|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||

1 Department of Biological Science and Technology, Science University of Tokyo, 2641 Yamazaki, Noda, Chiba 278-8510, Japan
2 Department of Nutrition, School of Medicine, University of Tokushima, 3-18-15 Kuramoto, Tokushima 770-8503, Japan
3 Department of Neuroanatomy, Biomedical Research Center, Osaka University Medical School, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan
4 Department of Cell Biology, MGH Cancer Center, 149-7309 Harvard Medical School, Building 149, 13th Street, Charlestown, MA 02129, USA
5 Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology corporation, 2-6-15 Shibakoen, Minato-ku, Tokyo 105-0011, Japan
6 Department of Physiology, Keio University, School of medicine, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan
* These two authors contributed equally to this work
Author for correspondence (e-mail: matsuno{at}rs.noda.sut.ac.jp)
Accepted 28 November 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Notch, Deltex, Cell-cell interaction, Wing formation, SH3-domain, RING-H2 finger, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
In Drosophila, Notch encodes a 300 kDa single-pass transmembrane receptor (Artavanis-Tsakonas et al., 1983
). The extracellular domain of Notch contains 36 epidermal growth factor (EGF)-like repeats and three Notch/Lin-12 repeats. In the intracellular domain of Notch, there are six CDC10/Ankyrin repeats and a PEST-like sequence. Delta and Serrate have been identified as transmembrane ligands for Notch (Vässin et al., 1987
; Nye and Kopan, 1995
). There is strong evidence supporting the idea that the ligand-dependent activation of Notch induces the proteolytic cleavage of Notch itself, so that the intracellular domain of Notch is released from the cell membrane and moves to the nucleus (Lecourtois and Schweisguth, 1998
; Schroeter et al., 1998
; Struhl and Adachi, 1998
). This cleavage has been shown to depend on the function of Presenilin and a
-secretase-like proteinase (De Strooper et al., 1999
; Struhl and Greenwald, 1999
; Ye et al., 1999
; Brou et al., 2000
; Mumm et al., 2000
). In the nucleus, the intracellular domain of Notch physically interacts with a transcription factor, Suppressor of Hairless [Su(H)], which functions as a suppressor of transcription when it is not complexed with the intracellular domain of Notch (Fortini and Artavanis-Tsakonas, 1994
; Honjo, 1996
; Klein et al., 2000
). The complex involving the Notch intracellular domain and Su(H) is an activator of transcription and binds to promoter elements that regulate the expression of the target genes of Notch signaling, such as Enhancer of split and vestigial (Bailey and Posakony, 1995
; Lecourtois and Schweisguth, 1995
; Kim et al., 1996
).
Although an increasing number of genes have been identified as components of the Notch pathway, the biochemical function of the deltex gene product remains elusive. Drosophila deltex encodes a cytoplasmic regulator of Notch, although its function may not be essential for signaling (Xu and Artavanis-Tsakonas, 1990
; Gorman and Girton, 1992
; Busseau et al., 1994
). The N-terminal region of Deltex physically interacts with the CDC10/Ankyrin repeats of the Notch intracellular domain (Busseau et al., 1994
; Matsuno et al., 1995
). This interaction appears to be crucial for the function of Deltex (Matsuno et al., 1995
). Two other Deltex domains, a proline-rich motif and a RING-H2 finger motif have been identified previously (Matsuno et al., 1995
). In general, proline-rich motifs are known as binding sites for various SH3-domains (Cohen et al., 1995
; Di Fiore et al., 1997
; Pawson and Scott, 1997
; Kay et al., 2000
). Indeed, it has been shown that human GRB2, a SH3-domain-containing protein, binds to the human Deltex homolog and to Drosophila Deltex (Matsuno et al., 1998
). RING-H2 finger motifs have also been shown to function in protein-protein interactions in various systems (Freemont, 1993
; Freemont, 2000
; Joazeiro and Weissman, 2000
). These three motifs in Deltex, which are all presumably involved in protein-protein interactions, are conserved among the mammalian homologs of Deltex, suggesting that they have functional importance (Pampeno and Meruelo, 1996
; Matsuno et al., 1998
; Frolova and Beebe, 2000
; Kishi et al., 2001
).
Genetic analysis in Drosophila and biochemical studies involving mammalian Deltex and tissue culture cells support the idea that Deltex is a positive regulator of Notch signaling (Xu and Artavanis-Tsakonas, 1990
; Diederich et al., 1994
; Fortini and Artavanis-Tsakonas, 1994
). It has been shown that human and mouse Deltex homologs have a similar activity to that of mammalian Notch1, suggesting mammalian Deltex regulates Notch signaling in a positive manner (Matsuno et al., 1998
; Kishi et al., 2001
). However, a study using a mammalian neural cell culture system derived from adult brain revealed that Deltex homologs could act as negative regulators of Notch signaling (Sestan et al., 1999
). Thus, it is possible that the role played by Deltex in Notch signaling could be influenced dramatically by the developmental and cellular contexts.
In the present study, we have used molecular genetic approaches to investigate the role of Deltex motifs in the regulation of Notch signaling. A dominant-negative form of Deltex was generated and used in an epistatic analysis. The results showed that the dominant-negative form of Deltex acts on Notch signaling upstream of an active form of Notch and downstream of full-length Notch. We also showed that the RING-H2 finger motif of Deltex is involved in its multimerization. Experiments involving forced dimerization using a heterologous domain have suggested that the self-association of Deltex mediated by the RING-H2 finger motif is a crucial step in Deltex-dependent signaling.
| MATERIALS AND METHODS |
|---|
|
|
|---|
NBS and Dx
PRM lack a domain for binding to Notch (amino acids 46 to 204) (Matsuno et al., 1995
NBS-
PRM construct was made by replacing the BglII fragment of Dx
PRM cDNA with that of the Dx
NBS cDNA. The Dx
NBS-mRZF construct was made by replacing the XhoI fragment of the DxmRZF cDNA with that of the Dx
NBS cDNA. The NotI-KpnI fragments from all the constructs were subcloned into a P-element transformation vector, pUAST (Brand and Perrimon, 1993The constructs producing fusion proteins of GST with various Deltex derivatives were generated as follows. A cDNA of S. japonicum glutathione-S-transferase (GST) with an extra ClaI site was generated by a PCR with two primers, 5'TGACGG-ATATGTCCCCTATACTAGG3' and 5'AATCGATTATTTTGGAGGATGGTC3', using a pGEX vector (Amersham Pharmacia Biotech) as the template. The deltex cDNA fragment was amplified using two primers, 5'TCCAGGTCGTGCCTTCTTCGC3' and 5'GGGG-ACATATCCGTCACGCCCAGG3'. The resulting two PCR fragments were used as the templates in a recombinant PCR and amplified with the following primers: 5'AATCGATTATTTTGGAGGATGGTC3' and 5'TCCAGGTCGTGCCTTCTTCGC3'. The 3'-noncoding region of deltex cDNA with an extra ClaI site was amplified using the following primers: 5'AATCGATGGATTAGTTCCCTGTCC3' and the M13 reverse primer. The junctions of the resulting constructs and point mutations were sequenced for confirmation. These deltex and GST cDNA fragments were ligated into the pUAST-Deltex constructs to replace the corresponding cDNA fragments, as described above.
Production of transgenic flies
The germline transformations and subsequent crosses were described previously (Sawamoto et al., 1994
). In all experiments, several independent lines (
10) of each construct were established and examined. All crosses of UAS lines to patched-GAL4 (ptc-GAL4) were performed at 18°C (Johnson et al., 1995
).
Western blot analysis
Transformant lines were crossed to an hs-GAL4 line (Brand and Perrimon, 1993
). The resulting third-instar larvae were collected and heat shocked at 37°C twice for 1 hour, with a 1 hour 25°C interval between heat shocks. Larvae were homogenized in phosphate-buffered saline (PBS) (130 mM NaCl, 7 mM Na2HPO4, 3 mM NaH2PO4, pH 7.0) containing 1% SDS. The samples were boiled, and the protein concentration was determined using a bovine serum albumin (BSA) protein assay kit (Pierce). Protein samples were fractionated by SDS-PAGE on 7.5% or 10% acrylamide gels, transferred to Immobilon-P membranes (Millipore), and blocked. The protein blots were probed with rat anti-Deltex antibody (C645-17A) (Busseau et al., 1994
) or rabbit anti-GST antibody (Santa Cruz biotechnology). The signal was detected using an HRP-conjugated secondary antibody (Cappel) and the ECL western blotting analysis system (Amersham Pharmacia Biotech).
Immunohistochemistry
Wing imaginal discs of the third-instar larvae were dissected in PBS and fixed in PLP (2% paraformaldehyde, 0.01 M NaIO4, 0.075 M lysine, 0.037 M sodium phosphate, pH 7.2) (Tomlinson and Ready, 1987
). Discs were washed in PBS-DT (0.3% sodium deoxycholate, 0.3% Triton X-100 in PBS) and incubated with the following primary antibodies: mouse anti-Wg (1:5) (van den Heuvel et al., 1989
); rat anti-Deltex (1:25) (Busseau et al., 1994
); mouse anti-Notch (1:5000) (Fehon et al., 1990
); mouse anti-Delta (1:500) (Fehon et al., 1990
); and rabbit anti-ß-Galactosidase (1:500) (Cappel). After several washes in PBS-DT, the discs were incubated with fluorescently labeled secondary antibodies, rhodamine-conjugated goat anti-rat (Chemicon) and goat anti-mouse (Jackson Laboratories) antibodies, and FITC-conjugated goat anti-rabbit antibodies (Invitrogen), for 1-2 hours at room temperature, followed by washing in PBS-DT. The samples were mounted in 80% glycerol/PBS containing 1% N-propyl gallate.
Cell culture and in vitro binding assay
Drosophila S2 cells were cultured and transfected as described previously (Fehon et al., 1990
; Diederich et al., 1994
). To produce Deltex derivatives or GST fusion to Deltex derivatives, UAS constructs encoding Deltex derivatives and pWA-GAL4 were co-transfected. pWA-GAL4 expressed GAL4 protein under the control of an actin gene promoter. A total of 2 µg of DNA and 8 µl of Cellfectin reagent (Invitrogen) were mixed and added to cells in serum-free SFM medium (Invitrogen) and incubated for 4 hours, followed by incubation in a serum-containing medium for another 48 hours at 25°C. The cells were harvested and lysed in 200 µl TNE buffer (10 mM Tris-HCl pH 7.8, 1% NP-40, 0.15 M NaCl, 1 mM EDTA, 1 mM PMSF). After centrifugation at 18,000 g for 10 minutes at 4°C, the supernatant was incubated at 4°C for 1 hour with Glutathione-Sepharose 4B resin (Amersham Pharmacia Biotech), which was equilibrated with binding buffer (50 mM Tris-HCl pH 7.5, 5 mM MgCl2, 100 mM NaCl, 10% glycerol, 0.5 mg/ml BSA, 5 mM ß-mercaptoethanol). The resin was washed five times in binding buffer, then incubated in elution buffer (10 mM glutathione, 50 mM Tris-HCl pH 7.5, 5 mM MgCl2, 100 mM NaCl, 10% glycerol, 5 mM ß-mercaptoethanol) at room temperature for 20 minutes. Aliquots of the total lysates and the eluants from the Glutathione-Sepharose 4B resin were fractionated by 7.5% SDS-PAGE, and Deltex derivatives and the GST-Deltex derivative fusion proteins were detected on a western blot as described above, using an anti-Deltex antibody.
Rescue of deltex mutant by overexpression of Deltex derivatives
deltex24;hs-GAL4/TM3 was crossed to either UAS-Dxfull or UAS-DxmRZF+GST. Progeny were raised at 25°C, heat shocked at 37°C for 1 hour at the early pupae stage and then cultured at 25°C.
| RESULTS |
|---|
|
|
|---|
|
|
|
NBS) or carrying two amino acid substitutions in the RING-H2 finger motif (DxmRZF) failed to induce the secondary wing margin-like structure in the adult wing, although very slight effects were still observed occasionally (Fig. 3C,I,E,K). These findings were confirmed by the observation that ectopic SOPs were not formed in the wing discs expressing these two mutant proteins (Fig. 3O,Q). By contrast, the overexpression of a mutant Deltex lacking the nine amino acids (amino acids 475-483) that encompass the proline-rich motif (Dx
PRM) resulted in wing nicking (Fig. 3D,J). We noted that this phenotype resembled those of deltex/Y and Notch/+ flies (Fig. 1).
Dominant-negative behavior of a mutant Deltex lacking the proline-rich motif
The wing-notch phenotype induced by the overexpression of Dx
PRM suggested that Dx
PRM might be a dominant-negative form of Deltex that inhibited Notch signaling during wing margin development. To test this hypothesis, we performed two different lines of experiments. First, Dx
PRM and Dxfull were overexpressed simultaneously under the control of ptc-GAL4. We expected that Dx
PRM and Dxfull would counteract each others activity, if the Dx
PRM was a dominant-negative protein. As described above, overexpression of Dxfull induced an ectopic wing margin-like structure (Fig. 3B,H), and under the same conditions, overexpression of Dx
PRM resulted in the wing nick phenotype (Fig. 3D,J). However, as expected, the co-expression of Dx
PRM and Dxfull did not have a substantial effect on the wing development, indicating these two proteins suppressed each others activities (Fig. 4A,C). This result was consistent with the observation that Dx
PRM suppressed the ectopic induction of SOPs by Dxfull (Fig. 4E).
|
PRM overexpression on endogenous Notch activity. Fig. 4G shows the expression of the Wingless (Wg) protein in the wing discs of third-instar larvae. The expression of Wg along the boundary of the dorsal and ventral compartments has been shown to depend on the activation of Notch signaling (Couso et al., 1995
PRM (red and highlighted in the upper right of the panel).
The dominant-negative activity of Dx
PRM appeared to require the Deltex domain for binding to the intracellular domain of Notch. A Deltex protein lacking two regions, the proline-rich motif and the domain binding to Notch (Dx
NBS-
PRM in Fig. 2A) did not result in the wing-notch phenotype (Fig. 4B,D,F) and failed to suppress the expression of Wg in the dorsal/ventral compartment boundary (Fig. 4I). This result suggested that the dominant-negative activity of Dx
PRM requires interaction with the intracellular domain of Notch.
Dx
PRM acts on Notch signaling upstream of an active form of Notch and downstream of full-length Notch
The results presented above are consistent with the idea that Dx
PRM is a dominant-negative form of Deltex. We performed an epistatic analysis between Dx
PRM and full-length Notch (Nfull) or an activated form of Notch (Nact) (Fig. 5A). First, Dx
PRM was co-expressed with Nact under the control of the ptc-GAL4 driver. As shown in Fig. 5B, the expression of Nact alone resulted in the formation of ectopic SOPs (Rebay et al., 1993
; Struhl et al., 1993
; Lyman and Yedvobnick, 1995
). Ectopic SOPs are indicated by an arrowhead (Fig. 5B). As shown in Fig. 5C, the co-expression of Dx
PRM did not substantially affect the ectopic SOP induction caused by the overexpression of Nact (compare with Fig. 5B). Similarly, the co-expression of Dx
PRM did not cause any marked effect on the ectopic induction of Wg that was caused by overexpressed Nact (compare Fig. 5D with 5E). Although Dxfull induced ectopic SOPs only in the ventral compartment of the wing pouch, Nact induced SOPs and Wg expression in both the dorsal and ventral compartments (Fig. 3N, Fig. 5B,D). As shown in Fig. 5F, the overexpression of Nfull resulted in the ectopic and non-cell-autonomous induction of Wg expression, which contrasted with the cell-autonomous induction of Wg by the overexpression of Nact. We found that co-expression of Dx
PRM suppressed the induction of the ectopic Wg expression that was caused by the overexpressed Nfull (compare Fig. 5F with 5G). Therefore, these results suggest that Dx
PRM acted downstream of Nfull and upstream of Nact.
|
complex, which is composed of Ste4 and Ste18 (Whiteway et al., 1995The homology between the RING-H2 finger motifs of Ste5 and Deltex raised the possibility that the Deltex RING-H2 finger motif might have a similar function to the RING-H2 finger motif in Ste5. To test this hypothesis, we first performed an in vitro binding experiment. Two chimeric forms of Deltex, a wild-type Deltex (Dxfull+GST) and a Deltex carrying mutations in the RING-H2 finger motif, DxmRZF (DxmRZF+GST), in which GST was fused to the C terminus, were made in Drosophila tissue culture cells (the S2 cell line). We co-expressed each GST fusion protein with either wild-type Deltex or DxmRZF in S2 cells. The GST fusion form of the Deltex derivatives that bound to Glutathione-Sepharose 4B resin could be recovered and detected on a western blot using an anti-Deltex antibody. If Deltex formed homo-oligomers, non-GST fusion forms of Deltex should be co-purified with the fusion proteins and detected on the same western blot. We found that Deltex (non-GST fusion) bound to Dxfull+GST and was co-purified (Fig. 6, lane 11), but DxmRZF did not bind to the corresponding fusion protein (Fig. 6, lane 12). Neither wild-type Deltex nor DxmRZF bound to DxmRZF+GST under the same conditions (Fig. 6, lanes 13,14). These results show that Deltex self-associates and that the RING-H2 finger motif is required for this oligomerization.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
A dominant-negative form of Deltex
A proline-rich motif in the middle region of Deltex has been reported previously (Busseau et al., 1994
; Matsuno et al., 1998
). This motif shows homology to a consensus amino acid sequence of a binding site for SH3-domain proteins (Cohen et al., 1995
; Di Fiore et al., 1997
; Pawson and Scott, 1997
; Kay et al., 2000
). Indeed, we have previously demonstrated that human Grb-2, an SH3-domain protein, binds to Deltex (Lowenstein et al., 1992
; Matsuno et al., 1998
). In this paper, we show that Deltex lacking the proline-rich motif (Dx
PRM) behaves as a dominant-negative form. Based on these observations, we speculate that an as-yet-unidentified SH3-domain protein interacts with the proline-rich motif of Deltex and is an integral part of Deltex activity.
Nonetheless, the mechanism of the dominant-negative action of this mutant Deltex remains to be elucidated. Because proline-rich motifs are also found in the human, chicken and mouse Deltex homologs, the underlying mechanisms of this dominant-negative behavior may be evolutionarily conserved (Pampeno and Meruelo, 1996
; Matsuno et al., 1998
; Frolova and Beebe, 2000
; Kishi et al., 2001
). Previously, we showed that the expression of Deltex domain I fragment (amino acids 1-303), which lacks approximately two-thirds of the C-terminal region of the molecule, rescued a loss-of-function deltex phenotype and did not show dominant-negative function (Matsuno et al., 1995
). Therefore, in addition to the absence of the proline-rich motif, the presence of some other part(s) of the Deltex domain II-III is required for the Dx
PRM mutant to act as a dominant-negative form of the Deltex protein (see Fig. 2A).
While Dx
PRM behaved as a dominant-negative protein during wing margin development, overexpression of Dx
PRM under the control of a heat-shock promoter during early embryogenesis did not result in a neurogenic phenotype, which is an indication that Notch signaling was not disrupted (data not shown). Therefore, the dominant-negative action of Dx
PRM may depend on the developmental context of cells, although the cellular component(s) responsible for this context-dependence remains to be identified. In this regard, it is noteworthy that none of the existing deltex alleles show the neurogenic phenotype (Xu and Artavanis-Tsakonas, 1990
).
Oligomerization mediated by the RING-H2 finger motif is required for Deltex activity
In this paper, we have shown that Deltex forms homo-oligomers, and this oligomerization is integral for Deltex function. GST-mediated dimerization substituted for the function of the Deltex RING-H2 finger motif. The activity of DxmRZF+GST did not seem to be neomorphic, because the loss-of-function deltex phenotype was rescued by the expression of DxmRZF+GST. Furthermore, we often observed the partial loss of wing veins, which resembles the phenotypes of gain-of-function Notch mutants, or is also seen under the circumstances of constitutive activation of the Notch signal (Rebay et al., 1993
; Struhl et al., 1993
). However, the fusion of wild-type Deltex to GST (Dxfull+GST) did not show substantial activity in our system. Therefore, the GST-mediated dimerization may abolish the activity of wild-type Deltex; it is also possible that Dxfull+GST is not functional because the fusion to GST leads to some nonspecific disruption of the protein structure. However, it has been reported that the Ste5 oligomerization mediated by its RING-H2 finger motif serves as both a positive and negative regulatory step (Inouye et al., 1997
). An oligomerization of Ste5 that regulates it negatively is relieved by the Ste5-Ste4 interaction, and this interaction then permits Ste5 to form an oligomer mediated by its RING-H2 finger motif, in that order. Therefore, sequential oligomerization taking place in the proper order may be also important for Deltex function. However, in the case of Deltex, the factor that might relieve it from its inhibitory oligomeric state remains to be identified. It is not likely that Notch functions as such a relieving factor, because a GST-fusion with a double mutant Deltex, Dx
NBS-mRZF +GST, lost the activity of DxmRZF +GST (Fig. 7D,J,P,E,K,Q), suggesting that the binding of Deltex to the Notch CDC10/Ankyrin repeats was apparently still required in DxmRZF +GST, despite the fact that this protein presumably bypassed the inhibitory oligomerization state and was competent to signal. This also suggests that the binding of Deltex to Notch is not a prerequisite for the self-association of Deltex, as the Notch-binding domain of Deltex is still indispensable for the activity of the artificially dimerized Deltex GST (Fig. 7D,J,P,E,K,Q).
Implications from the dominant-negative form of Deltex
Previously, we have shown that the loss-of-function deltex phenotype could be rescued by the expression of an activated form of Notch (Matsuno et al., 1995
). This observation suggested that Deltex might act upstream of the activated form of Notch, although the nature of the deltex alleles used in that study had not been characterized very well. The present study shows that the dominant-negative form of Deltex acts upstream of an activated form of Notch and downstream of wild-type Notch. Although we need to be cautious in using a dominant-negative form of a protein to speculate about an epistatic relationship, the above two results are consistent. Therefore, we speculate that this dominant-negative form of Deltex may inhibit the activation or maturation of the Notch receptor. For example, possible target steps include the ligand-dependent cleavage of Notch, the processing of Notch to its mature form or the ligand susceptibility of Notch. Alternatively, it is possible that the dominant-negative Deltex specifically decreases the stability of full-length Notch.
Differences in the inductive properties of Dxfull and Nact
We have shown that overexpression of Dxfull induces an ectopic wing margin-like structure, which is similar to the consequence of the ectopic expression of Nact (Dias-Benjumea and Cohen, 1995
; de Celis and Bray, 1997
). However, these two proteins appear to have distinct inductive properties in the wing pouch. As shown in Fig. 3N, Dxfull induces SOPs only in the ventral compartment of the wing pouch, while Nact induces SOPs in both the dorsal and ventral compartments (Fig. 5B). Furthermore, Dxfull induces SOPs in cells other than and distant from those expressing Dxfull. From these results, we speculate that induction of Serrate may be a part of these events. Nact has been shown to induce Serrate within the wing pouch, and Serrate effectively activates Notch only in the ventral compartments (Panin et al., 1997
). The activation of Notch results in the Wg induction that in turn induces SOPs in the neighboring cells (Rulifson and Blair, 1995
). Furthermore, high-level expression of Serrate autonomously inhibits the induction of the genes within the wing pouch that are dependent upon Notch signaling (Jonsson and Knust, 1996
; Klein et al., 1997
; Micchelli et al., 1997
). Thus, the induction of Serrate would explain, at least in part, the result that Dxfull induced SOPs only in the ventral compartment, and ectopic SOPs were formed slightly remove from the cells expressing Dxfull.
Putative factor(s) binding to the proline-rich motif of Deltex
The dominant-negative behavior of Dx
PRM suggests that putative factor(s) that interact with the proline-rich motif might be essential for Deltex function. Suppressor of deltex [Su(dx)] is a good candidate. Su(dx) genetically suppresses deltex and Notch mutant phenotypes and encodes an E3-ubiquitin ligase (Fostier et al., 1998
; Cornell et al., 1999
). Su(dx) has WW domains that bind to proline-rich motifs in general (Cornell et al., 1999
). In a mammalian system, a mammalian homolog of Su(dx), Itch, binds to the intracellular domain of Notch and ubiquitinates it (Qiu et al., 2000
). Therefore, Deltex may function to suppress Su(dx), a negative regulator of Notch signaling, through an interaction that may be mediated by the proline-rich motif of Deltex and the WW domain of Su(dx).
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Artavanis-Tsakonas, S., Muskavitch, M. A. and Yedvobnick, B. (1983). Molecular cloning of Notch, a locus affecting neurogenesis in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 80, 1977-1981
Artavanis-Tsakonas, S., Matsuno, K. and Fortini, M. E. (1995). Notch signaling. Science 268, 225-232.
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J. (1999). Notch signaling: cell fate control and signal integration in development. Science 284, 770-776.
Axelrod, J. D., Matsuno, K., Artavanis-Tsakonas, S. and Perrimon, N. (1996). Interaction between Wingless and Notch signaling pathways mediated by dishevelled. Science 271, 1826-1832.[Abstract]
Bailey, A. M. and Posakony, J. W. (1995). Suppressor of hairless directly activates transcription of enhancer of split complex genes in response to Notch receptor activity. Genes Dev. 9, 2609-2622.
Blaumueller, C. M. and Artavanis-Tsakonas, S. (1997). Comparative aspects of Notch signaling in lower and higher eukaryotes. Perspect. Dev. Neurobiol. 4, 325-343.[Medline]
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401-415.[Abstract]
Brook, W. J., Diaz-Benjumea, F. J. and Cohen, S. M. (1996). Organizing spatial pattern in limb development. Annu. Rev. Cell Dev. Biol. 12, 161-180.[Medline]
Brou, C., Logeat, F., Gupta, N., Bessia, C., LeBail, O., Doedens, J. R., Cumano, A., Roux, P., Black, R. A. and Israel, A. (2000). A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Mol. Cell 5, 207-216.[Medline]
Busseau, I., Diederich, R. J., Xu, T. and Artavanis-Tsakonas, S. (1994). A member of the Notch group of interacting loci, deltex encodes acytoplasmic basic protein. Genetics 136, 585-596.[Abstract]
Cohen, G. B., Ren, R. and Baltimore, D. (1995). Modular binding domains in signal transduction proteins. Cell 80, 237-248.[Medline]
Cohen, S. M. (1996). Controlling growth of the wing: vestigial integrates signals from the compartment boundaries. BioEssays 18, 855-858.[Medline]
Cornell, M., Evans, D. A., Mann, R., Fostier, M., Flasza, M., Monthatong, M., Artavanis-Tsakonas, S. and Baron, M. (1999). The Drosophila melanogaster Suppressor of deltex gene, a regulator of the Notch receptor signaling pathway, is an E3 class ubiquitin ligase. Genetics 152, 567-576.
Couso, J. P., Bishop, S. A. and Martinez Arias, A. (1994). The wingless signalling pathway and the patterning of the wing margin in Drosophila. Development 120, 621-636.[Abstract]
Couso, J. P., Knust, E. and Martinez Arias, A. (1995). Serrate and wingless cooperate to induce vestigial gene expression and wing formation in Drosophila. Curr. Biol. 5, 1437-1448.[Medline]
de Celis, J. F. and Bray, S. (1997). Feed-back mechanisms affecting Notch activation at the dorsoventral boundary in the Drosophila wing. Development 124, 3241-3251.[Abstract]
De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J. S., Schroeter, E. H., Schrijvers, V., Wolfe, M. S., Ray, W. J. et al. (1999). A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain. Nature 398, 518-522.[Medline]
Di Fiore, P. P., Pelicci, P. G. and Sorkin, A. (1997). EH: a novel protein-protein interaction domain potentially involved in intracellular sorting. Trends Biochem. Sci. 22, 411-413.[Medline]
Diaz-Benjumea, F. J. and Cohen, S. M. (1995). Serrate signals through Notch to establish a Wingless-dependent organizer at the dorsal/ventral compartment boundary of the Drosophila wing. Development 121, 4215-4225.[Abstract]
Diederich, R. J., Matsuno, K., Hing, H. and Artavanis-Tsakonas, S. (1994). Cytosolic interaction between deltex and Notch ankyrin repeats implicates deltex in the Notch signaling pathway. Development 120, 473-481.[Abstract]
Doherty, D., Feger, G., Younger-Shepherd, S., Jan, L. Y. and Jan, Y. N. (1996). Delta is a ventral to dorsal signal complementary to Serrate,another Notch ligand,in Drosophila wing formation. Genes Dev. 10, 421-434.
Fehon, R. G., Kooh, P. J., Rebay, I., Regan, C. L., Xu, T., Muskavitch, M. A. and Artavanis-Tsakonas, S. (1990). Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF-homologous genes in Drosophila. Cell 61, 523-534.[Medline]
Feng, Y., Song, L. Y., Kincaid, E., Mahanty, S. K. and Elion, E. A. (1998). Functional binding between Gbeta and the LIM domain of Ste5 is required to activate the MEKK Ste11. Curr. Biol. 8, 267-278.[Medline]
Fortini, M. E. and Artavanis-Tsakonas, S. (1994). The suppressor of hairless protein participates in notch receptor signaling. Cell 79, 273-282.[Medline]
Fostier, M., Evans, D. A., Artavanis-Tsakonas, S. and Baron, M. (1998). Genetic characterization of the Drosophila melanogaster Suppressor of deltex gene: A regulator of notch signaling. Genetics 150, 1477-1485.
Freemont, P. S. (1993). The RING finger. A novel protein sequence motif related to the zinc finger. Ann. New York Acad. Sci. 684, 174-192.[Medline]
Freemont, P. S. (2000). RING for destruction? Curr. Biol. 10, R84-87.[Medline]
Frolova, E. and Beebe, D. (2000). The expression pattern of a novel Deltex homologue during chicken embryogenesis. Mech. Dev. 92, 285-289.[Medline]
Gorman, M. J. and Girton, J. R. (1992). A genetic analysis of deltex and its interaction with the Notch locus in Drosophila melanogaster. Genetics 131, 99-112.[Abstract]
Greenwald, I. (1998). LIN-12/Notch signaling: lessons from worms and flies. Genes Dev. 12, 1751-1762.
Gridley, T. (1997). Notch signaling in vertebrate development and disease. Mol. Cell. Neurosci. 9, 103-108.
Honjo, T. (1996). The shortest path from the surface to the nucleus: RBP-J kappa/Su(H) transcription factor. Genes Cells 1, 1-9.[Abstract]
Inouye, C., Dhillon, N. and Thorner, J. (1997). Ste5 RING-H2 domain: role in Ste4-promoted oligomerization for yeast pheromone signaling. Science 278, 103-106.
Irvine, K. D. and Vogt, T. F. (1997). Dorsal-ventral signaling in limb development. Curr Opin. Cell Biol. 9, 867-876.[Medline]
Joazeiro, C. A. and Weissman, A. M. (2000). RING finger proteins: mediators of ubiquitin ligase activity. Cell 102, 549-552.[Medline]
Johnson, R. L., Grenier, J. K. and Scott, M. P. (1995). patched overexpression alters wing disc size and pattern: transcriptional and post-transcriptional effects on hedgehog targets. Development 121, 4161-4170.[Abstract]
Jonsson, F. and Knust, E. (1996). Distinct functions of the Drosophila genes Serrate and Delta revealed by ectopic expression during wing development. Dev. Genes Evol. 206, 91-101.
Kadesch, T. (2000). Notch signaling: A dance of proteins changing partners. Exp. Cell Res. 260, 1-8.[Medline]
Kay, B. K., Williamson, M. P. and Sudol, M. (2000). The importance of being proline: the interaction of proline-rich motifs in signaling proteins with their cognate domains. FASEB J. 14, 231-241.
Kim, J., Irvine, K. D. and Carroll, S. B. (1995). Cell recognition, signal induction, and symmetrical gene activation at the dorsal-ventral boundary of the developing Drosophila wing. Cell 82, 795-802.[Medline]
Kim, J., Sebring, A., Esch, J. J., Kraus, M. E., Vorwerk, K., Magee, J. and Carroll, S. B. (1996). Integration of positional signals and regulation of wing formation and identity by Drosophila vestigial gene. Nature 382, 133-138.[Medline]
Kimble, J. and Simpson, P. (1997). The LIN-12/Notch signaling pathway and its regulation. Annu. Rev. Cell. Dev. Biol. 13, 333-361.[Medline]
Kishi, N., Tang, Z., Maeda, Y., Hirai, A., Mo, R., Ito, M., Suzuki, S., Nakao, K., Kinoshita, T., Kadesch, T. et al. (2001). Murine homologs of deltex define a novel gene family involved in vertebrate Notch signaling and neurogenesis. Int. J. Dev. Neurosci. 19, 21-35.[Medline]
Klein, T., Brennan, K. and Arias, A. M. (1997). An intrinsic dominant negative activity of serrate that is modulated during wing development in Drosophila. Dev. Biol. 189, 123-134.[Medline]
Klein, T., Seugnet, L., Haenlin, M. and Martinez Arias, A. (2000). Two different activities of Suppressor of Hairless during wing development in Drosophila. Development 127, 3553-3566.[Abstract]
Lecourtois, M. and Schweisguth, F. (1995). The neurogenic suppressor of hairless DNA-binding protein mediates the transcriptional activation of the enhancer of split complex genes triggered by Notch signaling. Genes Dev. 9, 2598-2608.
Lecourtois, M. and Schweisguth, F. (1998). Indirect evidence for Delta-dependent intracellular processing of notch in Drosophila embryos. Curr. Biol. 8, 771-774.[Medline]
Lim, K., Ho, J. X., Keeling, K., Gilliland, G. L., Ji, X., Ruker, F. and Carter, D. C. (1994). Three-dimensional structure of Schistosoma japonicum glutathione S-transferase fused with a six-amino acid conserved neutralizing epitope of gp41 from HIV. Protein Sci. 3, 2233-2244.[Abstract]
Lowenstein, E. J., Daly, R. J., Batzer, A. G., Li, W., Margolis, B., Lammers, R., Ullrich, A., Skolnik, E. Y., Bar-Sagi, D. and Schlessinger, J. (1992). The SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signaling. Cell 70, 431-442.[Medline]
Lyman, D. F. and Yedvobnick, B. (1995). Drosophila Notch receptor activity suppresses Hairless function during adult external sensory organ development. Genetics 141, 1491-1505.[Abstract]
Madhani, H. D. and Fink, G. R. (1998). The riddle of MAP kinase signaling specificity. Trends Genet. 14, 151-155.[Medline]
Maru, Y., Afar, D. E., Witte, O. N. and Shibuya, M. (1996). The dimerization property of glutathione S-transferase partially reactivates Bcr-Abl lacking the oligomerization domain. J. Biol. Chem. 271, 15353-15357.
Matsuno, K., Diederich, R. J., Go, M. J., Blaumueller, C. M. and Artavanis-Tsakonas, S. (1995). Deltex acts as a positive regulator of Notch signaling through interactions with the Notch ankyrin repeats. Development 121, 2633-2644.[Abstract]
Matsuno, K., Eastman, D., Mitsiades, T., Quinn, A. M., Carcanciu, M. L., Ordentlich, P., Kadesch, T.