenchymal-epithelial signals Development, August 1, 2004; 131(15): 3795 - 3804. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. MacLaughlin and P. K. Donahoe Sex Determination and Differentiation N. Engl. J. Med., January 22, 2004; 350(4): 367 - 378. [Full Text] [PDF] |
||||
![]() |
E. A. Morgan, S. B. Nguyen, V. Scott, and H. S. Stadler Loss of Bmp7 and Fgf8 signaling in Hoxa13-mutant mice causes hypospadia Development, July 15, 2003; 130(14): 3095 - 3109. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Aubin, U. Dery, M. Lemieux, P. Chailler, and L. Jeannotte Stomach regional specification requires Hoxa5-driven mesenchymal-epithelial signaling Development, September 1, 2002; 129(17): 4075 - 4087. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||