spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuno, K.
Right arrow Articles by Okano, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuno, K.
Right arrow Articles by Okano, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 129, 1049-1059 (2002)
© 2002 The Company of Biologists Limited

Involvement of a proline-rich motif and RING-H2 finger of Deltex in the regulation of Notch signaling

Kenji Matsuno1,*,{dagger}, Mikiko Ito2,*, Kazuya Hori1, Fumiyasu Miyashita1, Satoshi Suzuki3, Noriyuki Kishi3, Spyros Artavanis-Tsakonas4 and Hideyuki Okano3,5,6

1 Department of Biological Science and Technology, Science University of Tokyo, 2641 Yamazaki, Noda, Chiba 278-8510, Japan
2 Department of Nutrition, School of Medicine, University of Tokushima, 3-18-15 Kuramoto, Tokushima 770-8503, Japan
3 Department of Neuroanatomy, Biomedical Research Center, Osaka University Medical School, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan
4 Department of Cell Biology, MGH Cancer Center, 149-7309 Harvard Medical School, Building 149, 13th Street, Charlestown, MA 02129, USA
5 Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology corporation, 2-6-15 Shibakoen, Minato-ku, Tokyo 105-0011, Japan
6 Department of Physiology, Keio University, School of medicine, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan
* These two authors contributed equally to this work

{dagger}Author for correspondence (e-mail: matsuno{at}rs.noda.sut.ac.jp)

Accepted 28 November 2001


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Notch pathway is an evolutionarily conserved signaling mechanism that is essential for cell-cell interactions. The Drosophila deltex gene regulates Notch signaling in a positive manner, and its gene product physically interacts with the intracellular domain of Notch through its N-terminal domain. Deltex has two other domains that are presumably involved in protein-protein interactions: a proline-rich motif that binds to SH3-domains, and a RING-H2 finger motif. Using an overexpression assay, we have analyzed the functional involvement of these Deltex domains in Notch signaling. The N-terminal domain of Deltex that binds to the CDC10/Ankyrin repeats of the Notch intracellular domain was indispensable for the function of Deltex. A mutant form of Deltex that lacked the proline-rich motif behaved as a dominant-negative form. This dominant-negative Deltex inhibited Notch signaling upstream of an activated, nuclear form of Notch and downstream of full-length Notch, suggesting the dominant-negative Deltex might prevent the activation of the Notch receptor. We found that Deltex formed a homo-multimer, and mutations in the RING-H2 finger domain abolished this oligomerization. The same mutations in the RING-H2 finger motif of Deltex disrupted the function of Deltex in vivo. However, when the same mutant was fused to a heterologous dimerization domain (Glutathione-S-Transferase), the chimeric protein had normal Deltex activity. Therefore, oligomerization mediated by the RING-H2 finger motif is an integral step in the signaling function of Deltex.

Key words: Notch, Deltex, Cell-cell interaction, Wing formation, SH3-domain, RING-H2 finger, Drosophila


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Local cell-cell interactions are essential for the development of multicellular organisms. Notch signaling is involved in cell-cell communications that regulate a broad spectrum of cell-fate determinations in organisms ranging from the fly to mammals (reviewed by Artavanis-Tsakonas et al., 1995Go; Blaumueller and Artavanis-Tsakonas, 1997Go; Gridley, 1997Go; Kimble and Simpson, 1997Go; Weinmaster, 1998Go; Greenwald, 1998Go; Artavanis-Tsakonas et al., 1999Go; Kadesch, 2000Go).

In Drosophila, Notch encodes a 300 kDa single-pass transmembrane receptor (Artavanis-Tsakonas et al., 1983Go). The extracellular domain of Notch contains 36 epidermal growth factor (EGF)-like repeats and three Notch/Lin-12 repeats. In the intracellular domain of Notch, there are six CDC10/Ankyrin repeats and a PEST-like sequence. Delta and Serrate have been identified as transmembrane ligands for Notch (Vässin et al., 1987Go; Nye and Kopan, 1995Go). There is strong evidence supporting the idea that the ligand-dependent activation of Notch induces the proteolytic cleavage of Notch itself, so that the intracellular domain of Notch is released from the cell membrane and moves to the nucleus (Lecourtois and Schweisguth, 1998Go; Schroeter et al., 1998Go; Struhl and Adachi, 1998Go). This cleavage has been shown to depend on the function of Presenilin and a {gamma}-secretase-like proteinase (De Strooper et al., 1999Go; Struhl and Greenwald, 1999Go; Ye et al., 1999Go; Brou et al., 2000Go; Mumm et al., 2000Go). In the nucleus, the intracellular domain of Notch physically interacts with a transcription factor, Suppressor of Hairless [Su(H)], which functions as a suppressor of transcription when it is not complexed with the intracellular domain of Notch (Fortini and Artavanis-Tsakonas, 1994Go; Honjo, 1996Go; Klein et al., 2000Go). The complex involving the Notch intracellular domain and Su(H) is an activator of transcription and binds to promoter elements that regulate the expression of the target genes of Notch signaling, such as Enhancer of split and vestigial (Bailey and Posakony, 1995Go; Lecourtois and Schweisguth, 1995Go; Kim et al., 1996Go).

Although an increasing number of genes have been identified as components of the Notch pathway, the biochemical function of the deltex gene product remains elusive. Drosophila deltex encodes a cytoplasmic regulator of Notch, although its function may not be essential for signaling (Xu and Artavanis-Tsakonas, 1990Go; Gorman and Girton, 1992Go; Busseau et al., 1994Go). The N-terminal region of Deltex physically interacts with the CDC10/Ankyrin repeats of the Notch intracellular domain (Busseau et al., 1994Go; Matsuno et al., 1995Go). This interaction appears to be crucial for the function of Deltex (Matsuno et al., 1995Go). Two other Deltex domains, a proline-rich motif and a RING-H2 finger motif have been identified previously (Matsuno et al., 1995Go). In general, proline-rich motifs are known as binding sites for various SH3-domains (Cohen et al., 1995Go; Di Fiore et al., 1997Go; Pawson and Scott, 1997Go; Kay et al., 2000Go). Indeed, it has been shown that human GRB2, a SH3-domain-containing protein, binds to the human Deltex homolog and to Drosophila Deltex (Matsuno et al., 1998Go). RING-H2 finger motifs have also been shown to function in protein-protein interactions in various systems (Freemont, 1993Go; Freemont, 2000Go; Joazeiro and Weissman, 2000Go). These three motifs in Deltex, which are all presumably involved in protein-protein interactions, are conserved among the mammalian homologs of Deltex, suggesting that they have functional importance (Pampeno and Meruelo, 1996Go; Matsuno et al., 1998Go; Frolova and Beebe, 2000Go; Kishi et al., 2001Go).

Genetic analysis in Drosophila and biochemical studies involving mammalian Deltex and tissue culture cells support the idea that Deltex is a positive regulator of Notch signaling (Xu and Artavanis-Tsakonas, 1990Go; Diederich et al., 1994Go; Fortini and Artavanis-Tsakonas, 1994Go). It has been shown that human and mouse Deltex homologs have a similar activity to that of mammalian Notch1, suggesting mammalian Deltex regulates Notch signaling in a positive manner (Matsuno et al., 1998Go; Kishi et al., 2001Go). However, a study using a mammalian neural cell culture system derived from adult brain revealed that Deltex homologs could act as negative regulators of Notch signaling (Sestan et al., 1999Go). Thus, it is possible that the role played by Deltex in Notch signaling could be influenced dramatically by the developmental and cellular contexts.

In the present study, we have used molecular genetic approaches to investigate the role of Deltex motifs in the regulation of Notch signaling. A dominant-negative form of Deltex was generated and used in an epistatic analysis. The results showed that the dominant-negative form of Deltex acts on Notch signaling upstream of an active form of Notch and downstream of full-length Notch. We also showed that the RING-H2 finger motif of Deltex is involved in its multimerization. Experiments involving forced dimerization using a heterologous domain have suggested that the self-association of Deltex mediated by the RING-H2 finger motif is a crucial step in Deltex-dependent signaling.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Creation of Deltex and Deltex mutant constructs
The amino acids of Deltex were numbered according to Busseau et al. (Busseau et al., 1994Go). A Chameleon double-stranded site-directed mutagenesis kit (Stratagene) was used to create the deletion and point mutation constructs of deltex. Dx{Delta}NBS and Dx{Delta}PRM lack a domain for binding to Notch (amino acids 46 to 204) (Matsuno et al., 1995Go) and the proline-rich motif (amino acids 475 to 483), respectively. DxmRZF has mutations in which two histidine residues (amino acids 570 and 573) have been replaced by alanine residues. The cDNA encoding DxmRZF was generated using the primer 5'CTGAGTCGCTGCCAGGCTCTCATGGCTTTGCAGTGCCTCAAT3'. All junctions and point mutations were confirmed by sequencing. The Dx{Delta}NBS-{Delta}PRM construct was made by replacing the BglII fragment of Dx{Delta}PRM cDNA with that of the Dx{Delta}NBS cDNA. The Dx{Delta}NBS-mRZF construct was made by replacing the XhoI fragment of the DxmRZF cDNA with that of the Dx{Delta}NBS cDNA. The NotI-KpnI fragments from all the constructs were subcloned into a P-element transformation vector, pUAST (Brand and Perrimon, 1993Go).

The constructs producing fusion proteins of GST with various Deltex derivatives were generated as follows. A cDNA of S. japonicum glutathione-S-transferase (GST) with an extra ClaI site was generated by a PCR with two primers, 5'TGACGG-ATATGTCCCCTATACTAGG3' and 5'AATCGATTATTTTGGAGGATGGTC3', using a pGEX vector (Amersham Pharmacia Biotech) as the template. The deltex cDNA fragment was amplified using two primers, 5'TCCAGGTCGTGCCTTCTTCGC3' and 5'GGGG-ACATATCCGTCACGCCCAGG3'. The resulting two PCR fragments were used as the templates in a recombinant PCR and amplified with the following primers: 5'AATCGATTATTTTGGAGGATGGTC3' and 5'TCCAGGTCGTGCCTTCTTCGC3'. The 3'-noncoding region of deltex cDNA with an extra ClaI site was amplified using the following primers: 5'AATCGATGGATTAGTTCCCTGTCC3' and the M13 reverse primer. The junctions of the resulting constructs and point mutations were sequenced for confirmation. These deltex and GST cDNA fragments were ligated into the pUAST-Deltex constructs to replace the corresponding cDNA fragments, as described above.

Production of transgenic flies
The germline transformations and subsequent crosses were described previously (Sawamoto et al., 1994Go). In all experiments, several independent lines (~10) of each construct were established and examined. All crosses of UAS lines to patched-GAL4 (ptc-GAL4) were performed at 18°C (Johnson et al., 1995Go).

Western blot analysis
Transformant lines were crossed to an hs-GAL4 line (Brand and Perrimon, 1993Go). The resulting third-instar larvae were collected and heat shocked at 37°C twice for 1 hour, with a 1 hour 25°C interval between heat shocks. Larvae were homogenized in phosphate-buffered saline (PBS) (130 mM NaCl, 7 mM Na2HPO4, 3 mM NaH2PO4, pH 7.0) containing 1% SDS. The samples were boiled, and the protein concentration was determined using a bovine serum albumin (BSA) protein assay kit (Pierce). Protein samples were fractionated by SDS-PAGE on 7.5% or 10% acrylamide gels, transferred to Immobilon-P membranes (Millipore), and blocked. The protein blots were probed with rat anti-Deltex antibody (C645-17A) (Busseau et al., 1994Go) or rabbit anti-GST antibody (Santa Cruz biotechnology). The signal was detected using an HRP-conjugated secondary antibody (Cappel) and the ECL western blotting analysis system (Amersham Pharmacia Biotech).

Immunohistochemistry
Wing imaginal discs of the third-instar larvae were dissected in PBS and fixed in PLP (2% paraformaldehyde, 0.01 M NaIO4, 0.075 M lysine, 0.037 M sodium phosphate, pH 7.2) (Tomlinson and Ready, 1987Go). Discs were washed in PBS-DT (0.3% sodium deoxycholate, 0.3% Triton X-100 in PBS) and incubated with the following primary antibodies: mouse anti-Wg (1:5) (van den Heuvel et al., 1989Go); rat anti-Deltex (1:25) (Busseau et al., 1994Go); mouse anti-Notch (1:5000) (Fehon et al., 1990Go); mouse anti-Delta (1:500) (Fehon et al., 1990Go); and rabbit anti-ß-Galactosidase (1:500) (Cappel). After several washes in PBS-DT, the discs were incubated with fluorescently labeled secondary antibodies, rhodamine-conjugated goat anti-rat (Chemicon) and goat anti-mouse (Jackson Laboratories) antibodies, and FITC-conjugated goat anti-rabbit antibodies (Invitrogen), for 1-2 hours at room temperature, followed by washing in PBS-DT. The samples were mounted in 80% glycerol/PBS containing 1% N-propyl gallate.

Cell culture and in vitro binding assay
Drosophila S2 cells were cultured and transfected as described previously (Fehon et al., 1990Go; Diederich et al., 1994Go). To produce Deltex derivatives or GST fusion to Deltex derivatives, UAS constructs encoding Deltex derivatives and pWA-GAL4 were co-transfected. pWA-GAL4 expressed GAL4 protein under the control of an actin gene promoter. A total of 2 µg of DNA and 8 µl of Cellfectin reagent (Invitrogen) were mixed and added to cells in serum-free SFM medium (Invitrogen) and incubated for 4 hours, followed by incubation in a serum-containing medium for another 48 hours at 25°C. The cells were harvested and lysed in 200 µl TNE buffer (10 mM Tris-HCl pH 7.8, 1% NP-40, 0.15 M NaCl, 1 mM EDTA, 1 mM PMSF). After centrifugation at 18,000 g for 10 minutes at 4°C, the supernatant was incubated at 4°C for 1 hour with Glutathione-Sepharose 4B resin (Amersham Pharmacia Biotech), which was equilibrated with binding buffer (50 mM Tris-HCl pH 7.5, 5 mM MgCl2, 100 mM NaCl, 10% glycerol, 0.5 mg/ml BSA, 5 mM ß-mercaptoethanol). The resin was washed five times in binding buffer, then incubated in elution buffer (10 mM glutathione, 50 mM Tris-HCl pH 7.5, 5 mM MgCl2, 100 mM NaCl, 10% glycerol, 5 mM ß-mercaptoethanol) at room temperature for 20 minutes. Aliquots of the total lysates and the eluants from the Glutathione-Sepharose 4B resin were fractionated by 7.5% SDS-PAGE, and Deltex derivatives and the GST-Deltex derivative fusion proteins were detected on a western blot as described above, using an anti-Deltex antibody.

Rescue of deltex mutant by overexpression of Deltex derivatives
deltex24;hs-GAL4/TM3 was crossed to either UAS-Dxfull or UAS-DxmRZF+GST. Progeny were raised at 25°C, heat shocked at 37°C for 1 hour at the early pupae stage and then cultured at 25°C.


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Notch signaling is required for the proper formation of the wing margin in Drosophila (for reviews, see Brook et al., 1996Go; Cohen, 1996Go; Irvine and Vogt, 1997Go). For example, partial loss of Notch activity results in the wing nicking phenotype for which Notch was named (Fig. 1C). Most deltex mutant alleles also yield a recessive wing-notch phenotype similar to that of Notch mutants, indicating the involvement of deltex function in wing margin development (Fig. 1B). Our previous study showed that the ectopic expression of Deltex results in the activation of Notch signaling (Matsuno et al., 1995Go). Because ectopic activation of Notch signaling in the wing pouch of the third-instar larval wing disc induces an ectopic wing margin-like structure that includes ectopic wing outgrowth and bristle formation (Diaz-Benjumea and Cohen, 1995Go; de Celis and Bray, 1997Go), we examined whether the overexpression of Deltex might induce a similar ectopic wing margin structure (Matsuno et al., 1995Go). Using the UAS/GAL4 system, we overexpressed the full-length Deltex protein under the control of patched-GAL4 (ptc-GAL4) (Fig. 1D) (Brand and Perrimon, 1993Go; Johnson et al., 1995Go). As shown in Fig. 1D, in the wing discs of third-instar larvae from the ptc-GAL4 line, the region expressing the GAL4 protein was located between two proveins (arrowheads in Fig. 1D), which corresponded to the longitudinal veins III and IV in the adult wing (arrowheads in Fig. 1A).



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 1. deltex and Notch are required for the normal development of the wing margin. (A) Wild-type adult wing. The wing veins III and IV are indicated by arrowheads (see D). (B) deltex/Y wing. (C) Notch54l9/+ wing. (D) Protein expression from a UAS responder line under the control of the ptc-GAL4 driver. UAS-GFP was crossed to ptc-GAL4, and wing discs of the third-instar larvae were stained with mouse anti-Delta antibody. GFP and Delta are shown in green and red, respectively. Presumptive cells of wing veins III and IV expressing Delta are indicated by arrowheads.

 
As a result of full-length Deltex (Dxfull) overexpression, an ectopic secondary wing margin-like structure was induced along the region expressing Deltex (see Fig. 3H). This secondary wing margin-like structure included ectopic outgrowth and ectopic bristle formation (see Fig. 3B,H). Taking advantage of this Deltex activity, we decided to analyze the function of three conserved motifs found in Deltex: (1) a domain that binds to the CDC10/Ankyrin repeats of the Notch intracellular domain, (2) a proline-rich motif, and (3) a RING-H2 finger motif (Fig. 2A). Constructs to produce mutant Deltex proteins were generated and introduced into flies by P-element-mediated transformation (Brand and Perrimon, 1993Go). The Deltex mutant proteins used in this study are shown schematically in Fig. 2A. The production of each Deltex derivative in vivo was confirmed by western blotting using an anti-Deltex antibody, and the molecular weights of these proteins were as expected (Fig. 2C). Judged by the relative intensity of the bands, similar amounts of each protein were produced (Fig. 2C).



View larger version (75K):
[in this window]
[in a new window]
 
Fig. 3. Effects of overexpression of Deltex derivatives under the control of the ptc-GAL4 driver. Transgenic flies carrying the various UAS constructs expressing the Deltex derivatives were crossed to ptc-GAL4 or ptc-GAL4/CyO; A101/TM6B. (A-L) Adult wings and high magnifications of regions of wings. (M-R) The SOP cells in the third-instar wing discs are shown in green, and the Deltex derivatives are shown in red. An enhancer trap line, A101, was used to visualize the SOP cells. (A,G,M) Wild-type wing and disc. (B,H,N) Overexpression of Dxfull. Note a secondary wing margin-like structure (black arrowheads) and ectopic SOPs (white arrowhead). (C,I,O) Overexpression of Dx{Delta}NBS. Occasionally, a missing crossvein (white arrow) and a few extra bristles (white arrowhead) are observed. (D,J,P) Overexpression of Dx{Delta}PRM. Note the wing-notch phenotype. (E,K,Q) Overexpression of DxmRZF. (F,L,R) Overexpression of Dx{Delta}NBS-mRZF.

 


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 2. Wild-type and mutant Deltex proteins used in this study. The Deltex protein is arbitrarily divided into three regions (domains I, II and III), based on the position of two OPA repeats, which separate the regions. The region binding to the Notch CDC10/Ankyrin repeats (blue box), a proline-rich motif that is a putative SH3-binding site (red box) and a RING-H2 finger motif (green box) are shown. The full-length Deltex protein consists of 737 amino acids (Busseau et al., 1994Go). All the cDNAs encoding the Deltex derivatives shown were inserted into the pUAST vector, and transgenic flies carrying these constructs were generated. (A) Deltex derivatives are shown schematically. Dx{Delta}NBS lacks the domain capable of mediating Notch and Deltex interactions (amino acids 46-204). Dx{Delta}PRM lacks the proline-rich motif (amino acids 475-483). DxmRZF has point mutations in the RING-H2 finger motif: two histidine residues (amino acids 570 and 573) are replaced by alanine residues. Dx{Delta}NBS-{Delta}PRM lacks both the binding sites for Notch and the proline-rich motif. Dx{Delta}NBS-mRZF is a double mutation that lacks the binding site for Notch and has point mutations in the RING-H2 finger motif. Amino acid numbers are according to Busseau et al. (Busseau et al., 1994Go). (B) The Deltex derivatives listed in A were also made as fusion proteins with GST (yellow box), and are shown schematically. GST is wild-type GST used as a control. (C,D) Western blot analysis of the Deltex mutant derivatives shown in A,B. Flies carrying UAS constructs capable of expressing the Deltex derivatives (A,B) were crossed to the hs-GAL4 line. Samples isolated before (shown by –) and after (shown by +) heat shock. (C) Lanes 1 and 2, Canton-S; lanes 3 and 4, Dxfull; lanes 5 and 6, Dx{Delta}NBS; lanes 7 and 8, Dx{Delta}PRM; lanes 9 and 10, DxmRZF; lanes 11 and 12, Dx{Delta}NBS-{Delta}PRM; lanes 13 and 14, Dx{Delta}NBS-mRZF. The protein blot was probed with the anti-Deltex antibody. Molecular weight markers are shown in kDa. (D) Lanes1 and 2, Dxfull+GST; lanes 3 and 4, Dx{Delta}NBS+GST; lane 5 and 6, Dx{Delta}PRM+GST; lanes 7 and 8, DxmRZF+GST; lanes 9 and 10, Dx{Delta}NBS-mRZF+GST; lanes 11 and 12, GST alone. The protein blot was probed with anti-GST antibody. Molecular weight markers are shown in kDa.

 
All three motifs of Deltex are required for normal Deltex function
As mentioned above, overexpression of Dxfull under the control of ptc-GAL4 induced a secondary wing margin-like structure (Fig. 3B,H). As shown in Fig. 3N, ectopic sensory organ precursor (SOP) cells (green and arrowhead) along the region expressing Dxfull protein (red) were formed in these flies. The induction of SOPs appeared to be non-cell-autonomous and occurred only in the ventral compartment (Fig. 3N). This observation provides further support to the interpretation that the overexpression of Dxfull leads to the development of a secondary wing margin-like structure. The endogenous Deltex protein could be detected as faint, ubiquitous staining throughout the entire wing discs of the late third-instar larvae (Fig. 3M, red). Using this overexpression system, we examined the activity of four different mutant forms of Deltex (Fig. 3C-R). A mutant Deltex protein lacking the domain that binds to the Notch CDC10/Ankyrin repeats (Dx{Delta}NBS) or carrying two amino acid substitutions in the RING-H2 finger motif (DxmRZF) failed to induce the secondary wing margin-like structure in the adult wing, although very slight effects were still observed occasionally (Fig. 3C,I,E,K). These findings were confirmed by the observation that ectopic SOPs were not formed in the wing discs expressing these two mutant proteins (Fig. 3O,Q). By contrast, the overexpression of a mutant Deltex lacking the nine amino acids (amino acids 475-483) that encompass the proline-rich motif (Dx{Delta}PRM) resulted in wing nicking (Fig. 3D,J). We noted that this phenotype resembled those of deltex/Y and Notch/+ flies (Fig. 1).

Dominant-negative behavior of a mutant Deltex lacking the proline-rich motif
The wing-notch phenotype induced by the overexpression of Dx{Delta}PRM suggested that Dx{Delta}PRM might be a dominant-negative form of Deltex that inhibited Notch signaling during wing margin development. To test this hypothesis, we performed two different lines of experiments. First, Dx{Delta}PRM and Dxfull were overexpressed simultaneously under the control of ptc-GAL4. We expected that Dx{Delta}PRM and Dxfull would counteract each other’s activity, if the Dx{Delta}PRM was a dominant-negative protein. As described above, overexpression of Dxfull induced an ectopic wing margin-like structure (Fig. 3B,H), and under the same conditions, overexpression of Dx{Delta}PRM resulted in the wing nick phenotype (Fig. 3D,J). However, as expected, the co-expression of Dx{Delta}PRM and Dxfull did not have a substantial effect on the wing development, indicating these two proteins suppressed each other’s activities (Fig. 4A,C). This result was consistent with the observation that Dx{Delta}PRM suppressed the ectopic induction of SOPs by Dxfull (Fig. 4E).



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 4. Dominant-negative behavior of Dx{Delta}PRM. (A-D) Adult wings. (E,F) Wing discs of third-instar larvae. SOPs are shown in green, and Deltex derivatives are shown in red. (G-I) Wing discs of third-instar larvae. Wg and Deltex proteins are shown in green and red, respectively. (A,C,E) Co-expression of Dxfull and Dx{Delta}PRM. Note that phenotypes induced by either Dxfull or Dx{Delta}PRM were suppressed by co-expression of both proteins (see Fig. 3B,D,H,J,N,P). (B,D,F) Overexpression of Dx{Delta}NBS-{Delta}PRM with the ptc-Gal4 driver. Note that overexpression of Dx{Delta}NBS-{Delta}PRM did not result in the wing-notch phenotype. (G) Endogenous expression of Wg (green) was detected along the boundary of the dorsal/ventral compartments in the wild-type wing discs of third-instar larvae. (H) Overexpression of Dx{Delta}PRM. Endogenous expression of Wg (green) was suppressed in the cells expressing Dx{Delta}PRM (red). A high-magnification photograph is shown at the top right. (I) Overexpression of Dx{Delta}NBS-{Delta}PRM. Note that Dx{Delta}NBS-{Delta}PRM (red) did not suppress the Wg (green) expression. A high-magnification photograph is shown at the top right.

 
Second, we examined the effect of Dx{Delta}PRM overexpression on endogenous Notch activity. Fig. 4G shows the expression of the Wingless (Wg) protein in the wing discs of third-instar larvae. The expression of Wg along the boundary of the dorsal and ventral compartments has been shown to depend on the activation of Notch signaling (Couso et al., 1995Go; Diaz-Benjumea and Cohen, 1995Go; Kim et al., 1995Go; Axelrod et al., 1996Go; Doherty et al., 1996Go). As shown in Fig. 4H, the endogenous expression of Wg (green) in the dorsal/ventral compartment boundary was suppressed by the overexpression of Dx{Delta}PRM (red and highlighted in the upper right of the panel).

The dominant-negative activity of Dx{Delta}PRM appeared to require the Deltex domain for binding to the intracellular domain of Notch. A Deltex protein lacking two regions, the proline-rich motif and the domain binding to Notch (Dx{Delta}NBS-{Delta}PRM in Fig. 2A) did not result in the wing-notch phenotype (Fig. 4B,D,F) and failed to suppress the expression of Wg in the dorsal/ventral compartment boundary (Fig. 4I). This result suggested that the dominant-negative activity of Dx{Delta}PRM requires interaction with the intracellular domain of Notch.

Dx{Delta}PRM acts on Notch signaling upstream of an active form of Notch and downstream of full-length Notch
The results presented above are consistent with the idea that Dx{Delta}PRM is a dominant-negative form of Deltex. We performed an epistatic analysis between Dx{Delta}PRM and full-length Notch (Nfull) or an activated form of Notch (Nact) (Fig. 5A). First, Dx{Delta}PRM was co-expressed with Nact under the control of the ptc-GAL4 driver. As shown in Fig. 5B, the expression of Nact alone resulted in the formation of ectopic SOPs (Rebay et al., 1993Go; Struhl et al., 1993Go; Lyman and Yedvobnick, 1995Go). Ectopic SOPs are indicated by an arrowhead (Fig. 5B). As shown in Fig. 5C, the co-expression of Dx{Delta}PRM did not substantially affect the ectopic SOP induction caused by the overexpression of Nact (compare with Fig. 5B). Similarly, the co-expression of Dx{Delta}PRM did not cause any marked effect on the ectopic induction of Wg that was caused by overexpressed Nact (compare Fig. 5D with 5E). Although Dxfull induced ectopic SOPs only in the ventral compartment of the wing pouch, Nact induced SOPs and Wg expression in both the dorsal and ventral compartments (Fig. 3N, Fig. 5B,D). As shown in Fig. 5F, the overexpression of Nfull resulted in the ectopic and non-cell-autonomous induction of Wg expression, which contrasted with the cell-autonomous induction of Wg by the overexpression of Nact. We found that co-expression of Dx{Delta}PRM suppressed the induction of the ectopic Wg expression that was caused by the overexpressed Nfull (compare Fig. 5F with 5G). Therefore, these results suggest that Dx{Delta}PRM acted downstream of Nfull and upstream of Nact.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 5. The dominant-negative form of Deltex (Dx{Delta}PRM) suppressed Notch signaling downstream of the full-length Notch and upstream of an activated form of Notch. (A) Notch and its derivative. Protein motifs in Notch: SP, a signal peptide; EGF, 36 EGF-like repeats; N, 3 Notch/Lin-12 repeats; TM, the transmembrane domain; NLS, two nuclear localization signals; ANK, 6 CDC10/Ankyrin repeats; opa, polyglutamine repeat. The full-length Notch and an activated form of Notch are shown at the top and bottom of A, respectively. Nact is a truncated form that lacks the entire extracellular domain and the transmembrane domain. It functions as a constitutively active form of Notch. (B-G) UAS-Nfull or UAS-Nact was expressed alone or co-expressed with UAS-Dx{Delta}PRM under the control of the ptc-GAL4 driver. Wing discs of third-instar larvae are shown. (B) Overexpression of Nact. SOPs are shown in green. Note that a row of ectopic SOP cells was formed (arrowhead). (C) Co-expression of Nact and Dx{Delta}PRM (red). Ectopic formation of SOPs (green) was not suppressed. (D) Overexpression of Nact induced the ectopic expression of Wg (green) (Couso et al., 1994Go; Williams et al., 1994Go). (E) Co-expression of Nact and Dx{Delta}PRM (red). Note that the ectopic Wg expression (green) remained essentially the same. (F) Overexpression of Nfull (red) induced the ectopic Wg expression (green). (G) Co-expression of Nfull and Dx{Delta}PRM (red). Note that the ectopic expression of Wg (green) was suppressed.

 
Deltex signaling activity is regulated by oligomerization mediated by its RING-H2 finger
The above results demonstrate that the Deltex RING-H2 finger motif is essential for Deltex function. RING-H2 finger motifs have been shown to mediate various protein-protein interactions (Freemont, 1993Go; Freemont, 2000Go; Joazeiro and Weissman, 2000Go). Ste5, a yeast protein, and Deltex have similar RING-H2 finger motifs (Inouye et al., 1997Go). Ste5 is an essential component of the mitogen-activated protein kinase (MAPK) cascade in a yeast pheromone response pathway (for a review, see Madhani and Fink, 1998Go; Schaeffer and Weber, 1999Go). In response to pheromone, Ste5 binds through its RING-H2 finger motif to the free Gß{gamma} complex, which is composed of Ste4 and Ste18 (Whiteway et al., 1995Go; Inouye et al., 1997Go; Feng et al., 1998Go). This interaction leads to the activation of the MAPK cascade (Feng et al., 1998Go). The interaction between Ste5 and Ste4 is a prerequisite for Ste5 to self-associate and to function as part of the signal-transduction pathway (Whiteway et al., 1995Go). Moreover, it has been shown that the RING-H2 finger motif of Ste5 is also required for this self-association (Inouye et al., 1997Go).

The homology between the RING-H2 finger motifs of Ste5 and Deltex raised the possibility that the Deltex RING-H2 finger motif might have a similar function to the RING-H2 finger motif in Ste5. To test this hypothesis, we first performed an in vitro binding experiment. Two chimeric forms of Deltex, a wild-type Deltex (Dxfull+GST) and a Deltex carrying mutations in the RING-H2 finger motif, DxmRZF (DxmRZF+GST), in which GST was fused to the C terminus, were made in Drosophila tissue culture cells (the S2 cell line). We co-expressed each GST fusion protein with either wild-type Deltex or DxmRZF in S2 cells. The GST fusion form of the Deltex derivatives that bound to Glutathione-Sepharose 4B resin could be recovered and detected on a western blot using an anti-Deltex antibody. If Deltex formed homo-oligomers, non-GST fusion forms of Deltex should be co-purified with the fusion proteins and detected on the same western blot. We found that Deltex (non-GST fusion) bound to Dxfull+GST and was co-purified (Fig. 6, lane 11), but DxmRZF did not bind to the corresponding fusion protein (Fig. 6, lane 12). Neither wild-type Deltex nor DxmRZF bound to DxmRZF+GST under the same conditions (Fig. 6, lanes 13,14). These results show that Deltex self-associates and that the RING-H2 finger motif is required for this oligomerization.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 6. Mutations in the RING-H2 finger motif of Deltex disrupted its homotypic interaction. UAS-Dxfull, -DxmRZF, -Dxfull+GST, and -DxmRZF+GST (see Fig. 2A,B) were expressed with pWA-GAL4 in Drosophila S2 cells. Deltex derivatives were detected by western blot with an anti-Deltex antibody. Lanes 1-7, the total cell extract that was added to the resin; lanes 8-14, eluants from the Glutathione-Sepharose 4B resin. Dxfull and DxmRZF are indicated by an arrowhead (~90 kDa). Dxfull+GST and DxmRZF+GST are indicated by an arrow (~120 kDa). Molecular weight markers are shown in kDa.

 
We then tested the possibility that the oligomerization of Deltex that was mediated by the RING-H2 finger motif had a crucial role for the activity of Deltex. The GST protein forms a stable dimer complex, both in solution and in protein crystals (Lim et al., 1994Go; McTigue et al., 1995Go), and this dimerization can functionally substitute for the dimerization domain of a heterologous protein (Maru et al., 1996Go; Riley et al., 1996Go). The Deltex derivative-GST fusion proteins were expressed in vivo using the UAS/GAL4 system (Fig. 2B). A western blot analysis using the anti-GST antibody revealed that all the GST fusion proteins were expressed with the expected molecular weight (Fig. 2D). Each fusion protein was expressed under the control of the ptc-GAL4 driver, and the transgenic flies were examined for formation of an ectopic wing margin-like structure and ectopic induction of SOPs (Fig. 7). Expression of DxmRZF+GST resulted in the formation of an ectopic wing margin-like structure and the ectopic induction of SOPs (Fig. 7D,J,P), while DxmRZF (the non- GST form) had no significant effect on either (Fig. 3E,K,Q). Therefore, the GST-mediated dimerization was sufficient to restore the function of DxmRZF. Furthermore, we found that overexpression of DxmRZF+GST under the control of a heat-shock promoter could rescue the mutant phenotype of the loss-of-function deltex in the wing veins (Fig. 8C). DxmRZF+GST was as competent as wild-type Deltex in rescuing the wing vein thickening phenotype (compare Fig. 8E with 8F). Occasionally, a wing vein was found to be missing in wings overexpressing DxmRZF+GST or wild-type Deltex (data not shown). By contrast, a control GST fusion form of wild-type Deltex did not show a substantial effect in the adult wing or on the formation of SOPs (Fig. 7A,G,M). These results suggest that the self-association of Deltex that is mediated by the RING-H2 finger motif in the wild-type protein is essential for the signaling activity of Deltex.



View larger version (80K):
[in this window]
[in a new window]
 
Fig. 7. GST-mediated dimerization substituted for the function of the Deltex RING-H2 finger motif. Transgenic flies carrying UAS constructs expressing Deltex derivatives fused to GST were crossed to ptc-GAL4 or ptc-GAL4/CyO;A101/TM6B. (A-L) Adult wings and high-magnification photographs. (M-R) The SOP cells in the third-instar wing discs are shown in green, and Deltex derivatives are shown in red. An enhancer trap line, A101, was used to visualize SOP cells. (A,G,M) Overexpression of Dxfull+GST did not produce a noticeable effect. (B,H,N) Overexpression of Dx{Delta}NBS+GST resulted in wild-type wings and discs. (C,I,O) Overexpression of Dx{Delta}PRM+GST gave wild-type wings and discs. (D,J,P) Overexpression of DxmRZF+GST resulted in the induction of a secondary wing margin-like structure and ectopic SOP formation (indicated by an arrow), which resembled the effect of Dxfull overexpression (see Fig. 3B,H,N). Note that DxmRZF (non-GST form) did not show a substantial effect under the same conditions (see Fig. 3E,K,Q). (E,K,Q) Overexpression of Dx{Delta}NBS-mRZF+GST resulted in wild-type wings and discs. (F,L,R) Overexpression of GST alone did not show a substantial effect.

 


View larger version (136K):
[in this window]
[in a new window]
 
Fig. 8. Loss-of-function deltex phenotype was rescued by the overexpression of DxmRZF+GST. Adult wings from flies of the following genotypes. (C,F) deltex24 / Y;; hs-GAL4/DxmRZF+GST. Wing phenotype of deltex was rescued (27% showed complete rescue). (A-C) Wings without heat-shock treatment and (D-F) wings from flies heat-shocked at the early pupal stage. (A,D) deltex24 / Y;; hs-GAL4. Small deltas of extra vein material are visible where the veins reach the wing margin. (B,E) deltex24/Y;; hs-GAL4/UAS-Dxful. Wing phenotype of deltex was rescued (18% showed complete rescue).

 

    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have dissected the functions of three Deltex domains. These domains have been described previously, but their functions are not understood. Our results showed that the proline-rich and the RING-H2 finger motifs are required for distinct Deltex functions and are indispensable for Deltex activity. Although the identity of the proteins binding to these Deltex motifs and the nature of the protein-protein interactions are still elusive, our results suggest that unidentified factor(s) are an integral component of Deltex function and the regulation of Notch signaling.

A dominant-negative form of Deltex
A proline-rich motif in the middle region of Deltex has been reported previously (Busseau et al., 1994Go; Matsuno et al., 1998Go). This motif shows homology to a consensus amino acid sequence of a binding site for SH3-domain proteins (Cohen et al., 1995Go; Di Fiore et al., 1997Go; Pawson and Scott, 1997Go; Kay et al., 2000Go). Indeed, we have previously demonstrated that human Grb-2, an SH3-domain protein, binds to Deltex (Lowenstein et al., 1992Go; Matsuno et al., 1998Go). In this paper, we show that Deltex lacking the proline-rich motif (Dx{Delta}PRM) behaves as a dominant-negative form. Based on these observations, we speculate that an as-yet-unidentified SH3-domain protein interacts with the proline-rich motif of Deltex and is an integral part of Deltex activity.

Nonetheless, the mechanism of the dominant-negative action of this mutant Deltex remains to be elucidated. Because proline-rich motifs are also found in the human, chicken and mouse Deltex homologs, the underlying mechanisms of this dominant-negative behavior may be evolutionarily conserved (Pampeno and Meruelo, 1996Go; Matsuno et al., 1998Go; Frolova and Beebe, 2000Go; Kishi et al., 2001Go). Previously, we showed that the expression of Deltex domain I fragment (amino acids 1-303), which lacks approximately two-thirds of the C-terminal region of the molecule, rescued a loss-of-function deltex phenotype and did not show dominant-negative function (Matsuno et al., 1995Go). Therefore, in addition to the absence of the proline-rich motif, the presence of some other part(s) of the Deltex domain II-III is required for the Dx{Delta}PRM mutant to act as a dominant-negative form of the Deltex protein (see Fig. 2A).

While Dx{Delta}PRM behaved as a dominant-negative protein during wing margin development, overexpression of Dx{Delta}PRM under the control of a heat-shock promoter during early embryogenesis did not result in a neurogenic phenotype, which is an indication that Notch signaling was not disrupted (data not shown). Therefore, the dominant-negative action of Dx{Delta}PRM may depend on the developmental context of cells, although the cellular component(s) responsible for this context-dependence remains to be identified. In this regard, it is noteworthy that none of the existing deltex alleles show the neurogenic phenotype (Xu and Artavanis-Tsakonas, 1990Go).

Oligomerization mediated by the RING-H2 finger motif is required for Deltex activity
In this paper, we have shown that Deltex forms homo-oligomers, and this oligomerization is integral for Deltex function. GST-mediated dimerization substituted for the function of the Deltex RING-H2 finger motif. The activity of DxmRZF+GST did not seem to be neomorphic, because the loss-of-function deltex phenotype was rescued by the expression of DxmRZF+GST. Furthermore, we often observed the partial loss of wing veins, which resembles the phenotypes of gain-of-function Notch mutants, or is also seen under the circumstances of constitutive activation of the Notch signal (Rebay et al., 1993Go; Struhl et al., 1993Go). However, the fusion of wild-type Deltex to GST (Dxfull+GST) did not show substantial activity in our system. Therefore, the GST-mediated dimerization may abolish the activity of wild-type Deltex; it is also possible that Dxfull+GST is not functional because the fusion to GST leads to some nonspecific disruption of the protein structure. However, it has been reported that the Ste5 oligomerization mediated by its RING-H2 finger motif serves as both a positive and negative regulatory step (Inouye et al., 1997Go). An oligomerization of Ste5 that regulates it negatively is relieved by the Ste5-Ste4 interaction, and this interaction then permits Ste5 to form an oligomer mediated by its RING-H2 finger motif, in that order. Therefore, sequential oligomerization taking place in the proper order may be also important for Deltex function. However, in the case of Deltex, the factor that might relieve it from its inhibitory oligomeric state remains to be identified. It is not likely that Notch functions as such a relieving factor, because a GST-fusion with a double mutant Deltex, Dx{Delta}NBS-mRZF +GST, lost the activity of DxmRZF +GST (Fig. 7D,J,P,E,K,Q), suggesting that the binding of Deltex to the Notch CDC10/Ankyrin repeats was apparently still required in DxmRZF +GST, despite the fact that this protein presumably bypassed the inhibitory oligomerization state and was competent to signal. This also suggests that the binding of Deltex to Notch is not a prerequisite for the self-association of Deltex, as the Notch-binding domain of Deltex is still indispensable for the activity of the artificially dimerized Deltex GST (Fig. 7D,J,P,E,K,Q).

Implications from the dominant-negative form of Deltex
Previously, we have shown that the loss-of-function deltex phenotype could be rescued by the expression of an activated form of Notch (Matsuno et al., 1995Go). This observation suggested that Deltex might act upstream of the activated form of Notch, although the nature of the deltex alleles used in that study had not been characterized very well. The present study shows that the dominant-negative form of Deltex acts upstream of an activated form of Notch and downstream of wild-type Notch. Although we need to be cautious in using a dominant-negative form of a protein to speculate about an epistatic relationship, the above two results are consistent. Therefore, we speculate that this dominant-negative form of Deltex may inhibit the activation or maturation of the Notch receptor. For example, possible target steps include the ligand-dependent cleavage of Notch, the processing of Notch to its mature form or the ligand susceptibility of Notch. Alternatively, it is possible that the dominant-negative Deltex specifically decreases the stability of full-length Notch.

Differences in the inductive properties of Dxfull and Nact
We have shown that overexpression of Dxfull induces an ectopic wing margin-like structure, which is similar to the consequence of the ectopic expression of Nact (Dias-Benjumea and Cohen, 1995Go; de Celis and Bray, 1997Go). However, these two proteins appear to have distinct inductive properties in the wing pouch. As shown in Fig. 3N, Dxfull induces SOPs only in the ventral compartment of the wing pouch, while Nact induces SOPs in both the dorsal and ventral compartments (Fig. 5B). Furthermore, Dxfull induces SOPs in cells other than and distant from those expressing Dxfull. From these results, we speculate that induction of Serrate may be a part of these events. Nact has been shown to induce Serrate within the wing pouch, and Serrate effectively activates Notch only in the ventral compartments (Panin et al., 1997Go). The activation of Notch results in the Wg induction that in turn induces SOPs in the neighboring cells (Rulifson and Blair, 1995Go). Furthermore, high-level expression of Serrate autonomously inhibits the induction of the genes within the wing pouch that are dependent upon Notch signaling (Jonsson and Knust, 1996Go; Klein et al., 1997Go; Micchelli et al., 1997Go). Thus, the induction of Serrate would explain, at least in part, the result that Dxfull induced SOPs only in the ventral compartment, and ectopic SOPs were formed slightly remove from the cells expressing Dxfull.

Putative factor(s) binding to the proline-rich motif of Deltex
The dominant-negative behavior of Dx{Delta}PRM suggests that putative factor(s) that interact with the proline-rich motif might be essential for Deltex function. Suppressor of deltex [Su(dx)] is a good candidate. Su(dx) genetically suppresses deltex and Notch mutant phenotypes and encodes an E3-ubiquitin ligase (Fostier et al., 1998Go; Cornell et al., 1999Go). Su(dx) has WW domains that bind to proline-rich motifs in general (Cornell et al., 1999Go). In a mammalian system, a mammalian homolog of Su(dx), Itch, binds to the intracellular domain of Notch and ubiquitinates it (Qiu et al., 2000Go). Therefore, Deltex may function to suppress Su(dx), a negative regulator of Notch signaling, through an interaction that may be mediated by the proline-rich motif of Deltex and the WW domain of Su(dx).


    ACKNOWLEDGMENTS
 
We thank Dr Roel Nusse for an antibody, Dr Masahiro J. Go for stocks, and members of the Okano and Matsuno laboratories. K. M. and M. I. were supported by CREST (to H. O.) as a research scientist and a research technician, respectively. This work was supported in part by grants from the Ministry of Science, Culture and Education to K. M., who is also grateful for the support from the Sumitomo Foundation and the Naito Foundation.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Artavanis-Tsakonas, S., Muskavitch, M. A. and Yedvobnick, B. (1983). Molecular cloning of Notch, a locus affecting neurogenesis in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 80, 1977-1981[Abstract/Free Full Text]
Artavanis-Tsakonas, S., Matsuno, K. and Fortini, M. E. (1995). Notch signaling. Science 268, 225-232.[Abstract/Free Full Text]
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J. (1999). Notch signaling: cell fate control and signal integration in development. Science 284, 770-776.[Abstract/Free Full Text]
Axelrod, J. D., Matsuno, K., Artavanis-Tsakonas, S. and Perrimon, N. (1996). Interaction between Wingless and Notch signaling pathways mediated by dishevelled. Science 271, 1826-1832.[Abstract]
Bailey, A. M. and Posakony, J. W. (1995). Suppressor of hairless directly activates transcription of enhancer of split complex genes in response to Notch receptor activity. Genes Dev. 9, 2609-2622.[Abstract/Free Full Text]
Blaumueller, C. M. and Artavanis-Tsakonas, S. (1997). Comparative aspects of Notch signaling in lower and higher eukaryotes. Perspect. Dev. Neurobiol. 4, 325-343.[Medline]
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401-415.[Abstract]
Brook, W. J., Diaz-Benjumea, F. J. and Cohen, S. M. (1996). Organizing spatial pattern in limb development. Annu. Rev. Cell Dev. Biol. 12, 161-180.[Medline]
Brou, C., Logeat, F., Gupta, N., Bessia, C., LeBail, O., Doedens, J. R., Cumano, A., Roux, P., Black, R. A. and Israel, A. (2000). A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Mol. Cell 5, 207-216.[Medline]
Busseau, I., Diederich, R. J., Xu, T. and Artavanis-Tsakonas, S. (1994). A member of the Notch group of interacting loci, deltex encodes acytoplasmic basic protein. Genetics 136, 585-596.[Abstract]
Cohen, G. B., Ren, R. and Baltimore, D. (1995). Modular binding domains in signal transduction proteins. Cell 80, 237-248.[Medline]
Cohen, S. M. (1996). Controlling growth of the wing: vestigial integrates signals from the compartment boundaries. BioEssays 18, 855-858.[Medline]
Cornell, M., Evans, D. A., Mann, R., Fostier, M., Flasza, M., Monthatong, M., Artavanis-Tsakonas, S. and Baron, M. (1999). The Drosophila melanogaster Suppressor of deltex gene, a regulator of the Notch receptor signaling pathway, is an E3 class ubiquitin ligase. Genetics 152, 567-576.[Abstract/Free Full Text]
Couso, J. P., Bishop, S. A. and Martinez Arias, A. (1994). The wingless signalling pathway and the patterning of the wing margin in Drosophila. Development 120, 621-636.[Abstract]
Couso, J. P., Knust, E. and Martinez Arias, A. (1995). Serrate and wingless cooperate to induce vestigial gene expression and wing formation in Drosophila. Curr. Biol. 5, 1437-1448.[Medline]
de Celis, J. F. and Bray, S. (1997). Feed-back mechanisms affecting Notch activation at the dorsoventral boundary in the Drosophila wing. Development 124, 3241-3251.[Abstract]
De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J. S., Schroeter, E. H., Schrijvers, V., Wolfe, M. S., Ray, W. J. et al. (1999). A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain. Nature 398, 518-522.[Medline]
Di Fiore, P. P., Pelicci, P. G. and Sorkin, A. (1997). EH: a novel protein-protein interaction domain potentially involved in intracellular sorting. Trends Biochem. Sci. 22, 411-413.[Medline]
Diaz-Benjumea, F. J. and Cohen, S. M. (1995). Serrate signals through Notch to establish a Wingless-dependent organizer at the dorsal/ventral compartment boundary of the Drosophila wing. Development 121, 4215-4225.[Abstract]
Diederich, R. J., Matsuno, K., Hing, H. and Artavanis-Tsakonas, S. (1994). Cytosolic interaction between deltex and Notch ankyrin repeats implicates deltex in the Notch signaling pathway. Development 120, 473-481.[Abstract]
Doherty, D., Feger, G., Younger-Shepherd, S., Jan, L. Y. and Jan, Y. N. (1996). Delta is a ventral to dorsal signal complementary to Serrate,another Notch ligand,in Drosophila wing formation. Genes Dev. 10, 421-434.[Abstract/Free Full Text]
Fehon, R. G., Kooh, P. J., Rebay, I., Regan, C. L., Xu, T., Muskavitch, M. A. and Artavanis-Tsakonas, S. (1990). Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF-homologous genes in Drosophila. Cell 61, 523-534.[Medline]
Feng, Y., Song, L. Y., Kincaid, E., Mahanty, S. K. and Elion, E. A. (1998). Functional binding between Gbeta and the LIM domain of Ste5 is required to activate the MEKK Ste11. Curr. Biol. 8, 267-278.[Medline]
Fortini, M. E. and Artavanis-Tsakonas, S. (1994). The suppressor of hairless protein participates in notch receptor signaling. Cell 79, 273-282.[Medline]
Fostier, M., Evans, D. A., Artavanis-Tsakonas, S. and Baron, M. (1998). Genetic characterization of the Drosophila melanogaster Suppressor of deltex gene: A regulator of notch signaling. Genetics 150, 1477-1485.[Abstract/Free Full Text]
Freemont, P. S. (1993). The RING finger. A novel protein sequence motif related to the zinc finger. Ann. New York Acad. Sci. 684, 174-192.[Medline]
Freemont, P. S. (2000). RING for destruction? Curr. Biol. 10, R84-87.[Medline]
Frolova, E. and Beebe, D. (2000). The expression pattern of a novel Deltex homologue during chicken embryogenesis. Mech. Dev. 92, 285-289.[Medline]
Gorman, M. J. and Girton, J. R. (1992). A genetic analysis of deltex and its interaction with the Notch locus in Drosophila melanogaster. Genetics 131, 99-112.[Abstract]
Greenwald, I. (1998). LIN-12/Notch signaling: lessons from worms and flies. Genes Dev. 12, 1751-1762.[Free Full Text]
Gridley, T. (1997). Notch signaling in vertebrate development and disease. Mol. Cell. Neurosci. 9, 103-108.
Honjo, T. (1996). The shortest path from the surface to the nucleus: RBP-J kappa/Su(H) transcription factor. Genes Cells 1, 1-9.[Abstract]
Inouye, C., Dhillon, N. and Thorner, J. (1997). Ste5 RING-H2 domain: role in Ste4-promoted oligomerization for yeast pheromone signaling. Science 278, 103-106.[Abstract/Free Full Text]
Irvine, K. D. and Vogt, T. F. (1997). Dorsal-ventral signaling in limb development. Curr Opin. Cell Biol. 9, 867-876.[Medline]
Joazeiro, C. A. and Weissman, A. M. (2000). RING finger proteins: mediators of ubiquitin ligase activity. Cell 102, 549-552.[Medline]
Johnson, R. L., Grenier, J. K. and Scott, M. P. (1995). patched overexpression alters wing disc size and pattern: transcriptional and post-transcriptional effects on hedgehog targets. Development 121, 4161-4170.[Abstract]
Jonsson, F. and Knust, E. (1996). Distinct functions of the Drosophila genes Serrate and Delta revealed by ectopic expression during wing development. Dev. Genes Evol. 206, 91-101.
Kadesch, T. (2000). Notch signaling: A dance of proteins changing partners. Exp. Cell Res. 260, 1-8.[Medline]
Kay, B. K., Williamson, M. P. and Sudol, M. (2000). The importance of being proline: the interaction of proline-rich motifs in signaling proteins with their cognate domains. FASEB J. 14, 231-241.[Abstract/Free Full Text]
Kim, J., Irvine, K. D. and Carroll, S. B. (1995). Cell recognition, signal induction, and symmetrical gene activation at the dorsal-ventral boundary of the developing Drosophila wing. Cell 82, 795-802.[Medline]
Kim, J., Sebring, A., Esch, J. J., Kraus, M. E., Vorwerk, K., Magee, J. and Carroll, S. B. (1996). Integration of positional signals and regulation of wing formation and identity by Drosophila vestigial gene. Nature 382, 133-138.[Medline]
Kimble, J. and Simpson, P. (1997). The LIN-12/Notch signaling pathway and its regulation. Annu. Rev. Cell. Dev. Biol. 13, 333-361.[Medline]
Kishi, N., Tang, Z., Maeda, Y., Hirai, A., Mo, R., Ito, M., Suzuki, S., Nakao, K., Kinoshita, T., Kadesch, T. et al. (2001). Murine homologs of deltex define a novel gene family involved in vertebrate Notch signaling and neurogenesis. Int. J. Dev. Neurosci. 19, 21-35.[Medline]
Klein, T., Brennan, K. and Arias, A. M. (1997). An intrinsic dominant negative activity of serrate that is modulated during wing development in Drosophila. Dev. Biol. 189, 123-134.[Medline]
Klein, T., Seugnet, L., Haenlin, M. and Martinez Arias, A. (2000). Two different activities of Suppressor of Hairless during wing development in Drosophila. Development 127, 3553-3566.[Abstract]
Lecourtois, M. and Schweisguth, F. (1995). The neurogenic suppressor of hairless DNA-binding protein mediates the transcriptional activation of the enhancer of split complex genes triggered by Notch signaling. Genes Dev. 9, 2598-2608.[Abstract/Free Full Text]
Lecourtois, M. and Schweisguth, F. (1998). Indirect evidence for Delta-dependent intracellular processing of notch in Drosophila embryos. Curr. Biol. 8, 771-774.[Medline]
Lim, K., Ho, J. X., Keeling, K., Gilliland, G. L., Ji, X., Ruker, F. and Carter, D. C. (1994). Three-dimensional structure of Schistosoma japonicum glutathione S-transferase fused with a six-amino acid conserved neutralizing epitope of gp41 from HIV. Protein Sci. 3, 2233-2244.[Medline]
Lowenstein, E. J., Daly, R. J., Batzer, A. G., Li, W., Margolis, B., Lammers, R., Ullrich, A., Skolnik, E. Y., Bar-Sagi, D. and Schlessinger, J. (1992). The SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signaling. Cell 70, 431-442.[Medline]
Lyman, D. F. and Yedvobnick, B. (1995). Drosophila Notch receptor activity suppresses Hairless function during adult external sensory organ development. Genetics 141, 1491-1505.[Abstract]
Madhani, H. D. and Fink, G. R. (1998). The riddle of MAP kinase signaling specificity. Trends Genet. 14, 151-155.[Medline]
Maru, Y., Afar, D. E., Witte, O. N. and Shibuya, M. (1996). The dimerization property of glutathione S-transferase partially reactivates Bcr-Abl lacking the oligomerization domain. J. Biol. Chem. 271, 15353-15357.[Abstract/Free Full Text]
Matsuno, K., Diederich, R. J., Go, M. J., Blaumueller, C. M. and Artavanis-Tsakonas, S. (1995). Deltex acts as a positive regulator of Notch signaling through interactions with the Notch ankyrin repeats. Development 121, 2633-2644.[Abstract]
Matsuno, K., Eastman, D., Mitsiades, T., Quinn, A. M., Carcanciu, M. L., Ordentlich, P., Kadesch, T. and Artavanis-Tsakonas, S. (1998). Human deltex is a conserved regulator of Notch signalling. Nat. Genet. 19, 74-78.[Medline]
McTigue, M. A., Bernstein, S. L., Williams, D. R. and Tainer, J. A. (1995). Purification and crystallization of a schistosomal glutathione S- transferase. Proteins 22, 55-57.[Medline]
Micchelli, C. A., Rulifson, E. J. and Blair, S. S. (1997). The function and regulation of cut expression on the wing margin of Drosophila: Notch, Wingless and a dominant negative role for Delta and Serrate. Development 124, 1485-1495.[Abstract]
Mumm, J. S., Schroeter, E. H., Saxena, M. T., Griesemer, A., Tian, X., Pan, D. J., Ray, W. J. and Kopan, R. (2000). A ligand-induced extracellular cleavage regulates gamma-secretase-like proteolytic activation of Notch1. Mol. Cell. 5, 197-206.[Medline]
Nye, J. S. and Kopan, R. (1995). Developmental signaling. Vertebrate ligands for Notch. Curr. Biol. 5, 966-969.[Medline]
Pampeno, C. L. and Meruelo, D. (1996). A novel cDNA transcript expressed in fractionated X-irradiation-induced murine thymomas. Cell Growth Differ. 7, 1113-1123.[Abstract]
Panin, V. M., Papayannopoulos, V., Wilson, R. and Irvine, K. D. (1997). Fringe modulates Notch-ligand interactions. Nature 387, 908-912.[Medline]
Pawson, T. and Scott, J. D. (1997). Signaling through scaffold, anchoring, and adaptor proteins. Science 278, 2075-2080.[Abstract/Free Full Text]
Qiu, L., Joazeiro, C., Fang, N., Wang, H. Y., Elly, C., Altman, Y., Fang, D., Hunter, T. and Liu, Y. C. (2000). Recognition and Ubiquitination of Notch by Itch, a Hect-type E3 Ubiquitin Ligase. J. Biol. Chem. 275, 35734-35737.[Abstract/Free Full Text]
Rebay, I., Fehon, R. G. and Artavanis-Tsakonas, S. (1993). Specific truncations of Drosophila Notch define dominant activated and dominant negative forms of the receptor. Cell 74, 319-329.[Medline]
Riley, L. G., Ralston, G. B. and Weiss, A. S. (1996). Multimer formation as a consequence of separate homodimerization domains: the human c-Jun leucine zipper is a transplantable dimerization module. Protein Eng. 9, 223-230.[Abstract/Free Full Text]
Rulifson, E. J. and Blair, S. S. (1995). Notch regulates wingless expression and is not required for reception of the paracrine wingless signal during wing margin neurogenesis in Drosophila. Development 121, 2813-2824.[Abstract]
Sawamoto, K., Okano, H., Kobayakawa, Y., Hayashi, S., Mikoshiba, K. and Tanimura, T. (1994). The function of argos in regulating cell fate decisions during Drosophila eye and wing vein development. Dev. Biol. 164, 267-276.[Medline]
Schaeffer, H. J. and Weber, M. J. (1999). Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol. Cell. Biol. 19, 2435-2444.[Free Full Text]
Schroeter, E. H., Kisslinger, J. A. and Kopan, R. (1998). Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Nature 393, 382-386.[Medline]
Sestan, N., Artavanis-Tsakonas, S. and Rakic, P. (1999). Contact-dependent inhibition of cortical neurite growth mediated by notch signaling. Science 286, 741-746.[Abstract/Free Full Text]
Struhl, G. and Adachi, A. (1998). Nuclear access and action of notch in vivo. Cell 93, 649-660.[Medline]
Struhl, G. and Greenwald, I. (1999). Presenilin is required for activity and nuclear access of Notch in Drosophila. Nature 398, 522-525.[Medline]
Struhl, G., Fitzgerald, K. and Greenwald, I. (1993). Intrinsic activity of the Lin-12 and Notch intracellular domains in vivo. Cell 74, 331-345.[Medline]
Tomlinson, A. and Ready, D. F. (1987). Neuronal differentiation in the Drosophila ommatidium. Dev. Biol. 120, 366-376.[Medline]
van den Heuvel, M., Nusse, R., Johnston, P. and Lawrence, P. A. (1989). Distribution of the wingless gene product in Drosophila embryos: a protein involved in cell-cell communication. Cell 59, 739-749.[Medline]
Vässin, H., Bremer, K. A., Knust, E. and Campos-Ortega, J. A. (1987). The neurogenic gene Delta of Drosophila melanogaster is expressed in neurogenic territories and encodes a putative transmembrane protein with EGF-like repeats. EMBO J. 6, 3431-3440.[Medline]
Weinmaster, G. (1998). Notch signaling: direct or what? Curr. Opin. Genet. Dev. 8, 436-442.[Medline]
Whiteway, M. S., Wu, C., Leeuw, T., Clark, K., Fourest-Lieuvin, A., Thomas, D. Y. and Leberer, E. (1995). Association of the yeast pheromone response G protein beta gamma subunits with the MAP kinase scaffold Ste5p. Science 269, 1572-1575.[Abstract/Free Full Text]
Williams, J. A., Paddock, S. W., Vorwerk, K. and Carroll, S. B. (1994). Organization of wing formation and induction of a wing-patterning gene at the dorsal/ventral compartment boundary. Nature 368, 299-305.[Medline]
Xu, T. and Artavanis-Tsakonas, S. (1990). deltex, a locus interacting with the neurogenic genes, Notch, Delta and mastermind in Drosophila melanogaster. Genetics 126, 665-677.[Abstract]
Ye, Y., Lukinova, N. and Fortini, M. E. (1999). Neurogenic phenotypes and altered Notch processing in Drosophila Presenilin mutants. Nature 398, 525-529.[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. Takeyama, R. C. T. Aguiar, L. Gu, C. He, G. J. Freeman, J. L. Kutok, J. C. Aster, and M. A. Shipp
The BAL-binding Protein BBAP and Related Deltex Family Members Exhibit Ubiquitin-Protein Isopeptide Ligase Activity
J. Biol. Chem., June 6, 2003; 278(24): 21930 - 21937.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuno, K.
Right arrow Articles by Okano, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuno, K.
Right arrow Articles by Okano, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?