|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
Department of Cell Biology and Anatomy, University of Arizona Health Sciences Center, 1501 N. Campbell Avenue, PO Box 245044, Tucson, AZ 85724, USA
*Author for correspondence (e-mail: pkrieg{at}email.arizona.edu)
Accepted 1 November 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Vasculogenesis, Tubulogenesis, Endoderm, Induction, Xenopus laevis
| INTRODUCTION |
|---|
|
|
|---|
A number of signaling pathways are known to play regulatory roles during embryonic vasculogenesis. At the earliest stages of vascular development, the VEGF signaling pathway is essential for blood vessel formation (Shalaby et al., 1995
; Carmeliet et al., 1996
; Ferrara et al., 1996
). The VEGF ligand is bound by two high-affinity receptors, VEGFR2 (Flk-1/KDR) and VEGFR1 (Flt-1), both of which belong to the tyrosine kinase receptor family. Flk-1 is expressed exclusively in vascular endothelial cells, and represents the earliest known specific marker of endothelial cells. In addition to its role as a mitogen, VEGF also acts as a chemoattractant for endothelial cells (Waltenberger et al., 1994
; Cleaver and Krieg, 1998
; Ash and Overbeek, 2000
), and is also involved in the correct assembly of endothelial cells into lumenated vessels (Drake et al., 2000
). Ablation of VEGF expression results in an almost complete block to vascular development (Carmeliet et al., 1996
; Ferrara et al., 1996
). On the other hand, expression of excess VEGF ligand in the embryo results in both hypervascularization and formation of abnormally large vascular lumens (Drake and Little, 1995
; Flamme et al., 1995
; Cleaver et al., 1997
). Following the formation of the original vascular network, numerous other growth factor signaling pathways are involved in the subsequent remodeling and maturation of the vascular system (reviewed by Yancopoulos et al., 2000
).
In amniotes, the formation of primary vascular networks occurs in two distinct regions. Extraembryonic vasculogenesis is observed in the yolk sac blood islands, while intraembryonic vasculogenesis occurs within the developing embryo itself. Classical embryological experiments have demonstrated that formation of the two vascular systems is not developmentally linked, since assembly of the intraembryonic vascular network is completely independent of extraembryonic vasculogenesis (Hahn, 1909
; Miller and McWhorter, 1914
; Reagan, 1915
). On the other hand, in organisms such as teleosts (bony fishes) and amphibians, all vasculogenesis occurs intraembryonically (Stockard, 1915
). A major difference between extraembryonic angioblasts and intraembryonic angioblasts lies in their organization. Extraembryonic angioblasts originate in blood islands, containing an outer layer of endothelial cells and an inner layer of red blood cells. In contrast, intraembryonic endothelial precursors are almost always first observed as solitary angioblasts (Risau, 1995
) and these can arise in any mesodermal tissue in the embryo with the exception of the prechordal mesoderm (Noden, 1989
; Wilms et al., 1991
; Wilting et al., 1995
). Only in certain specific, rare, instances are these intraembryonic angioblasts closely associated with blood cells (Cormier and Dieterlen-Lièvre, 1988
; Olah et al., 1988
; Jaffredo et al., 1998
; Ciau-Uitz et al., 2000
). Based on the remarkable ability of diverse mesodermal tissues to form angioblasts, it appears that the tissue environment in and around a specific region of mesoderm is responsible for regulating vascular endothelial cell specification and commitment (Noden, 1989
; Pardanaud et al., 1989
; Pardanaud and Dieterlen-Lièvre, 1999
; Cox and Poole, 2000
). Although both intraembryonic and extraembryonic angioblasts are of mesodermal origin, the different environments in which they arise and the differences in the fate of associated cells raises the possibility that the two populations may be specified by different mechanisms.
At present, the precise origin of the embryonic angioblast lineage is uncertain. Numerous anatomical studies have shown that angioblasts in the extraembryonic blood islands, and also in the earliest intraembryonic blood vessels, arise in close proximity to endoderm (Mato et al., 1964
; Gonzalez-Crussi, 1971
; Mobbs and McMillan, 1979
; Meier, 1980
; Kessel and Fabian, 1985
; Pardanaud et al., 1989
). Based on these observations, it was proposed (Wilt, 1965
) that direct interactions between the endoderm and mesoderm might be required for angioblast induction, and this possibility has been investigated in a number of different studies carried out using the avian embryo (Wilt, 1965
; Miura and Wilt, 1969
; Pardanaud et al., 1989
; Pardanaud and Dieterlen-Lièvre, 1993
). In chick tissue culture experiments, when specific portions of the area vasculosa that form the extraembryonic blood islands were separated into the mesectodermal and endodermal components, the mesectodermal component failed to generate detectable endothelial cell enclosed blood islands (Wilt, 1965
). Endothelial cell differentiation could be restored if the mesectoderm was recombined with endoderm. This suggests that an endodermally derived inductive signal is necessary for extraembryonic endothelial cell formation, at least in the context of blood island formation. This result was corroborated in a subsequent study (Miura and Wilt, 1969
). While these studies implied that endoderm is required for blood island formation, in the absence of molecular markers it was not possible to identify individual angioblasts prior to blood vessel formation, and so the results are not necessarily conclusive.
In studies of intraembryonic vasculogenesis, it was also proposed (Pardanaud et al., 1989
) that interactions between mesodermal and endodermal tissues are necessary for vasculogenesis. Once again, this proposal was based on the fact that vasculogenic mesoderm is always observed in the immediate vicinity of endoderm. This hypothesis was extended in a subsequent study showing that, when grafted onto chick limb buds, quail splanchnopleuric mesoderm (which is in contact with endoderm) generated greatly more endothelial cells than somatopleuric mesoderm (not in contact with endoderm). On the basis of this result, it was concluded that an endodermal factor is necessary to promote the emergence of endothelial cells (Pardanaud and Dieterlen-Lièvre, 1993
). More recently, it has been argued that an indian hedgehog signal from the visceral endoderm is necessary for specifying endothelial cell fate in mouse embryos (Belaoussoff et al., 1998
; Dyer et al., 2001
). Overall, these studies imply that interactions between endoderm and mesoderm are required for vascular endothelial cell specification. Notwithstanding a large number of assumptions and the relative paucity of experimental support, this relationship is routinely stated in the literature and has largely assumed the status of dogma (Wilt, 1965
; Miura and Wilt, 1969
; Gonzalez-Crussi, 1971
; Augustine, 1981
; Kessel and Fabian, 1985
; Pardanaud et al., 1989
; Pardanaud and Dieterlen-Lièvre, 1993
; Risau and Flamme, 1995
; Sugi and Markwald, 1996
; Belaoussoff et al., 1998
; Waldo and Kirby, 1998
; Cleaver and Krieg, 1999
; Roman and Weinstein, 2000
; Dyer et al., 2001
; Poole et al., 2001
).
Despite the widespread acceptance of a role for endoderm in angioblast specification, the results of a number of experiments using several different organisms have called this conclusion into question (see Discussion). It is important to acknowledge, however, that none of these studies had been designed to specifically address the requirement of endoderm for angioblast formation, and so none of them were fully controlled. To formally address this question, we have used a combination of molecular and classical embryology techniques to examine the role of endodermal tissues during vasculogenesis. We find that large numbers of angioblasts are formed in frog embryos that contain no detectable endoderm. However, angioblasts in these endoderm-depleted embryos fail to assemble into endothelial tubes. This observation was confirmed in complementary experiments using avian embryos. In summary, our studies indicate that endoderm is indeed important for vascular development, not for angioblast specification, but for the formation of tubular blood vessels.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Japanese quail (Coturnix coturnix japanica) embryos were incubated until stage 5 (Hamburger and Hamilton, 1951
) and whole embryo New culture explants were mounted on glass rings on albumen agar dishes (New, 1955
). Endoderm was then removed from one side of the embryo, and the adjacent extraembryonic domain, using electrolytically sharpened tungsten needles, while the other side was left intact to serve as an internal control. These embryos were then incubated to the 6-somite stage (stage 9), at which time vascular structure was examined.
VegT antisense-treated embryos
cDNA from VegT antisense oligonucleotide-treated embryos was generously provided by Matt Kofron and Janet Heasman. The samples, obtained following the host-transfer technique, are identical to those used by Kofron et al. (Kofron et al., 1999
), and represent oocytes injected with 5-8 ng of phosphorothioate antisense VegT oligonucleotides and subsequently implanted into host females prior to fertilization. Embryos were harvested at stage 34 for reverse transcription-polymerase chain reaction (RT-PCR) analysis.
RT-PCR
Approximately eight animal caps were harvested for each sample and total RNA was prepared using a standard SDS-Proteinase K method. cDNA samples were prepared from one-half of the total RNA (with the other have serving as a RT control) and radioactive RT-PCRs were performed using 1/25th of the cDNA reaction as template and 0.3 µCi of [
-32P]dATP in a 50 µl reaction. The number of cycles for each primer was empirically determined so that they would be in the linear range of amplification. PCR samples were run on non-denaturing 5% acrylamide gels.
Primers
Cardiac
-actin (Niehrs et al., 1994
) (Tm=63°C); cardiac Troponin I: forward: 5'TCGGTCCTATGCCACAGAACCAC3', reverse: 5'TTTTGAACTTGCCACGGAGG3' (Tm=63°C); Endodermin: forward: 5'GAGACTTGGCTTTGGGACCTTGTTG3', reverse: 5'CCATTTCCTGCGAGCACAGTAACC3' (Tm=62°C); Erg (detects both isoforms): forward: 5'CCTCAACAAGACTGGCTCTCACAG3', reverse: 5'TGCTCCACAAAGTAGGGTCAGC3' (Tm=66°C); Flk-1: forward: 5'AAGAGGGAACAAGAATGAGGGC3', reverse: 5'TGCTGCTGCTGTGAAGAAACC3' (Tm=64°C); IFABP: (Henry et al., 1996
) (Tm=60°C); Insulin (Henry et al., 1996
) (Tm=63°C); Mixer: forward: 5'GCTTTGTTCAGAATCCACCTACGC3', reverse: 5'AGTGATGGTCTTGTTGGGAGGG3' (Tm=61°C); Ornithine decarboxylase (ODC) (Bouwmeester et al., 1996
) (Tm=64°C); SCL/tal-1: forward: 5'CCCAAATGAAAGGCAAACGG3', reverse: 5'CAGTTCTGTGGCTGGTGTCAAAG3' (Tm=64°C); Xbra: forward: 5'GGAGTAATGAGTGCGACCGAGAGC3', reverse: 5'GCCACAAAGTCCAGCAGAACCG3' (Tm=60°C); Xlhbox8: forward: 5'AAGGACAGTGGACAGATG3', reverse: 5'GGATGAAGTTGGCAGAGG3' (Tm=65°C); Xsox17-
: forward: 5'TGCCAATAATGATGACTGGACTCG3', reverse: 5'TCTTCACCTGTTTCCTCCTGCG3' (Tm=61°C).
In situ hybridization and histology
Digoxigenin-labeled RNA probe was transcribed using MEGAscript (Ambion). Embryos were assayed by in situ hybridization with the endothelial marker X-msr as previously described (Gerber et al., 1999
), and developed in either BM-Purple (Roche) or NBT-BCIP (Roche). X-msr (Devic et al., 1996
; Cleaver et al., 1997
) is the Xenopus orthologue of the mammalian APJ receptor (Devic et al., 1999
), which is the receptor for the apelin peptide (Tatemoto et al., 1998
). While the precise physiological role of this ligand-receptor system is unclear, it is thought that it plays a related role to the structurally related angiotensin II signaling system (Lee et al., 2000
). Paraffin sections on embryos assayed by in situ hybridization were carried out by dehydrating the embryos in a graded ethanol series, washing twice for 10 minutes each in xylene, and then three times in Paraplast at 60°C for a total of 2 hours. Embryos were then embedded in Paraplast and sectioned at a thickness of 12 µm. Slides were dewaxed in xylene and viewed by DIC optics. For plastic sections, embryos were fixed in 1/2 strength Karnovskys solution in 0.1 M cacodylate buffer, embedded in Spurr resin, post-fixed in 2% OsO4, sectioned at a thickness of 1 µm and stained with Toluidine Blue (semi-thin histological sections) or 3 µm (in situ hybridized sections). For electron microscopy imaging, thin sections (approximately 0.06 µm) were stained with uranyl acetate and lead citrate and imaged on a Philips CM12 transmission electron microscope.
Immunohistochemistry
Quail endothelial cells were detected with the QH1 monoclonal antibody (Pardanaud et al., 1987
) (Developmental Studies Hybridoma Bank). The procedure was performed as described by Sugi and Markwald (Sugi and Markwald, 1996
), except that embryos were blocked in 5% normal donkey serum and a donkey anti-mouse Texas Red-conjugated IgG secondary antibody (Jackson ImmunoResearch) was used at a 1:500 dilution.
| RESULTS |
|---|
|
|
|---|
-actin is expressed at normal levels in the manipulated embryos while, as expected, expression of the heart-specific marker cardiac troponin I is undetectable (Fig. 2). We believe that the slightly reduced levels of angioblast markers in endoderm-depleted embryos may be due to reduced angioblast proliferation, because in normal embryos the endoderm expresses substantial amounts of VEGF (Cleaver et al., 1997
|
|
|
-actin. There is, however, no detectable expression of the endodermal markers endodermin, Xsox17-
, insulin, IFABP and xlhbox8. While endodermin is detected in manually dissected endodermless embryos, probably due to its expression in paraxial mesoderm, it is not present in bFGF-induced animal caps (Sasai et al., 1996
and mixer. The vascular markers flk-1 and erg are also absent at this stage, in agreement with their known embryonic expression profiles (Cleaver et al., 1997
|
As described above, embryos from which endoderm had been physically dissected at stage 10.5 showed the presence of an abundance of aggregated cords of angioblasts during later development (stage 34) (Fig. 1C,E,G). In no case, however, did we observe angioblasts assembling into the patent blood vessels visible in the control embryos. In order to ensure that this was not merely the consequence of a developmentally delayed phenotype, endoderm-depleted embryos were incubated until stage 37. At this stage, all embryos contained dark eye pigment and melanocytes, clear indications that they had developed past the stage when blood vessel tube formation would normally occur (about stage 34) (Cleaver et al., 1997
). When these endoderm-depleted embryos were assayed by in situ hybridization for the vascular marker X-msr, angioblasts, but no endothelial tubes, were visible in whole-mount embryos (Fig. 5B,C). In sectioned embryos, thick assemblages of angioblasts were visible in lateral regions of the embryo (Fig. 5F). However, despite the presence of large numbers of angioblasts, none of the endoderm-depleted embryos (0/21) contained any detectable vascular tubes. On the other hand, patent vessels were readily visible in all control embryos (15/15 examined; Fig. 5E).
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Although this study is amongst the first to use molecular markers to directly address the role of endoderm in angioblast specification, it is important to acknowledge that a number of previous studies, using different experimental systems, have hinted that endodermal-mesodermal interactions are not essential for the formation of angioblasts. For example, it has been shown that mouse embryoid bodies lacking activity of the transcription factor GATA-4, fail to form extraembryonic endoderm. In the absence of endoderm, these embryoid bodies are unable to form endothelial cell enclosed blood islands. This observation is in apparent agreement with the endoderm induction model. However, use of specific markers indicated that vascular endothelial cells were still present in these embryoid body cultures (Bielinska et al., 1996
). Similar results were obtained embryologically (Palis et al., 1995
); they showed that murine yolk sac explants that contained extraembryonic mesoderm, but were separated from endoderm, still developed endothelial cells, but lacked organized blood vessels. In this experiment, however, dissections were performed at E7.5. Since extraembryonic angioblasts are initially detected at E6.5 (Drake and Fleming, 2000
), it is possible that angioblasts had already been specified prior to the separation of mesoderm from endoderm.
Further evidence that angioblasts form in the absence of endoderm is provided by a series of experiments using quail-chick heterochronic chimeras. In these experiments, quail blastoderm treated with cytochalasin B to block gastrulation was grafted to host limb buds. The presence of endothelial cells was then assessed using the antibody QH-1. Because limb buds do not contain endoderm, the presence of quail endothelial cells in these chimeras implied that the endodermal germ layer is not necessary for vascular cell specification (Christ et al., 1991
; von Kirschhofer et al., 1994
; Wilting and Christ, 1996
). However, interpretation of the limb bud experiments in the context of endothelial cell specification is difficult since they utilized an older, already specified population of mesoderm that contained a complex and specific set of growth factors involved in limb bud patterning.
Studies of zebrafish mutants that are deficient in endoderm formation also support our suggestion that endoderm is not necessary for vascular specification. For example, one-eyed pinhead (oep) mutants lack almost all endoderm (Schier et al., 1997
), but still contain abundant angioblasts (Brown et al., 2000
). In these mutants, however, at least some endodermal tissue is still present and so the absolute requirement for endoderm in angioblast formation is difficult to ascertain.
Some recent molecular studies using mouse tissues would appear to directly contradict our conclusions. In particular, Belaoussof et al. (Belaoussof et al., 1998
) have suggested that an early signal from the visceral endoderm can respecify neurectoderm to a posterior mesodermal cell fate containing both endothelial and blood markers. It was concluded that a secreted signal from the visceral endoderm is needed to induce endothelial cell fate. Subsequent work has suggested that indian hedgehog (Ihh) is the secreted signaling factor (Dyer et al., 2001
). This result is challenged by gene ablation studies in mice, which show that embryos lacking function of either Ihh or Smoothened (the receptor for all hedgehog proteins) still contain at least rudimentary endothelial tubes in the yolk sac (Byrd et al., 2002
). This result conclusively demonstrates that hedgehog signaling is not necessary for angioblast specification, at least in an in vivo context. The tissue recombination work (Belaoussof et al., 1998
) implying that visceral endoderm is required to induce endothelial cells, is a more complicated issue. However, we propose that the function of visceral endoderm in these experiments is in fact the induction of mesodermal tissue, since this is not present in the original explants. Once mesoderm is present, it is then capable of forming angioblasts, precisely as observed in our experiments. Alternatively, it is possible that the mechanism leading to specification of angioblasts in frog and avian embryos differs from that operating in the mammalian embryo.
Endoderm is required for endothelial tube formation
Our experiments show that angioblasts are indeed present in embryos containing no endoderm. However, these angioblasts fail to assemble into patent vascular tubes. Serial sectioning through endoderm-depleted embryos shows that formation of tubular blood vessels is absent or severely reduced (Fig. 6B), although in situ hybridization indicates that angioblasts have assembled into dense, cord-like aggregations throughout the trunk of the embryo (Fig. 5B,C). These observations suggest that vasculogenesis in endoderm-depleted embryos is interrupted at a step prior to tube formation. This view is supported by the rescue experiments in which endoderm from a donor embryo is implanted into the endoderm-depleted embryo. Despite the trauma caused by this rather crude manipulation, the majority of rescued embryos show vascular tube formation. In the most effective cases, the rescued embryos showed clear organization of the posterior cardinal veins and intersomitic vessels. Variation in the amount of vascular structure observed in different rescued embryos is presumably due to differential healing, but we cannot exclude the possibility that pre-patterning of the endoderm has already occurred and therefore the degree of vascular rescue may be related to the orientation of the implanted endodermal tissue. In agreement with our results using Xenopus, we note that zebrafish oep mutants, which lack most endoderm, contain angioblasts but exhibit dramatic defects in axial vascular formation, and lack a functional circulatory system (Brown et al., 2000
), suggesting that endoderm is indeed required for vascular assembly. Likewise, murine extraembryonic mesoderm, when isolated from endoderm, forms endothelial cells that fail to assemble into vascular tubes (Palis et al., 1995
; Bielinska et al., 1996
).
The results of our experiments raise two fundamental questions relating to the mechanisms underlying vascular development. First, what is the molecular nature of the endodermal signal necessary for vascular tubulogenesis? At present, the composition of this signal is completely unknown. One could imagine it being a secreted molecule influencing expression of a subset of endothelial genes, or perhaps a secreted structural protein or extracellular matrix component that is necessary for vascular fusion. Given the close juxtaposition of endoderm with vasculogenic mesoderm, a cell surface signal is also plausible. It also remains to be determined whether the signal arising from endoderm is expressed exclusively in areas adjacent to mesodermal tissues or if it is distributed throughout the endoderm. The second question is related to the observation that endoderm is not involved in angioblast specification. This implies that any signal for angioblast specification arises within the mesoderm itself. The ectodermal germ layer, the only other theoretically possible source of inductive signals, is not likely to contribute to vasculogenesis because it has been shown to profoundly inhibit vasculogenesis (Feinberg et al., 1983
; Wilson et al., 1989
; Pardanaud and Dieterlen-Lièvre, 1993
; Pardanaud and Dieterlen-Lièvre, 1999
). While our results suggest that the origin of the angioblast specification signal is likely to be exclusively mesodermal, the molecular nature of the signal is completely unknown. Because almost all mesoderm has the potential to express angioblasts (Noden, 1989
), it is possible that angioblast specification occurs by an inherent patterning mechanism, perhaps analogous to the Delta/Notch signaling pathway responsible for neuroblast specification in Drosophila. Inhibitory signals from ectodermal tissues may subsequently help to determine the boundaries of the vasculogenic network.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ash, J. and Overbeek, P. (2000). Lens-specific VEGF-A expression induces angioblast migration and proliferation and stimulates angiogenic remodeling. Dev. Biol. 223, 383-398.[Medline]
Augustine, J. (1981). Influence of the entoderm on mesodermal expansion in the area vasculosa of the chick. J. Embryol. Exp. Morphol. 65, 89-103.
Baltzinger, M., Mager-Heckel, A. and Remy, P. (1999). Xl erg: expression pattern and overexpression during development plead for a role in endothelial cell differentiation. Dev. Dyn. 216, 420-433.[Medline]
Belaoussoff, M., Farrington, S. and Baron, M. (1998). Hematopoietic induction and respecification of the A-P identity by visceral endoderm signaling in the mouse embryo. Development 125, 5009-5018.[Abstract]
Bielinska, M., Narita, N., Heikinheimo, M., Porter, S. and Wilson, D. (1996). Erythropoiesis and vasculogenesis in embryoid bodies lacking visceral yolk sac endoderm. Blood 88, 3720-3730.
Bouwmeester, T., Kim, S., Sasai, Y., Lu, B. and De Robertis, E. (1996). Cerberus is a head-inducing secreted factor expressed in the anterior endoderm of Spemanns organizer. Nature 382, 595-601.[Medline]
Brown, L., Rodaway, A., Schilling, T., Jowett, T., Ingham, P., Patient, R. and Sharrocks, A. (2000). Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech. Dev. 90, 237-252.[Medline]
Byrd, N., Becker, S., Maye, P., Narasimhaiah, R., St-Jacques, B., Zhang, X., McMahon, J., McMahon, A. and Grabel, L. (2002). Hedgehog is required for murine yolk sac angiogenesis. Development 129 (in press).
Carmeliet, P., Ferreira, V., Breier, G., Pollefeyt, S., Kleckens, L., Gertsenstein, M., Fahrig, M., Vandenhoeck, A., Harpal, K., Eberhardt, C., Declercq, C., Pawling, J., Moons, L., Collen, D., Risau, W. and Nagy A. (1996). Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 380, 435-438.[Medline]
Carmeliet, P. (2000). Mechanisms of angiogenesis and arteriogenesis. Nature Med. 6, 389-395.[Medline]
Christ, B., Grim, M., Wilting, J., von Kirschhofer, K. and Wachtler, F. (1991). Differentiation of endothelial cells in avian embryos does not depend on gastrulation. Acta Histochem. 91, 193-199.[Medline]
Ciau-Uitz, A., Walmsley, M. and Patient, R. (2000). Distinct Origins of Adult and Embryonic Blood in Xenopus. Cell 102, 787-796.[Medline]
Cleaver, O. and Krieg, P. (1998). VEGF mediates angioblast migration during development of the dorsal aorta in Xenopus. Development 125, 3905-3914.[Abstract]
Cleaver, O. and Krieg, P. (1999). Molecular Mechanisms of Vascular Development. In Heart Development (ed. R. Harvey and N. Rosenthal), pp. 221-252. San Diego, CA: Academic Press.
Cleaver, O., Tonissen, K., Saha, M. and Krieg, P. (1997). Neovascularization of the Xenopus embryo. Dev. Dyn. 210, 66-77.[Medline]
Cooke, J. (1989). Xenopus mesoderm induction: evidence for early size control and partial autonomy for pattern development by onset of gastrulation. Development 106, 519-529.[Abstract]
Cormier, F. and Dieterlen-Lièvre, F. (1988). The wall of the chick embryo aorta harbours M-CFC, G-CFC, GM-CFC and BFU-E. Development 102, 279-285.[Abstract]
Cornell, R., Musci, T. and Kimelman, D. (1995). FGF is a prospective competence factor for early activin-type signals in Xenopus mesoderm induction. Development 121, 2429-2437.[Abstract]
Cox, C. and Poole, T. (2000). Angioblast differentiation is influenced by the local environment: FGF-2 induces angioblasts and patterns vessel formation in the quail embryo. Dev. Dyn. 218, 371-382.[Medline]
Devic, E., Rizzoti, K., Bodin, S., Knibiehler, B. and Audigier, Y. (1999). Amino acid sequence and embryonic expression of msr/apj, the mouse homolog of Xenopus X-msr and the human APJ. Mech. Dev. 84, 199-203.[Medline]
Devic, E., Paquereau, L., Vernier, P., Knibiehler, B. and Audigier, Y. (1996). Expression of a new G protein-coupled receptor X-msr is associated with an endothelial lineage in Xenopus laevis. Mech. Dev. 59, 129-140.[Medline]
Drake, C. and Fleming, P. (2000). Vasculogenesis in the day 6.5 to 9.5 mouse embryo. Blood 95, 1671-1679.
Drake, C. and Jacobson, A. (1988). A survey by scanning electron microscopy of the extracellular matrix and endothelial components of the primordial chick heart. Anat. Rec. 222, 391-400.[Medline]
Drake, C., LaRue, A., Ferrara, N. and Little, C. (2000). VEGF regulates cell behavior during vasculogenesis. Dev. Biol. 224, 178-188.[Medline]
Drake, C. and Little, C. (1995). Exogenous vascular endothelial growth factor induces malformed and hyperfused vessels during embryonic neovascularization. Proc. Natl. Acad. Sci. USA 92, 7657-7661.
Dyer, M., Farrington, S., Mohn, D., Munday, J. and Baron, M. (2001). Indian hedgehog activates hematopoiesis and vasculogenesis and can respecify prospective neurectodermal cell fate in the mouse embryo. Development 128, 1717-1730.[Abstract]
Feinberg, R., Repo, M. A. and Saunders, J. (1983). Ectodermal control of the avascular zone of the peripheral mesoderm in the chick embryo. J. Exp. Zool. 226, 391-398.[Medline]
Ferrara, N., Carver-Moore, K., Chen, H., Dowd, M., Lu, L., OShea, K., Powell-Braxton, L., Hillan, K. and Moore, M. (1996). Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature 380, 439-442.[Medline]
Flamme, I., von Reutern, M., Drexler, H., Syed-Ali, S. and Risau, W. (1995). Overexpression of vascular endothelial growth factor in the avian embryo induces hypervascularization and increased vascular permeability without alterations of embryonic pattern formation. Dev. Biol. 171, 399-414.[Medline]
Gamer, L. and Wright, C. (1995). Autonomous endodermal determination in Xenopus: regulation of expression of the pancreatic gene XlHbox 8. Dev. Biol. 171, 240-251.[Medline]
Gerber, W., Yatskievych, T., Antin, P., Correia, K., Conlon, R. and Krieg, P. (1999). The RNA-binding protein gene, hermes, is expressed at high levels in the developing heart. Mech. Dev. 80, 77-86.[Medline]
Gonzalez-Crussi, F. (1971). Vasculogenesis in the chick embryo, an ultrastructural study. Am. J. Anat. 130, 441-460.[Medline]
Green, J., Howes, G., Symes, K., Cooke, J. and Smith, J. (1990). The biological effects of XTC-MIF: quantitative comparison with Xenopus bFGF. Development 108, 173-183.[Abstract]
Hahn, H. (1909). Experimentelle studien uber die entstehung des blutes und der ersten Gefabe beim huhnchen. Arch. Entw. Org. 27, 337-433.
Hamburger, V. and Hamilton, H. (1951). A series of normal stages in the development of the chick embryo. J. Morph. 88, 49-93.
Henry, G. and Melton, D. (1998). Mixer, a homeobox gene required for endoderm development. Science 281, 91-96.
Henry, G., Brivanlou, I., Kessler, D., Hemmati-Brivanlou, A. and Melton, D. (1996). TGF-ß signals and a prepattern in Xenopus laevis endodermal development. Development 122, 1007-1015.[Abstract]
Houser, J., Ackerman, A. and Knouff, R. (1961). Vasculogenesis and erythropoiesis in the living yolk sac of the chick embryo. Anat. Rec. 140, 29-43.
Jaffredo, T., Gautier, R., Eichmann, A. and Dieterlen-Lièvre, F. (1998). Intraaortic hemopoietic cells are derived from endothelial cells during ontogeny. Development 125, 4575-4583.[Abstract]
Kessel, J. and Fabian, B. (1985). Graded morphogenetic patterns during the development of the extraembryonic blood system and coelom of the chick blastoderm: a scanning electron microscope and light microscope study. Am. J. Anat. 173, 99-112.
Keyt, B., Berleau, L., Nguyen, H., Chen, H., Heinsohn, H., Vandlen, R. and Ferrara, N. (1996). The carboxyl-terminal domain (111-165) of vascular endothelial growth factor is critical for its mitogenic potency. J. Biol. Chem. 271, 7788-7795.
Kofron, M., Demel, T., Xanthos, J., Lohr, J., Sun, B., Sive, H., Osada, S., Wright, C., Wylie, C. and Heasman, J. (1999). Mesoderm induction in Xenopus is a zygotic event regulated by maternal VegT via TGFß growth factors. Development 126, 5759-5770.[Abstract]
Lee, D., Cheng, R., Nguyen, T., Fan, T., Kariyawasam, A., Liu, Y., Osmond, D., George, S. and ODowd, B. (2000). Characterization of Apelin, the ligand for the APJ receptor. J. Neurochem. 74, 34-41.[Medline]
Mato, M., Aikawa, E. and Kishi, K. (1964). Some observations on interstice between mesoderm and endoderm in the area vasculosa of the chick blastoderm. Exp. Cell Res. 35, 426-428.
Mead, P., Kelley, C., Hahn, P., Piedad, O. and Zon, L. (1998). SCL specifies hematopoietic mesoderm in Xenopus embryos. Development 125, 2611-2620.[Abstract]
Meier, S. (1980). Development of the chick embryo mesoblast: pronephros, lateral plate, and early vasculature. J. Embryol. Exp. Morph. 55, 291-306.[Medline]
Miller, A. and McWhorter, J. (1914). Experiments on the development of blood vessels in the area pellucida and embryonic body of the chick. Anat. Rec. 8, 203-227.
Miura, Y. and Wilt, F. (1969). Tissue interaction and the formation of the first erythroblasts of the chick embryo. Dev. Biol. 19, 201-211.[Medline]
Mobbs, I. and McMillan, D. (1979). Structure of the endodermal epithelium of the chick yolk sac during the early stages of development. Am. J. Anat. 155, 287-309.[Medline]
Nascone, N. and Mercola, M. (1995). An inductive role for the endoderm in Xenopus cardiogenesis. Development 121, 515-523.[Abstract]
New, D. (1955). A new technique for the cultivation of the chick embryo in vitro. J. Embryol. Exp. Morph. 3, 326-331.
Niehrs, C., Steinbesser, H. and De Robertis, E. (1994). Mesodermal patterning by a gradient of the vertebrate homeobox gene goosecoid. Science 263, 817-820.
Nieuwkoop, P. D. and Faber, J. (1994). Normal Table of Xenopus laevis (Daudin). New York, NY: Garland Publishing, Inc.
Noden, D. (1989). Embryonic origins and assembly of blood vessels. Amer. Rev. Respir. Dis. 140, 1097-1103.[Medline]
Olah, I., Medgyes, J. and Glick, B. (1988). Origin of aortic cell clusters in the chicken embryo. Anat. Rec. 222, 60-68.[Medline]
Palis, J., McGrath, K. and Kingsley, P. (1995). Initiation of hematopoiesis and vasculogenesis in murine yolk sac explants. Blood 86, 156-163.
Pardanaud, L., Altmann, C., Kitos, P., Dieterlen-Lièvre, F. and Buck, C. (1987). Vasculogenesis in the early quail blastodisc as studied with a monoclonal antibody recognizing endothelial cells. Development 100, 339-349.
Pardanaud, L. and Dieterlen-Lièvre, F. (1993). Emergence of endothelial and hemopoietic cells in the avian embryo. Anat. Embryol. 187, 107-114.[Medline]
Pardanaud, L. and Dieterlen-Lièvre, F. (1999). Manipulation of the angiopoietic hemangiopoietic commitment in the avian embryo. Development 126, 617-627.[Abstract]
Pardanaud, L., Yassine, F. and Dieterlen-Lièvre, F. (1989). Relationship between vasculogenesis, angiogenesis and haemopoiesis during avian ontogeny. Development 105, 473-485.
Poole, T., Finkelstein, E. and Cox, C. (2001). The role of FGF and VEGF in angioblast induction and migration during vascular development. Dev. Dyn. 220, 1-17.[Medline]
Reagan, F. (1915). Vascularization phenomena in fragments of embryonic bodies completely isolated from yolk-sac blastoderm. Anat. Rec. 9, 329-341.
Risau, W. (1995). Differentiation of the endothelium. FASEB J. 9, 926-933[Abstract]
Risau, W. and Flamme, I. (1995). Vasculogenesis. Annu. Rev. Cell Dev. Biol. 11, 73-91.[Medline]
Roman, B. and Weinstein, B. (2000). Building the vertebrate vasculature: research is going swimmingly. BioEssays 22, 882-893.[Medline]
Sasai, Y., Lu, B., Piccolo, S. and DeRobertis, E. (1996). Endoderm induction by the organizer-secreted factors chordin and noggin in Xenopus animal caps. EMBO J. 15, 4547-4555.[Medline]
Schier, A., Neuhauss, S., Helde, K., Talbot, W. and Driever, W. (1997). The one-eyed pinhead gene functions in mesoderm and endoderm formation in zebrafish and interacts with no tail. Development 124, 327-342.[Abstract]
Shalaby, F., Rossant, J., Yamaguchi, T., Gertsenstein, M., Wu, X., Breitman, M. and Schuh, A. (1995). Failure of blood-island formation and vasculogenesis in Flk-deficient mice. Nature 376, 62-66.[Medline]
Stockard, C. (1915). The origin of blood and vascular endothelium in embryos without a circulation of the blood and in the normal embryo. Am. J. Anat. 18, 228-326.
Sugi, Y. and Markwald, R. (1996). Formation and early morphogenesis of endocardial endothelial precursor cells and the role of endoderm. Dev. Biol. 175, 66-83.[Medline]
Tatemoto, K., Hosoya, M., Habata, Y., Fujii, R., Kakegawa, T., Zou, M., Kawamata, Y. Fukusumi, S., Hinuma, S., Kitada, C., Kurokawa, T., Onda, H. and Fujino, M. (1998). Isolation and characterization of a novel endogenous peptide ligand for the human APJ receptor. Biochem. Biophys. Res. Commun. 251, 471-476.[Medline]
Vokes, S. A. and Krieg, P. A. (2002). Embryology and molecular biology of vascular system development. In Theory and Practice of Vascular Medicine (ed. P. Lanzer and E. J. Topol). Springer-Verlag, Heidelberg (in press).
von Kirschhofer, K., Grim, M., Christ, B. and Wachtler, F. (1994). Emergence of myogenic and endothelial cell lineages in avian embryos. Dev. Biol. 163, 270-278.[Medline]
Waldo, K. and Kirby, M. (1998). Development of the great arteries. In Living Morphogenesis of the Heart (ed. M. V. de la Cruz and R. Markwald), pp. 187-217. Boston: Birkhäuser.
Waltenberger, J., Claesson-Welsh, L., Siegbahn, A., Shibuya, M. and Heldin, C. (1994). Different signal transduction properties of KDR and Flt1, two receptors for vascular endothelial growth factor. J. Biol. Chem. 269, 26988-26995.
Wilms, P., Christ, B., Wilting, J. and Wachtler, F. (1991). Distribution and migration of angiogenic cells from grafted avascular intraembryonic mesoderm. J. Anat. Embryol. 183, 371-377.
Wilson, D., McNeill, J. and Hinchcliffe, J. (1989). Posterior half amputation of the chick wing bud: the response of the developing vasculature, and subsequent wound healing. J. Anat. Embryol. 180, 383-391.
Wilt, F. (1965). Erythropoiesis in the chick embryo: the role of endoderm. Science 147, 1588-1590.
Wilting, J. and Christ, B. (1996). Embryonic angiogenesis: a review. Naturwissenschaften. 83, 153-164.[Medline]
Wilting, J., Brand-Saberi, B., Huang, R., Zhi, Q., Köntges, G., Ordahl, C. and Christ, B. (1995). Angiogenic potential of the avian somite. Dev. Dyn. 202, 165-171.[Medline]
Xanthos, J., Kofron, M., Wylie, C. and Heasman, J. (2001). Maternal VegT is the initiator of a molecular network specifying endoderm in Xenopus laevis. Development 128, 167-180.[Abstract]
Yancopoulos, G., Davis, S., Gale, N., Rudge, J., Wiegand, S. and Holash, J. (2000). Vascular-specific growth factors and blood vessel formation. Nature 407, 242-248.[Medline]
Zhang, J., Houston, D., King, M., Payne, C., Wylie, C. and Heasman, J. (1998). The role of maternal VegT in establishing the primary germ layers in Xenopus embryos. Cell 94, 515-524.[Medline]
This article has been cited by other articles:
![]() |
A. Schmidt, K. Brixius, and W. Bloch Endothelial Precursor Cell Migration During Vasculogenesis Circ. Res., July 20, 2007; 101(2): 125 - 136. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-W. Jin, D. Beis, T. Mitchell, J.-N. Chen, and D. Y. R. Stainier Cellular and molecular analyses of vascular tube and lumen formation in zebrafish Development, December 1, 2005; 132(23): 5199 - 5209. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.E. Ferguson III, R. W. Kelley, and C. Patterson Mechanisms of Endothelial Differentiation in Embryonic Vasculogenesis Arterioscler Thromb Vasc Biol, November 1, 2005; 25(11): 2246 - 2254. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Small, A. S. Warkman, D.-Z. Wang, L. B. Sutherland, E. N. Olson, and P. A. Krieg Myocardin is sufficient and necessary for cardiac gene expression in Xenopus Development, March 1, 2005; 132(5): 987 - 997. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Vokes, T. A. Yatskievych, R. L. Heimark, J. McMahon, A. P. McMahon, P. B. Antin, and P. A. Krieg Hedgehog signaling is essential for endothelial tube formation during vasculogenesis Development, September 1, 2004; 131(17): 4371 - 4380. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-J. Duan, A. Nagy, and G.-H. Fong Gastrulation and Angiogenesis, Not Endothelial Specification, Is Sensitive to Partial Deficiency in Vascular Endothelial Growth Factor-A in Mice Biol Reprod, December 1, 2003; 69(6): 1852 - 1858. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||