|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
1 Department of Neurobiology, Harvard Medical School, 220 Longwood Avenue, Boston, MA 02115, USA
2 School of Biological Sciences, University of Sussex, Falmer, Brighton BN1 9QG, UK
*Authors for correspondence (e-mail: j.p.couso{at}biols.susx.ac.uk and sthor{at}hms.harvard.edu)
Accepted 26 November 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Imaginal disc development, Zinc finger, Drosophila melanogaster, Dual promoters, rotund, roughened eye
| INTRODUCTION |
|---|
|
|
|---|
The closely linked roughened eye (roe) locus affects a late step in the development of the eye, and roe mutants display rough eye morphology and reduction of photoreceptors (Renfranz and Benzer, 1989
). The roe gene is genetically separable from rn, but the two genes show complex complementation (Brand and Campos-Ortega, 1990
; Kerridge and Thomas-Cavallin, 1988
; Ma et al., 1996
). This previously led to the suggestion that rn and roe may be two classes of mutation of the same gene, each of them disrupting a subfunction (Ma et al., 1996
). To address the tight link between these two adjacent loci we have isolated the rn and roe genes. Intriguingly, our results show that roe is part of the rn gene but is represented by a different transcript. These two transcripts encode predicted proteins with an identical C-terminal region, containing a Krüppel-type zinc finger domain, but with different N-terminal regions. rn and roe are expressed in non-overlapping domains in the larval imaginal discs. Each cDNA can rescue only the corresponding mutation and when misexpressed in each others domain of expression has negative effects. Our results indicate that these two loci are genetically separable not only because of their differential expression but also because of distinct activities of the Rn and Roe proteins. By analyzing the expression of a number of markers in the developing imaginal discs, we further show that rn and roe act downstream of early patterning genes such as dachshund, but may act to modulate Notch signaling by regulating expression of Delta, Scabrous and Serrate.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Isolation of rn and roe cDNAs
Using genomic fragment D (Agnel et al., 1989
) (provided by R. Griffin-Shea) as a probe, three Drosophila cDNA libraries were screened for a total of 11 million plaques and colonies. A larval
gt11 cDNA library (Clontech) yielded a 1.3 kilobase pair (kb) positive clone (4H). Comparison of the 4H sequence with Drosophila genomic sequence revealed that the 4H cDNA was truncated on both ends owing to internal EcoRI sites. To obtain the remainder of the cDNA we used PCR to amplify a 700 bp fragment downstream of the 3' EcoRI site and used this PCR fragment to screen the same larval library. From 4 million plaques a 2.3 kb clone (22-4) was isolated and sequenced. The compiled cDNA sequence (4H/22-4) contained a long open reading frame (ORF) encoding a putative protein of 945 amino acids (aa; GenBank AF395905). There are several putative start codons at the beginning of the ORF, one of which closely matches the Drosophila consensus (Cavener and Ray, 1991
). Owing to internal EcoRI sites at the 5' of clone 4H and the 3' of clone 22-4, the precise extent of the rn gene was not determined. Immediately 3' of clone 22-4 the genome sequence reveals a number of polyadenylation sites that likely are used as termination signals.
We used a 3' fragment from rn clone 22-4 (bp 2714-3658 of GenBank AF395905) as a probe to screen the larval cDNA library used for isolation of the rn cDNA. This yielded 2 positive clones out of 5 million plaques. Both clones contained truncated roe cDNAs, corresponding to bp 332-2856 and 621-2856 (GenBank AF395904). Both inserts crossed the junction between exon 1 and exon 2 of the predicted roe gene, extending past the end of the Roe ORF. Since we did not obtain a full-length roe cDNA, we verified the structure of the roe transcript by amplifying part of it using RT-PCR. For this, RNA from w1118 embryos was isolated and purified using RNAsol (Tel-Test, Inc.) and Qiagen Oligotex (Qiagen). We designed a primer in the predicted first exon, 5' to stop codons in all three reading frames and followed by the predicted Roe start methionine (TAAAATTGTGCTTGGACCAGTGAA), and 2 primers in exon 2 (ATGCGAGAGCTGCGTGAACTT and TGCGACAGATACGACGAGTTGG). Using these primers, nested PCR was performed and a product of the predicted size was generated. Sequencing of this fragment was in agreement with our prediction for the intron/exon structure of roe (GenBank AF395904).
Generation of UAS-rn and UAS-roe
rn sequences corresponding to position 0-3373 (GenBank AF395905) of rn cDNA, and roe sequences corresponding to 0-2160 of roe cDNA (GenBank AF395904) and 86 bp of upstream genomic DNA, were cloned into the pUAST vector (Brand and Perrimon, 1993
). Three independent UAS-rn and eight independent UAS-roe transgenic lines were generated using P-element transformation (Spradling and Rubin, 1982
). These lines were tested for expression using GMR-GAL4 and all gave strong phenotypes indicating similar levels of expression.
P-element analysis
The insertion of the rn89 enhancer trap, a P[lArB] insert, was determined using standard plasmid rescue methods. This revealed that P[lArB] is inserted at position 440 bp upstream of the rn cDNA (GenBank AF395905).
Conversion of P[lArB] in rn89 to P[GawB] was carried out as previously described (Sepp and Auld, 1999
) with some modifications. Briefly, males of the genotype w1118, elavC155P[GawB];;rn89/D2-3,Sb were crossed to w1118 females and their progeny screened for red-eyed males (indicating that the P[GawB] had mobilized onto the autosomes). These males were crossed singly to UAS-GFP/TM3,Sb and their progeny screened for the rn expression pattern in larvae. From 30 lines screened, 3 independent insertions (rnGAL4#5, rnGAL4#13, rnGAL4#14) expressed GFP in the rn pattern and subsequently failed to complement rn. The site of insertion and the orientation of P[GawB] was determined by PCR amplification and sequencing. In all three cases P[GawB] was inserted in the exact same position as rn89 P[lArB]. For the rescue experiments rnGAL4#5 was used. The three rnGAL4 lines enhance the wing phenotype of Ser1, common to many third chromosome balancer lines (not shown).
To verify that the rn89 and rnGAL4#5 mutant phenotypes were due to the insertion of the P elements, we excised them by standard methods. For rn89, six independent revertants were isolated using their complementation of rn. Two independent revertant lines (rn#15 and rn#21) were homozygous viable and showed no rn phenotype. They were further analyzed by PCR and sequencing to determine the structure at the P-element insertion site. In both cases the P element had imprecisely excised but left a 30 bp (rn#15) and 37 bp (rn#21) footprint containing the expected direct duplication of the 8 bp P-element target sequence and additional sequences from both ends of the P element. These footprints are outside the identified rn exons thus explaining why they reverse the rn phenotype. Additionally, four stronger independent alleles were identified, one of which, rn
22 was analyzed in more detail. Southern blot analysis using multiple probes, revealed that rn
22 retained P[lArB] but is deleted for 3' flanking genomic DNA removing the first and part of the second rn exon (Fig. 1A). For the reversion of rnGAL4#5 a similar strategy was used and we obtained 5 independent revertant lines that complemented multiple rn alleles, and in addition had lost the white marker and GAL4 expression.
|
T mutation resulting in a glutamine to amber stop codon change at aa position 191 (bp 629 in GenBank AF395904) in the Roe ORF (Fig. 1A). This mutation would truncate the predicted Roe protein and the mutant protein would lack the entire C-terminal region including the ZF domain.
In situ hybridization and immunohistochemistry
Standard in situ protocols were used to examine expression of rn and roe (Tautz and Pfeile, 1989
). We used three probes, 4H, containing rn-only sequences (0-1331of GenBank AF395905), roe, containing the first exon of roe (0-785 of GenBank AF395904) and ZF, containing common 3' sequences including the ZF domain (2016-3373 of GenBank AF395905). Sense probes showed no signal in embryos or larvae. For the roe rescue experiments, adult eyes were cryo-sectioned and immunostained for Elav, a marker for photoreceptors (ONeill et al., 1994
). More than 14 ommatidia from more than four flies per genotype were analyzed and the total number of R1-7 photoreceptors determined. For epistatic analysis, third instar imaginal discs were immunostained using the following primary antibodies: anti-Elav (1:10), anti-Dac (1:25), anti-Boss (1:2000), anti-Sca (1:10), anti-Ser (1:1000), anti-Bab (1:2000) and anti-Dl (1:20).
| RESULTS |
|---|
|
|
|---|
150 aa ZF domain these two proteins display 84-90% identity to Rn (Fig. 1C). Among mammalian proteins, a recently identified rat cDNA, Cas-Interacting Zinc finger (CIZ) (Nakamoto et al., 2000
50 kb and extends on both sides of the rnracGAP (Fig. 1A).
The roe gene shows complex complementation with rn and a number of roe alleles are also rn (Agnel et al., 1989
; Brand and Campos-Ortega, 1990
; Kerridge and Thomas-Cavallin, 1988
; Ma et al., 1996
). The rn gene structure together with previous molecular work on rn alleles gave us some initial insight into the identity of roe. Particularly informative were the rn
22 and rn19 alleles. The rn
22 P-element excision allele (materials and methods) contains a deletion in the rn 5' region removing the first and part of the second exon of rn (Fig. 1A). Complementation analysis of rn
22 shows that it is a null allele of rn but does not cause roe phenotypes (see below). Furthermore, the rn19 allele, shown to contain a larger deletion in the rn 5' region (Agnel et al., 1989
), acts as a rn null allele and, although it removes at least one other lethal complementation group, does not cause roe phenotypes. These results indicated the existence of roe-specific functions encoded in the genomic region proximal to the breakpoint of rn19 (Fig. 1A). One model could be the existence of roe specific exon(s) that are spliced and utilized specifically in the eye. However, the fact that rn19 extends further distally, uncovering other complementation group(s), but does not produce roe phenotypes argues against eye-specific splicing of a long transcript originating from a promoter in the rn region. Instead, a more likely scenario would be the existence of an eye-specific promoter and exon(s). This notion was further supported by analysis of P-element insertions in the rn 5' area that result in the rn phenotype and matching expression but not in the roe phenotype or eye disc expression (see below). These results prompted us to look for additional exons that could explain the molecular nature of the roe gene. By screening a larval cDNA library with a rn 3' probe and by subsequent PCR analysis we isolated the roe cDNA. The roe gene utilizes the same two 3' exons as rn but contains a different 5' exon (Fig. 1A). As a result the predicted Roe protein shares the C-terminal region, including the ZF domain except the first finger, with Rn but differs in the N-terminal region (Fig. 1B). It is interesting to note that the rn genomic structure was not revealed by the analysis of the sequences carried out by the Drosophila Genome Project (Adams et al., 2000
). Although parts of the rn coding regions were identified (CG14600, CG14601, CG14603 and CG10040), the rn transcript was not predicted, probably because rn has several small exons spread over 50 kb. In contrast, the roe transcript was accurately predicted, short of one aa error in the splice junction between exons 1 and 2 (CG10040). At the submission of this study, the rn and roe cDNAs had not been isolated in the BDGP or RIKEN expressed sequence tag (EST) projects.
Molecular analysis of rotund and roughened eye mutations
The genomic structure of the rn locus that we propose fits well both with previous studies as well as with our molecular analysis of rn and roe alleles. First, rn16 and rn20 are deletions that show both rn and roe phenotypes, while the rn19 deletion only shows rn phenotypes (Agnel et al., 1989
). In agreement, rn16 deletes both the common ZF coding exons and roe-specific exons, rn20 deletes the whole region, and rn19 removes most of the rn-specific exons (Fig. 1A). Second, we sequenced roe3, a strong roe-specific allele, and show that it is the result of a nonsense mutation in the roe-specific exon. This mutation does not affect the common 3' exons and explains why roe3 acts as a roe null allele but does not show rn phenotypes. Third, rn89, a lacZ-containing P-element transposon allele (Couso and Bishop, 1998
) was shown to be inserted within the 5' region of the rn gene. This explains why it only displays rn and not roe phenotypes. In addition, imprecise excision of rn89 yielded rn
22, which contains a deletion of the first and part of the second rn exon (Fig. 1A). As expected, rn
22 displays a rn null phenotype (Fig. 3C,I) but no eye phenotype. In agreement with this, in situ hybridization failed to detect any rn transcript in rn
22 mutant discs (not shown). We further generated rnGAL4#5 by P-element conversion of rn89. rnGAL4#5 displays a stronger leg phenotype than rn89, possibly due to differences in the structure of the P element, but again no aberrant eye phenotype (not shown). Wild-type revertants of rn89 and rnGAL4#5 were generated that complement other rn alleles, verifying that in both cases the rn phenotype was caused by the P-element insertion.
|
|
Rescue of rotund
Owing to the complexity of the rn locus we wanted to further verify the authenticity of our rn and roe cDNAs by rescue experiments. For the rn rescue we focused on the leg phenotype and used the rnGAL4#5 line that shows strong leg phenotypes over rn20 (Fig. 3A,D,I). By providing rn function with UAS-rn, we observe rescue of the rnGAL4#5/rn20 leg phenotypes, often to a level indistinguishable from the wild-type leg (Fig. 3F,I, P<0.001). We do not observe any dominant effect in the leg of UAS-rn in a heterozygous background (Fig. 3E,I).
The structure of the rn genomic region and the differential expression in imaginal discs explains why rn and roe can be genetically separated and affect different tissues. However, the rn and roe gene products are also different, and the first ZF is truncated in the Roe protein (Fig. 1B), intriguing given that the first finger of Krüppel-type ZF proteins has been shown to be involved in DNA-binding (Avram et al., 1999
; Hamilton et al., 1998
). Rn and Roe further differ in the N-terminal regions where they contain stretches of glutamine/serine (Roe) or alanine (Rn), often found in transcriptional activator and repressor domains respectively (Gerber et al., 1994
; Lanz et al., 1995
; Licht et al., 1994
; Madden et al., 1993
; Nowling et al., 2000
). This raised the possibility that these two proteins may have different activities and may not be interchangeable. To address this issue we misexpressed roe in the leg disc and also attempted to rescue rn with roe. When roe is misexpressed in the developing leg disc using rnGAL4#5, we noticed a negative effect with reduced number of tarsi, similar to rn mutants (Fig. 3G,I). Furthermore, in a rn mutant background (rnGAL4#5/rn20) we observe no evidence of rescue by UAS-roe (Fig. 3H,I).
Rescue of roughened eye
We also wanted to rescue roe mutants using the GAL4/UAS system. The roe rescue was complicated by the fact that we did not have a GAL4 insertion in the roe gene. This is especially relevant given the dynamic pattern of roe expression in the eye disc, with transient expression in a band of approx. 4-6 cells at the morphogenetic furrow (Fig. 2I,K). We were unable to identify a GAL4 line that would express precisely in the roe pattern and instead attempted to rescue roe using GAL4 drivers that would drive in photoreceptors. To this end, we tested several eye disc GAL4 driver lines for ectopic effects. Not surprisingly, strong pan-eye drivers such as GMR-GAL4 lead to dramatic phenotypes with loss of pigment and bristle cells (Fig. 4D). A novel sevenless-GAL4 (sev-GAL4) line that expresses GAL4 in the photoreceptors, cone and mystery cells (Fig. 4A,B) showed little if any sign of rough eye morphology when crossed to UAS-roe (not shown). Using sev-GAL4 crossed to UAS-roe in a roe null mutant background (rn16/rn20) we observe partial rescue of the eye phenotypes with increased eye size and reduced roughness (Fig. 5A-C). To quantify the roe rescue we counted the number of adult R1-7 photoreceptors in wild-type, mutant and rescued flies. These results confirm previous studies (Ma et al., 1996
) and show that roe mutants have a reduced number of photoreceptors compared to wild type (Fig. 5E). In line with the apparent morphological rescue we find significantly increased numbers of photoreceptors in rescued flies when compared to mutants (P<0.04, Fig. 5E). Given that we were unable to use a GAL4 driver line that perfectly matched the dynamic expression of roe in eye discs, we believe that this partial rescue supports the proposed identity of the roe gene. As in the rn rescue experiments, we wanted to address whether rn is interchangeable with roe and could provide rescue activity in the eye. First we tested the activity of UAS-rn in the eye by misexpressing it using GMR-GAL4 and sev-GAL4. This leads to severe rough eye phenotypes with GMR-GAL4 (Fig. 4C) and little if any sign of rough eye morphology with sev-GAL4 (not shown). In a roe null mutant background (rn16/rn20) we find no evidence of rescue by adding UAS-rn (Fig. 5B-E).
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Regarding the function of the rnracGAP, both our work and previous studies argue against any involvement of rnracGAP in the rn or roe phenotypes (Agnel et al., 1989
; Agnel et al., 1992a
; Hoemann et al., 1996
). In situ studies indicate that rnracGAP is only expressed at low levels in the imaginal discs during pupal stages (Agnel et al., 1989
; Agnel et al., 1992a
; Hoemann et al., 1996
). In addition, there is no obvious difference in the severity of rn and roe phenotypes whether or not the rnracGAP is simultaneously removed. For instance, we have found no significant difference in the severity of rn leg phenotypes in rn20/rn20 (that removes rn, roe and rnracGAP) compared to rn19/rn20 (rn19 does not remove rnracGAP). Similarly, roe3/rn20 (roe3 has a premature stop codon in the roe-specific exon) displays as severe of an eye phenotype as rn20/rn20 (not shown). Furthermore, we can rescue rn and roe mutants with the rn and roe cDNAs. Recent studies may indicate an involvement of rnracGAP specifically in male fertility, and high levels of rnracGAP expression have been observed in the adult testis (Agnel et al., 1989
; Agnel et al., 1992a
; Hoemann et al., 1996
). The rn89 and rnGAL4#5 P-element insertions described here may provide useful starting materials for the generation of mutations specifically affecting the rnracGAP by local P-element mobilization.
Little is known about the genetic cascades within which roe and rn are acting. The results from eye-antennal imaginal discs indicate that roe acts at the morphogenetic furrow, as evident both from its expression and from the effects on Dl and Sca expression in roe mutants. Both Dl and sca play roles in spacing the array of ommatidial preclusters in the morphogenetic furrow (Baker et al., 1990
; Baker and Zitron, 1995
; Ellis et al., 1994
), and it is interesting to note that the expression of roe at the furrow is not evenly distributed and appears stronger in clusters of cells (Fig. 2I). Genetic screens for modifiers of the Nspl mutation identified roe as an enhancer, and sca and Dl as suppressors of the Nspl eye phenotype (Brand and Campos-Ortega, 1990
). Given the dynamics of N signaling, these results support models where Roe acts to either positively or negatively regulate Dl and Sca. A genetic interaction screen for enhancers of glass also identified roe (Ma et al., 1996
), an interesting finding given that ectopic expression of roe using GMR-GAL4 leads to a glass-like phenotype with a loss of bristles and pigment cells (Fig. 4E,F).
In the leg, rn expression is the earliest marker known for tarsal development (Couso and Bishop, 1998
). rn is required for the development of this region and for its subsequent patterning, as observed by the loss of Ser expression. Thus, the transient expression of rn in the leg might reveal that the intercalation of the presumptive tarsal region between the distal tip and medial leg regions occurs during early third instar.
It is increasingly common, even in invertebrates, to find genes that utilize two or more promoters (Gower et al., 2001
; Krishnan et al., 1995
; Li et al., 1999
; Mevel-Ninio et al., 1995
). Although this may lead to the generation of different proteins, it is often unclear whether the proteins have distinct activities. In fact, this issue is not easily resolved by traditional forward genetics and subsequent molecular analysis, since even if a locus can be genetically dissected into different subfunctions, this does not identify whether the different proteins have distinct activities. Perhaps the best way to test whether the variant proteins are interchangeable in vivo, is by cross-rescue in each others domain of expression. The rn gene is a clear example of a locus that utilizes both tissue-specific promoters and functionally distinct proteins to achieve functional diversity, a scenario likely to be observed more and more frequently in the post-genomic era.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A., Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A., Galle, R. F. et al. (2000). The genome sequence of Drosophila melanogaster. Science 287, 2185-2195.
Agnel, M., Kerridge, S., Vola, C. and Griffin-Shea, R. (1989). Two transcripts from the rotund region of Drosophila show similar positional specificities in imaginal disc tissues. Genes Dev. 3, 85-95.
Agnel, M., Roder, L., Griffin-Shea, R. and Vola, C. (1992a). The spatial expession of Drosophila rotund gene reveals that the imaginal discs are organized in domains along the proximal-distal axis. Rouxs Arch. Dev. Biol. 201, 284-295.
Agnel, M., Roder, L., Vola, C. and Griffin-Shea, R. (1992b). A Drosophila rotund transcript expressed during spermatogenesis and imaginal disc morphogenesis encodes a protein which is similar to human Rac GTPase-activating (racGAP) proteins. Mol. Cell Biol. 12, 5111-5122.
Avram, D., Leid, M. and Bakalinsky, A. T. (1999). Fzf1p of Saccharomyces cerevisiae is a positive regulator of SSU1 transcription and its first zinc finger region is required for DNA binding. Yeast 15, 473-480.[Medline]
Baker, N. E., Mlodzik, M. and Rubin, G. M. (1990). Spacing differentiation in the developing Drosophila eye: a fibrinogen-related lateral inhibitor encoded by scabrous. Science 250, 1370-1377.
Baker, N. E. and Zitron, A. E. (1995). Drosophila eye development: Notch and Delta amplify a neurogenic pattern conferred on the morphogenetic furrow by scabrous. Mech. Dev. 49, 173-189.[Medline]
Bishop, S. A., Klein, T., Arias, A. M. and Couso, J. P. (1999). Composite signalling from Serrate and Delta establishes leg segments in Drosophila through Notch. Development 126, 2993-3003.[Abstract]
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401-415.[Abstract]
Brand, M. and Campos-Ortega, J. A. (1990). Second-site modifiers of the split mutation of Notch define genes involved in neurogenesis in Drosophila melanogaster. Rouxs Arch. Dev. Biol. 198, 275-285.
Cavener, D. R., Otteson, D. C. and Kaufman, T. C. (1986). A rehabilitation of the genetic map of the 84B-D region in Drosophila melanogaster. Genetics 114, 111-123.
Cavener, D. R. and Ray, S. C. (1991). Eukaryotic start and stop translation sites. Nucleic Acids Res. 19, 3185-3192.
Couso, J. P. and Bishop, S. A. (1998). Proximodistal development in the legs of Drosophila. Int. J. Dev. Biol. 42, 345-352.[Medline]
Ellis, M. C., Weber, U., Wiersdorff, V. and Mlodzik, M. (1994). Confrontation of scabrous expressing and non-expressing cells is essential for normal ommatidial spacing in the Drosophila eye. Development 120, 1959-1969.[Abstract]
Gerber, H. P., Seipel, K., Georgiev, O., Hofferer, M., Hug, M., Rusconi, S. and Schaffner, W. (1994). Transcriptional activation modulated by homopolymeric glutamine and proline stretches. Science 263, 808-811.
Godt, D., Couderc, J. L., Cramton, S. E. and Laski, F. A. (1993). Pattern formation in the limbs of Drosophila: bric a brac is expressed in both a gradient and a wave-like pattern and is required for specification and proper segmentation of the tarsus. Development 119, 799-812.[Abstract]
Gower, N. J., Temple, G. R., Schein, J. E., Marra, M., Walker, D. S. and Baylis, H. A. (2001). Dissection of the promoter region of the inositol 1,4,5-trisphosphate receptor gene, itr-1, in C. elegans: a molecular basis for cell- specific expression of IP3R isoforms. J. Mol. Biol. 306, 145-157.[Medline]
Hamilton, T. B., Borel, F. and Romaniuk, P. J. (1998). Comparison of the DNA binding characteristics of the related zinc finger proteins WT1 and EGR1. Biochemistry 37, 2051-2058.[Medline]
Hart, A. C., Kramer, H., Van Vactor, D. L., Jr., Paidhungat, M. and Zipursky, S. L. (1990). Induction of cell fate in the Drosophila retina: the bride of sevenless protein is predicted to contain a large extracellular domain and seven transmembrane segments. Genes Dev. 4, 1835-1847.
Hay, B. A., Maile, R. and Rubin, G. M. (1997). P element insertion-dependent gene activation in the Drosophila eye. Proc. Natl. Acad. Sci. USA 94, 5195-5200.
Hoemann, C. D., Bergeret, E., Guichard, A. and Griffin-Shea, R. (1996). Alternative splicing of the Drosophila melanogaster rotundRacGAP gene. Gene 168, 135-141.[Medline]
Kerridge, S. and Thomas-Cavallin, M. (1988). Appendage morphogenesis in Drosophila: a developmental study of the rotund (rn) gene. Rouxs Arch. Dev. Biol. 197, 19-26.
Krishnan, S. N., Frei, E., Schalet, A. P. and Wyman, R. J. (1995). Molecular basis of intracistronic complementation in the Passover locus of Drosophila. Proc. Natl. Acad. Sci. USA 92, 2021-2025.
Lanz, R. B., Wieland, S., Hug, M. and Rusconi, S. (1995). A transcriptional repressor obtained by alternative translation of a trinucleotide repeat. Nucleic Acids Res. 23, 138-145.
Li, W., Streit, A., Robertson, B. and Wood, W. B. (1999). Evidence for multiple promoter elements orchestrating male-specific regulation of the her-1 gene in Caenorhabditis elegans. Genetics 152, 237-248.
Licht, J. D., Hanna-Rose, W., Reddy, J. C., English, M. A., Ro, M., Grossel, M., Shaknovich, R. and Hansen, U. (1994). Mapping and mutagenesis of the amino-terminal transcriptional repression domain of the Drosophila Kruppel protein. Mol. Cell Biol. 14, 4057-4066.
Ma, C., Liu, H., Zhou, Y. and Moses, K. (1996). Identification and characterization of autosomal genes that interact with glass in the developing Drosophila eye. Genetics 142, 1199-1213.[Abstract]
Madden, S. L., Cook, D. M. and Rauscher, F. J., 3rd. (1993). A structure-function analysis of transcriptional repression mediated by the WT1, Wilms tumor suppressor protein. Oncogene 8, 1713-1720.[Medline]
Mardon, G., Solomon, N. M. and Rubin, G. M. (1994). dachshund encodes a nuclear protein required for normal eye and leg development in Drosophila. Development 120, 3473-3486.[Abstract]
Mevel-Ninio, M., Terracol, R., Salles, C., Vincent, A. and Payre, F. (1995). ovo, a Drosophila gene required for ovarian development, is specifically expressed in the germline and shares most of its coding sequences with shavenbaby, a gene involved in embryo patterning. Mech. Dev. 49, 83-95.[Medline]
Nakamoto, T., Yamagata, T., Sakai, R., Ogawa, S., Honda, H., Ueno, H., Hirano, N., Yazaki, Y. and Hirai, H. (2000). CIZ, a zinc finger protein that interacts with p130(cas) and activates the expression of matrix metalloproteinases. Mol. Cell Biol. 20, 1649-1658.
Nowling, T. K., Johnson, L. R., Wiebe, M. S. and Rizzino, A. (2000). Identification of the transactivation domain of the transcription factor Sox-2 and an associated co-activator. J. Biol. Chem. 275, 3810-3818.
ONeill, E. M., Rebay, I., Tjian, R. and Rubin, G. M. (1994). The activities of two Ets-related transcription factors required for Drosophila eye development are modulated by the Ras/MAPK pathway. Cell 78, 137-147.[Medline]
Renfranz, P. J. and Benzer, S. (1989). Monoclonal antibody probes discriminate early and late mutant defects in development of the Drosophila retina. Dev. Biol. 136, 411-429.[Medline]
Rougvie, A. E. and Ambros, V. (1995). The heterochronic gene lin-29 encodes a zinc finger protein that controls a terminal differentiation event in Caenorhabditis elegans. Development 121, 2491-2500.[Abstract]
Sepp, K. J. and Auld, V. J. (1999). Conversion of lacZ enhancer trap lines to GAL4 lines using targeted transposition in Drosophila melanogaster. Genetics 151, 1093-1101.
Spradling, A. C. and Rubin, G. M. (1982). Transposition of cloned P-elements into Drosophila germ line chromosomes. Science 218, 341-347.
Tautz, D. and Pfeile, C. (1989). A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma 98, 81-85.[Medline]
Vassin, H., Bremer, K. A., Knust, E. and Campos-Ortega, J. A. (1987). The neurogenic gene Delta of Drosophila melanogaster is expressed in neurogenic territories ans encodes a putative transmembrane protein with EGF-like repeats. EMBO J. 6, 3431-3440.[Medline]
This article has been cited by other articles:
![]() |
M.-L. Dichtel-Danjoy, J. Caldeira, and F. Casares SoxF is part of a novel negative-feedback loop in the wingless pathway that controls proliferation in the Drosophila wing disc Development, March 1, 2009; 136(5): 761 - 769. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Melicharek, A. Shah, G. DiStefano, A. J. Gangemi, A. Orapallo, A. D. Vrailas-Mortimer, and D. R. Marenda Identification of Novel Regulators of atonal Expression in the Developing Drosophila Retina Genetics, December 1, 2008; 180(4): 2095 - 2110. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. del Alamo and M. Mlodzik Self-modulation of Notch signaling during ommatidial development via the Roughened eye transcriptional repressor Development, September 1, 2008; 135(17): 2895 - 2904. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zhao, P. Szafranski, C. A. Hall, and S. Goode Basolateral Junctions Utilize Warts Signaling to Control Epithelial-Mesenchymal Transition and Proliferation Crucial For Migration and Invasion of Drosophila Ovarian Epithelial Cells Genetics, April 1, 2008; 178(4): 1947 - 1971. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Felix, M. Magarinos, and F. J. Diaz-Benjumea Nab controls the activity of the zinc-finger transcription factors Squeeze and Rotund in Drosophila development Development, May 15, 2007; 134(10): 1845 - 1852. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Garces and S. Thor Specification of Drosophila aCC motoneuron identity by a genetic cascade involving even-skipped, grain and zfh1 Development, April 15, 2006; 133(8): 1445 - 1455. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Cho and K. D. Irvine Action of fat, four-jointed, dachsous and dachs in distal-to-proximal wing signaling Development, September 15, 2004; 131(18): 4489 - 4500. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Raymond, E. Bergeret, A. Avet-Rochex, R. Griffin-Shea, and M.-O. Fauvarque A screen for modifiers of RacGAP(84C) gain-of-function in the Drosophila eye revealed the LIM kinase Cdi/TESK1 as a downstream effector of Rac1 during spermatogenesis J. Cell Sci., June 1, 2004; 117(13): 2777 - 2789. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakamoto, A. Shiratsuchi, H. Oda, K. Inoue, T. Matsumura, M. Ichikawa, T. Saito, S. Seo, K. Maki, T. Asai, et al. Impaired spermatogenesis and male fertility defects in CIZ/Nmp4-disrupted mice Genes Cells, June 1, 2004; 9(6): 575 - 589. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. de Celis Ibeas and S. J. Bray Bowl is required downstream of Notch for elaboration of distal limb patterning Development, December 15, 2003; 130(24): 5943 - 5952. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kolzer, B. Fuss, M. Hoch, and T. Klein defective proventriculus is required for pattern formation along the proximodistal axis, cell proliferation and formation of veins in the Drosophila wing Development, September 1, 2003; 130(17): 4135 - 4147. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Butler, T. L. Jacobsen, D. M. Cain, M. G. Jarman, M. Hubank, J. R. S. Whittle, R. Phillips, and A. Simcox Discovery of genes with highly restricted expression patterns in the Drosophila wing disc using DNA oligonucleotide microarrays Development, February 15, 2003; 130(4): 659 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. d. A. Rodriguez, J. Terriente, M. I. Galindo, J. P. Couso, and F. J. Diaz-Benjumea Different mechanisms initiate and maintain wingless expression in the Drosophila wing hinge Development, September 1, 2002; 129(17): 3995 - 4004. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Galindo, S. A. Bishop, S. Greig, and J. P. Couso Leg Patterning Driven by Proximal-Distal Interactions and EGFR Signaling Science, July 12, 2002; 297(5579): 256 - 259. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||