|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||

1 Department of Molecular, Cellular and Developmental Biology and
2 Department of Ecology and Evolutionary Biology, Yale University, P.O. Box 208104, New Haven, CT 06520, USA
* Present address: Section of Molecular and Cellular Biology, University of California, 1 Shields Avenue, Davis, CA 95616, USA
Author for correspondence (e-mail: vivian.irish{at}yale.edu)
Accepted 14 February 2002
| SUMMARY |
|---|
|
|
|---|
Key words: APETALA3, LEAFY, APETALA1, Floral homeotic gene, Meristem identity gene, Transcriptional regulation, Arabidopsis thaliana
| INTRODUCTION |
|---|
|
|
|---|
In turn, the development of floral structures depends on the action of three classes of floral homeotic genes, A, B and C. These ABC floral homeotic genes function in overlapping domains to specify different floral organ identities. AP1, in addition to its role as a meristem identity gene, has a second role as an A class gene and is required for the development of sepal and petal primordia (Bowman et al., 1993
; Irish and Sussex, 1990
; Mandel et al., 1992
). The B class genes APETALA3 (AP3) and PISTILLATA (PI) specify petal and stamen identities (Bowman et al., 1989
; Goto and Meyerowitz, 1994
; Jack et al., 1992
), while AGAMOUS (AG), the C class gene, is responsible for conferring stamen and carpel identities (Bowman et al., 1989
; Yanofsky et al., 1990
). To a large extent, the functions of these ABC genes in specifying different organ identities correspond to their domains of expression in the developing flower (Riechmann and Meyerowitz, 1997
; Weigel and Meyerowitz, 1994
).
LFY is required for the transcription of representatives of all three classes of ABC genes (Weigel and Meyerowitz, 1993
). LFY encodes a nuclear-localized product that can bind to DNA and so could act directly to regulate transcription of the floral homeotic genes (Parcy et al., 1998
). In fact, LFY protein has been demonstrated to bind to sequences in the AP1 and AG enhancer regions that are required for normal levels of expression from these genes (Busch et al., 1999
; Parcy et al., 1998
). Ectopic expression of LFY is sufficient to induce the expression of AP1 outside the flower (Parcy et al., 1998
). Furthermore, the activation of early AP1 expression by LFY is not dependent on protein synthesis, demonstrating that LFY is a direct transcriptional activator of AP1 (Wagner et al., 1999
). While ectopic expression of LFY is insufficient to ectopically activate AG, expression of a dominant, activated form of LFY, LFY:VP16, can induce AG expression in vegetative tissues (Parcy et al., 1998
). These observations suggest that AG expression does not depend on LFY alone, but the requirement of other factors for AG activation can be bypassed by LFY:VP16 (Parcy et al., 1998
). One such factor is the WUSCHEL (WUS) homeodomain protein, which cooperatively interacts with LFY to regulate AG expression (Lenhard et al., 2001
; Lohmann et al., 2001
).
The effects of LFY on AP3 expression are more complex. LFY is required for AP3 expression, since a loss-of-function lfy-6 mutant shows a dramatic reduction in the levels and domain of AP3 activation (Weigel and Meyerowitz, 1993
). However, ectopic expression of either LFY or LFY:VP16 does not significantly affect AP3 expression (Parcy et al., 1998
). These observations suggest that the regulation of AP3 is considerably different from that of AP1 or AG, and that LFY may not directly activate AP3 expression. Alternatively, LFY activation of AP3 may occur directly by binding to the AP3 promoter, but other cofactors may be required for transcriptional activation to ensue.
AP1 has also been implicated in the regulation of AP3 gene expression. AP1 encodes a MADS-domain containing protein that binds to sequences in the AP3 promoter that are required for normal AP3 expression (Hill et al., 1998
; Tilly et al., 1998
). While AP3 expression is almost normal in ap1 mutant flowers, plants containing both the strong lfy-6 and ap1-1 alleles show a complete abolition of AP3 expression, reflecting the synergistic action of both LFY and AP1 in activating AP3 expression (Weigel and Meyerowitz, 1993
). Furthermore, plants containing an activated form of AP1, AP1:VP16, display a partial transformation of medial first whorl organs into petals that is dependent on AP3 function, supporting the idea that AP1 positively regulates AP3 (Ng and Yanofsky, 2001
).
In order to begin to dissect the molecular mechanisms by which these meristem identity genes function, we have analyzed the role of LFY and AP1 in regulating AP3 transcription. Previously, we have shown that the AP3 promoter contains distinct cis-acting elements that are required for the different spatial and temporal aspects of AP3 expression (Hill et al., 1998
; Tilly et al., 1998
). Here we show that LFY protein can bind to sequences within the AP3 promoter that are required for early AP3 expression. Furthermore, using an inducible form of LFY, we show that LFY acts both directly and indirectly to regulate AP3 expression, and that the indirect pathway depends on the function of the AP1 floral homeotic gene. Mutations of the LFY binding site in the AP3 promoter fail to abrogate AP3 expression in planta, suggesting that the indirect pathway may be sufficient to induce AP3 expression in this context. Based on these observations, we propose a model for how these meristem identity genes act together to activate the expression of the AP3 floral homeotic gene.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Electrophoretic mobility shift assays
Proteins for EMSA were produced by in vitro transcription of the LFY cDNA which was translated in vitro using wheat germ extract (Promega, Madison, WI). Preparation of DNA probes, binding reactions, and gel conditions were as described previously (Hill et al., 1998
). Fragments used for cold competitors in the binding reactions corresponded to the following sequences within the AP3 promoter and were generated by polymerase chain reaction (PCR): competitor 1, 727 to 554; competitor 2, 705 to 587; competitor 3, 662 to 554; competitor 4 727 to 626; competitor 5, 618 to 554; competitor 6, 727 to 678. Competitors were cleaned by ammonium acetate precipitation, quantitated, then added to the binding reaction in amounts of 10,000-fold molar excess over labeled probe. The following oligos were annealed with their complimentary oligos and cloned into the EcoRV site of the pBluescript SKII+ vector (Stratagene, La Jolla, CA): AP3I (site I), 5'-CTT AAA CCC TAG GGG TAA TA-3'; AP3Im, 5'-CTT AAA CCC TAT TATTAA TA-3'; AP3II (site II), 5'-TTC TAT TTT CCA AGG ATC TTT AGT TAA AGG C-3'; AP3IIm, 5'-TTC TAT TTT CCA ATT ATC TTT AGT TAA AGG C-3'; AP3I-II, 5'-CTT AAA CCC TAG GGG TAA TAT TCT ATT TTC CAA GGA TCT TTA GTT AAA GGC-3'; AP3Im-II, 5'-CTT AAA CCC TAT TAT TAA TAT TCT ATT TTC CAA GGA TCT TTA GTT AAA GGC-3'; AP3I-IIm, 5'-CTT AAA CCC TAG GGG TAA TAT TCT ATT TTC CAA TTA TCT TTA GTT AAA GGC-3'; AP3Im-IIm, 5'-CTT AAA CCC TAT TAT TAA TAT TCT ATT TTC CAA TTA TCT TTA GTT AAA GGC-3'. Mutated sequences are shown in bold. These fragments were released from the vector using HindIII and EcoRI to produce gel shift probes.
Yeast one hybrid assays
An in frame GAL4AD:LFY fusion was created in the pGAD424 vector and transformed into yeast strain YM4271. The DEE promoter fragment was trimerized and cloned into the EcoRI site of the placZi vector resulting in trimers fused in both the + and orientations with respect to the lacZ reporter gene. The DEE-lacZ fusions were then integrated into the yeast strain YM4271 containing the GAL4AD:LFY construct. Yeast transformation protocols, yeast vectors and yeast strains were obtained from Clontech (Palo Alto, CA). To determine lacZ expression, yeast colonies were grown on selection medium for 2 days, and then 1 ml of the culture was resuspended in 2 ml of YPD and grown at 30°C. After 3-4 hours, the OD600 of the culture was measured, and 1 ml of the culture was spun down and resuspended in 800 µl of Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 50 mM 2-mercaptoethanol, pH 7). One drop of 0.1% SDS and 2 drops of chloroform were added to each tube to lyse the cells. The suspension was then equilibrated at 30°C for 15 minutes. Subsequently, 160 µl of 4 mg/ml ONPG (Sigma, St. Louis, MO) was added, and the reaction was allowed to take place for 2 hours. The reaction was stopped with 400 µl of 1 M sodium carbonate, and the OD420 and OD550 of the suspension was noted. The units of ß-gal activity were calculated using the following formula: U=1000 x [(OD420) (1.75 x OD550)]/[time (minutes) x OD600]. Replicate assays were conducted using five colonies of each construct tested per assay, and similar results were obtained in all assays.
Plasmid constructions for plant transformation
The mutated promoter constructs were generated using PCR from plasmids p5D3, pD3-36 and pD3-18 (Hill et al., 1998
) using the primers AP3IM-II, AP3I-IIM or AP3IM-IIM and vector primers. The resulting products were cloned into the TOPO TA vector (Invitrogen, Carlsbad, CA) and sequenced. In frame translational fusions at the ATG of the mutated AP3 promoter constructs and the GUS reporter gene were created by cloning the various promoter constructs into the SalI and BamHI sites of pBI101 (Clontech, Palo Alto, CA). Expression constructs were transferred to Agrobacterium tumefaciens strain GV3101 by electroporation.
Chemical treatments and real time RT-PCR conditions
Dexamethasone (DEX; Sigma, St. Louis, MO) was dissolved in ethanol and used at a final concentration of 1 µM on seedlings. For inhibition of protein synthesis, 10 µM cyclohexamide (CHX; Sigma, St Louis, MO) was added simultaneously with the DEX treatment. For seedling treatments, wild-type or transgenic seedlings were grown for 5 days on growth medium then transferred to media containing either DEX or DEX/CHX for 16 hours. For inflorescence treatments, plants were grown on soil under long day conditions (16 hours light, 8 hours dark). The primary bolt was cut 1-2 days after the start of bolting and after 24-48 hours individual inflorescences were treated with 5 µM DEX, 10 µM CHX, or DEX/CHX as described previously (Wagner et al., 1999
). RNA was extracted from seedlings and inflorescences using Trizol (GibcoBRL, Frederick, MD) according to the manufacturers instructions. cDNA was synthesized using Superscript II RNase-Reverse Transcriptase (Invitrogen, Carlsbad, CA) according to the manufacturers instructions. Real time PCR reactions were carried out using an ABI Prism 7000 Sequence Detector (Applied Biosystems, Foster City, CA) in MicroAmp Optical 96-well reaction plates with optical covers, according to manufacturers instructions. PCR reactions (final volume 50 µl) contained TaqManMGB gene-specific probe and primers and the passive reference dye ROX, in order to normalize fluorescence across the plate. In all experiments, controls without template were used and at least two replicates using at least two independent RNA samples were used. AP3-specific TaqManMGB probe was conjugated to the fluorescent dye JOE and AP1-specific TaqManMGB probe was conjugated to the fluorescent dye FAM. Reaction conditions were: 50°C for 2 minutes, 94°C for 10 minutes, followed by 40 cycles of 94°C for 15 seconds, 60°C for 1 minute. Primers and probes were designed using Primer Express software (Applied Biosystems, Foster City, CA) to flank introns so genomic DNA contamination would not amplify. AP3 primers: AP3F 5' CCACCAGAACCATCACCACTATT; AP3R 5' GTCAGAGGCAGAGGGTGCAT. AP3 TaqManMGB probe: 5' CCCAACCATGGCCTT. AP1 primers: AP1F 5' TGAGCTGGAACTAAGAGCTGAAGA; AP1R 5' AACTGAGTCGTAATCTCCTCCATTG. AP1 TaqManMGB Probe: 5' CCTCACTATGGACTACTAG. Relative quantification values and standard deviations were calculated using the standard curve method according to the manufacturers instructions (ABI Prism 7000 Sequence Detection System User Guide). Values were normalized to the mock treated sample and results analyzed with Microsoft Excel software.
| RESULTS |
|---|
|
|
|---|
|
|
|
This 52 bp sequence could be divided into two regions, termed site I (corresponding to basepairs 678 to 658) and site II (657 to 626), each of which showed some sequence similarity to the LFY binding sequences found in the regulatory regions of the AP1 and AG genes (Fig. 3B). These two sites each contain a palindromic sequence that overlaps the putative LFY binding sites. Mutated versions of site I and site II were generated that disrupted both the palindromic sequences and the presumptive LFY binding sites (Fig. 3B). We tested the ability of LFY to bind to these sites by assaying the wild-type and mutated versions of each site either individually or within the same 52 bp DNA fragment using several assay systems. First, we checked the ability of these sequences to bind to LFY in yeast one-hybrid assays (Fig. 3C). Trimerized versions of wild-type or mutated site I and/or site II sequences were fused to the lacZ coding sequence and introduced into the yeast genome; these strains were assayed for lacZ expression in the presence of a LFY-GAL4 activation domain (LFY-AD) fusion gene product. In addition, the wild-type and mutated oligonucleotide sequences were used in EMSAs to test their ability to bind to LFY (Fig. 3D). Both these assays gave similar results and indicated that site I is necessary and sufficient for LFY binding, while the site II sequence alone is not sufficient. However, LFY cannot bind when site II is mutated in the context of the entire fragment, indicating that intact site II is required for LFY binding in this context. This may reflect a requirement for a particular DNA conformation for LFY binding.
LFY can act in both a direct and an indirect manner to activate AP3 expression
We assessed whether LFY acts directly or indirectly to activate AP3 transcription in vivo by utilizing a ubiquitously expressed inducible form of LFY, 35S::LFY-GR (Wagner et al., 1999
) to induce AP3 expression in several contexts in the presence or absence of the protein synthesis inhibitor, cyclohexamide (CHX). The LFY-GR fusion protein is localized to the cytoplasm and thus is inactive, but can be induced to localize to the nucleus and function by treatment of plants with dexamethasone (DEX) (Wagner et al., 1999
).
Because AP3 is not normally expressed in seedlings, we took advantage of the fact that constitutive expression of LFY in conjunction with UFO results in ectopic AP3 transcription in seedlings (Parcy et al., 1998
). Inducing LFY expression at the seedling stage provides an ideal way to directly assess the effects of LFY expression on AP3 transcriptional activation. 35S::LFY-GR; 35S::UFO seedlings were grown without DEX for 5 days, then treated with 1 µM DEX. Upon DEX treatment, these seedlings arrest their normal development, but recover if DEX is removed. The 35S::LFY-GR; 35S::UFO seedlings were treated with DEX alone, or concomitantly with 10 µM CHX at day 5, and seedling tissue was harvested after 16 hours of treatment and examined for levels of AP3 expression. The relative levels of AP3 expression with the various treatments were assessed using a quantitative real time reverse transcription PCR (RT-PCR) approach. The treatment of 35S::LFY-GR; 35S::UFO seedlings with DEX posttranslationally activated LFY and resulted in induction of AP3 expression (Fig. 4A). CHX treatment somewhat reduced the levels of AP3 expression in these DEX-induced seedlings, but these levels are significantly above that of seedlings treated with CHX alone (Fig. 4A). These observations indicate that part of the LFY-dependent activation of AP3 expression in the seedling requires protein synthesis, and implies that the activation of AP3 by LFY in this context is indirect. In addition, the fact that we could observe significant levels of AP3 expression in these DEX/CHX-treated seedlings indicates that LFY can also function in a direct manner to activate AP3 expression.
|
Since LFY directly activates AP1 expression in seedlings, we examined whether LFY-dependent expression of AP3 required AP1 activity. 35S::LFY; 35S::UFO; ap1-1 seedlings were examined for the presence of AP3 transcripts using quantitative real time RT-PCR. An examination of the relative levels of AP3 ectopic activation in a 35S::LFY; 35S::UFO; ap1-1 background, as compared to a 35S::LFY; 35S::UFO background indicates that overall levels of AP3 expression are significantly reduced when AP1 function is absent (Fig. 4C). However, some AP3 expression is still detectable in the 35S::LFY; 35S::UFO; ap1-1 seedlings, supporting the idea that LFY can act independently of AP1, and presumably directly, to activate AP3 transcription.
We also examined AP3 expression induced by 35S::LFY-GR in floral tissue. DEX application to young 35S::LFY-GR flower buds did not induce AP3 expression above endogenous levels (data not shown). In order to eliminate AP3 expression dependent on endogenous LFY-dependent pathways, we examined the induction of AP3 expression in a 35S::LFY-GR; lfy-6/lfy-6 background. In these flower buds, DEX application induced AP3 expression, and simultaneous DEX/CHX application somewhat reduced AP3 expression, but did not abrogate this expression completely (Fig. 4D). This is similar to what we observed in 35S::LFY-GR, 35S::UFO seedlings (Fig. 4A) and implies that LFY can act in both a direct and an indirect manner to activate AP3 expression in flowers. As a control, we also examined the levels of AP1 expression induced in 35S::LFY-GR; lfy-6/lfy-6 flowers (Fig. 4E). Similar to what has been observed previously, LFY appears to act directly to activate AP1 transcription in these tissues (Wagner et al., 1999
).
To determine whether LFY-dependent induction of AP3 depended on AP1 activity in flowers, we examined the levels of AP3 expression in 35S::LFY-GR; ap1-1/ap1-1 flower buds. DEX treatment of 35S::LFY-GR; ap1-1/ap1-1 plants (Fig. 4F) resulted in levels of AP3 expression that were higher than the level produced in the presence of DEX and CHX, indicating that LFY can act via an AP1-independent indirect pathway to activate AP3 expression in the flower.
Intact LFY binding sites at the DEE are not required for AP3 expression in planta
Because our real time RT-PCR results indicated that LFY acts in both a direct and an indirect manner to regulate AP3 transcription, we chose to test the significance of the in vitro defined LFY binding sites in planta. We generated transgenic plants in which site I and/or site II sequences were mutated in the context of several diagnostic AP3 promoter constructs (Fig. 1). The same site I and/or site II mutations used in the EMSA and yeast-one hybrid assays were introduced into the 5D3 and the D3-18 (lacking the PEE but containing the DEE) AP3 promoter constructs (Fig. 1) and fused to the GUS reporter gene. These mutated reporter gene constructs were stably transformed into Arabidopsis plants, and at least three independent single insertion lines for each construct were analyzed for reporter gene expression in flowers. We also examined the expression of these reporter constructs in 35S::LFY; 35S::UFO seedlings. Mutation of sites I and II individually, or of both sites simultaneously, has no obvious effect on reporter gene expression in either the wild-type or 35S::LFY; 35S::UFO backgrounds (Fig. 5 and data not shown). This is quite surprising in the case of the site I and site II mutated D3-18 construct, since this construct is mutated for the LFY binding site in DEE as well as being deleted for the PEE, the other promoter region required for stage 3-5 AP3 expression (Hill et al., 1998
). Based on these observations, these results suggest that LFY-dependent activation of AP3 does not require that the identified LFY binding site be intact.
|
| DISCUSSION |
|---|
|
|
|---|
A model for regulation of AP3
Based on our results, we propose a model for LFY and AP1 activation of AP3 transcription (Fig. 6). We suggest that there are at least four separate pathways that regulate the onset of AP3 expression in the flower.
|
The second LFY-dependent pathway we have defined is indirect and depends on the activity of AP1 to activate AP3 transcription. Loss of AP1 function significantly reduces the level of AP3 transcription that can be induced by LFY action (Fig. 4C). AP1 has been previously shown to be a positive regulator of AP3 (Hill et al., 1998
; Krizek and Meyerowitz, 1996
; Ng and Yanofsky, 2001
; Weigel and Meyerowitz, 1993
). Since LFY directly activates AP1 (this work) (Wagner et al., 1999
), and AP1 has been shown to bind to sequences within the PEE (Hill et al., 1998
), this short regulatory cascade may activate transcription through the PEE sequences. LFY direct activation of AP1 expression appears to be limited to early stages of floral development, when the pattern of AP1 expression is largely coincident with that of LFY in the floral meristem (Parcy et al., 1998
; Wagner et al., 1999
). At later stages, spatially restricted AP1 expression depends on other factors, which may include AG (Gustafson-Brown et al., 1994
; Parcy et al., 1998
; Wagner et al., 1999
).
The fact that mutation of AP1 does not completely abolish LFY-dependent expression of AP3 suggests that LFY also regulates AP3 via a third pathway that is independent of AP1 (Fig. 4F). This appears to be an indirect pathway of activation via an unknown factor X (Fig. 6). This indirect pathway potentially could depend on the products of the CAULIFLOWER (CAL) and FRUITFULL (FUL) genes, which are both paralogs of AP1 and appear to have overlapping functions (Ferrandiz et al., 2000
); and so may act in a partially redundant fashion to weakly activate AP3 in the absence of AP1.
A number of other identified genes are also candidates for being involved in this third, LFY-dependent indirect pathway of AP3 activation. One such gene is UFO, which has been shown to encode a region-specific factor that is required in conjunction with LFY to activate AP3 (Lee et al., 1997
). UFO does not appear to have DNA binding activity, and so presumably does not act as part of the transcriptional machinery (data not shown). It is more likely that UFO acts as part of an SCF (SKP1-Cullin-F-box) complex and targets specific proteins for ubiquitin-dependent degradation, since UFO encodes an F-box containing protein that has been shown to interact with SKP1-like gene products (Bai et al., 1996
; Ingram et al., 1995
; Samach et al., 1999
). This postulated role of UFO has led to a model whereby UFO acts to promote the degradation of a putative negative regulator of AP3 (Samach et al., 1999
). One possibility to explain the role of UFO in the indirect pathway regulating AP3 expression would be that LFY activates the transcription of the putative negative regulator while UFO acts to target it for degradation.
At least one other candidate gene has been identified which may act in this LFY-dependent indirect pathway activating AP3 transcription. A myb-domain containing DNA binding protein has recently been identified that binds to AP3 promoter sequences and appears to act as a positive regulator of AP3 transcription in vivo (C. Juarez, E. Chae, Q. K.-G. T. and V. F. I., unpublished data).
Finally, a fourth pathway that is independent of LFY can be defined, which requires an as yet unidentified factor or factors (Y, Fig. 6). Low levels of AP3 expression are detectable at the base of the second and third whorls in lfy-6 mutant plants, indicating that not all AP3 expression is dependent on LFY function (Fig. 2). This pathway also appears to be independent of UFO as well as ASK1, a putative subunit of a UFO-containing SCF ubiquitin ligase complex, since mutations in either UFO or ASK1 still result in AP3 expression at the base of the second and third whorls (Levin and Meyerowitz, 1995
; Zhao et al., 2001
).
Floral homeotic gene regulation by LFY
LFY has now been implicated in activating the transcription of representatives of all three A, B, and C classes of floral homeotic genes (Busch et al., 1999
; Wagner et al., 1999
; Weigel and Meyerowitz, 1993
) (this work). Despite this global control of floral homeotic gene expression by LFY, each of these organ identity genes is expressed in a different spatially limited domain, implying that LFY acts in conjunction with other factors to delimit ABC gene activation. Our results suggest that LFY acts to regulate expression of AP3 in a manner distinct from that of AP1 or AG. The multiple AP3 regulatory pathways we have defined could act as a failsafe mechanism to ensure appropriate expression of AP3 and may reflect a requirement for the strict temporal control of expression of this floral homeotic gene. In light of these results, it seems likely that there are multiple complex regulatory interactions that serve to reinforce the precise spatial and temporal control of floral homeotic gene expression, which in turn is critical for normal floral patterning.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bai, C., Sen, P., Hofmann, P., Ma, L., Goebl, M., Harper, J. W. and Elledge, S. J. (1996). SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box. Cell 86, 263-274.[Medline]
Bowman, J. L., Alvarez, J., Weigel, D., Meyerowitz, E. M. and Smyth, D. R. (1993). Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development 119, 721-743.
Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M. (1989). Genes directing flower development in Arabidopsis. Plant Cell 1, 37-52.
Busch, M. A., Bomblies, K. and Weigel, D. (1999). Activation of a floral homeotic gene in Arabidopsis. Science 285, 585-587.
Clough, S. J. and Bent, A. F. (1998). Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735-743.[Medline]
Ferrandiz, C., Gu, Q., Martienssen, R. and Yanofsky, M. F. (2000). Redundant regulation of meristem identity and plant architecture by FRUITFULL, APETALA1 and CAULIFLOWER. Development 127, 725-734.[Abstract]
Goto, K. and Meyerowitz, E. M. (1994). Function and regulation of the Arabidopsis floral homeotic gene PISTILLATA. Genes Dev. 8, 1548-1560.
Gustafson-Brown, C., Savidge, B. and Yanofsky, M. F. (1994). Regulation of the Arabidopsis homeotic gene APETALA1. Cell 76, 131-143.[Medline]
Hill, T. A., Day, C. D., Zondlo, S. C., Thackeray, A. G. and Irish, V. F. (1998). Discrete spatial and temporal cis-acting elements regulate transcription of the Arabidopsis floral homeotic gene APETALA3. Development 125, 1711-1721.[Abstract]
Ingram, G. C., Goodrich, J., Wilkinson, M. D., Simon, R., Haughn, G. W. and Coen, E. S. (1995). Parallels between UNUSUAL FLORAL ORGANS and FIMBRIATA, genes controlling flower development in Arabidopsis and Antirrhinum. Plant Cell 7, 1501-1510.[Abstract]
Irish, V. F. and Sussex, I. M. (1990). Function of the apetala-1 gene during Arabidopsis floral development. The Plant Cell 2, 741-753.
Jack, T., Brockman, L. L. and Meyerowitz, E. M. (1992). The homeotic gene APETALA3 of Arabidopsis thaliana encodes a MADS box and is expressed in petals and stamens. Cell 68, 683-697.[Medline]
Krizek, B. A. and Meyerowitz, E. M. (1996). The Arabidopsis homeotic genes APETALA3 and PISTILLATA are sufficient to provide the B class organ identity function. Development 122, 11-22.[Abstract]
Lee, I., Wolfe, D. S., Nilsson, O. and Weigel, D. (1997). A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS. Curr. Biol. 7, 95-104.[Medline]
Lenhard, M., Bohnert, A., Jürgens, G. and Laux, T. (2001). Termination of stem cell maintenance in Arabidopsis Floral meristems by interactions between WUSCHEL and AGAMOUS. Cell 105, 805-814.[Medline]
Levin, J. Z. and Meyerowitz, E. M. (1995). UFO: an Arabidopsis gene involved in both floral meristem and floral organ development. Plant Cell 7, 529-548.[Abstract]
Lohmann, J. U., Hong, R. L., Hobe, M., Busch, M. A., Parcy, F., Simon, R. and Weigel, D. (2001). A molecular link between stem cell regulation and floral patterning in Arabidopsis. Cell 105, 793-803.[Medline]
Mandel, M. A., Gustafson-Brown, C., Savidge, B. and Yanofsky, M. F. (1992). Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature 360, 273-277.[Medline]
Mandel, M. A. and Yanofsky, M. F. (1995). A gene triggering flower formation in Arabidopsis. Nature 377, 522-524.[Medline]
Ng, M. and Yanofsky, M. F. (2001). Activation of the Arabidopsis B class homeotic genes by APETALA1. Plant Cell 13, 739-753.
Parcy, F., Nilsson, O., Busch, M. A., Lee, I. and Weigel, D. (1998). A genetic framework for floral patterning. Nature 395, 561-566.[Medline]
Riechmann, J. L. and Meyerowitz, E. M. (1997). MADS domain proteins in plant development. Biol. Chem. 378, 1079-1101.
Samach, A., Klenz, J. E., Kohalmi, S. E., Risseeuw, E., Haughn, G. W. and Crosby, W. L. (1999). The UNUSUAL FLORAL ORGANS gene of Arabidopsis thaliana is an F-box protein required for normal patterning and growth in the floral meristem. Plant J. 20, 433-445.[Medline]
Tilly, J., Allen, D. W. and Jack, T. (1998). The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects. Development 125, 1647-1657.[Abstract]
Wagner, D., Sablowski, R. W. M. and Meyerowitz, E. M. (1999). Transcriptional activation of APETALA1 by LEAFY. Science 285, 582-584.
Weigel, D., Alvarez, J., Smyth, D. R., Yanofsky, M. F. and Meyerowitz, E. M. (1992). LEAFY controls floral meristem identity in Arabidopsis. Cell 69, 843-859.[Medline]
Weigel, D. and Meyerowitz, E. M. (1993). Activation of floral homeotic genes in Arabidopsis. Science 261, 1723-1726.
Weigel, D. and Meyerowitz, E. M. (1994). The ABCs of floral homeotic genes. Cell 78, 203-209.[Medline]
Weigel, D. and Nilsson, O. (1995). A developmental switch sufficient for flower initiation in diverse plants. Nature 377, 495-500.[Medline]
Yanofsky, M. F., Ma, H., Bowman, J. L., Drews, G. N., Feldmann, K. A. and Meyerowitz, E. M. (1990). The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors. Nature 346, 35-39.[Medline]
Zhao, D., Yu, Q., Chen, M. and Ma, H. (2001). The ASK1 gene regulates B function gene expression in cooperation with UFO and LEAFY in Arabidopsis. Development 128, 2735-2746.
This article has been cited by other articles:
![]() |
S. D. Roy, M. Saxena, and N. Bhalla-Sarin Overexpression of AtLEAFY Accelerates Flowering in Brassica juncea Crop Sci., May 11, 2009; 49(3): 930 - 936. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Hileman and V. F. Irish More is better: the uses of developmental genetic data to reconstruct perianth evolution Am. J. Botany, January 1, 2009; 96(1): 83 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Chuck, R. Meeley, and S. Hake Floral meristem initiation and meristem cell fate are regulated by the maize AP2 genes ids1 and sid1 Development, September 15, 2008; 135(18): 3013 - 3019. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Mara and V. F. Irish Two GATA Transcription Factors Are Downstream Effectors of Floral Homeotic Gene Action in Arabidopsis Plant Physiology, June 1, 2008; 147(2): 707 - 718. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Chae, Q. K.-G. Tan, T. A. Hill, and V. F. Irish An Arabidopsis F-box protein acts as a transcriptional co-factor to regulate floral development Development, April 1, 2008; 135(7): 1235 - 1245. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Guo, J. Thomas, G. Collins, and M. C.P. Timmermans Direct Repression of KNOX Loci by the ASYMMETRIC LEAVES1 Complex of Arabidopsis PLANT CELL, January 1, 2008; 20(1): 48 - 58. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Rotem, E. Shemesh, Y. Peretz, F. Akad, O. Edelbaum, H. D. Rabinowitch, I. Sela, and R. Kamenetsky Reproductive development and phenotypic differences in garlic are associated with expression and splicing of LEAFY homologue gaLFY J. Exp. Bot., March 1, 2007; 58(5): 1133 - 1141. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Megraw, V. Baev, V. Rusinov, S. T. Jensen, K. Kalantidis, and A. G. Hatzigeorgiou MicroRNA promoter element discovery in Arabidopsis RNA, September 1, 2006; 12(9): 1612 - 1619. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Gregis, A. Sessa, L. Colombo, and M. M. Kater AGL24, SHORT VEGETATIVE PHASE, and APETALA1 Redundantly Control AGAMOUS during Early Stages of Flower Development in Arabidopsis PLANT CELL, June 1, 2006; 18(6): 1373 - 1382. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Saddic, B. Huvermann, S. Bezhani, Y. Su, C. M. Winter, C. S. Kwon, R. P. Collum, and D. Wagner The LEAFY target LMI1 is a meristem identity regulator and acts together with LEAFY to regulate expression of CAULIFLOWER Development, May 1, 2006; 133(9): 1673 - 1682. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Aagaard, R. G. Olmstead, J. H. Willis, and P. C. Phillips Duplication of floral regulatory genes in the Lamiales Am. J. Botany, August 1, 2005; 92(8): 1284 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Niinuma, N. Someya, M. Kimura, I. Yamaguchi, and H. Hamamoto Circadian Rhythm of Circumnutation in Inflorescence Stems of Arabidopsis Plant Cell Physiol., August 1, 2005; 46(8): 1423 - 1427. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Maizel, M. A. Busch, T. Tanahashi, J. Perkovic, M. Kato, M. Hasebe, and D. Weigel The Floral Regulator LEAFY Evolves by Substitutions in the DNA Binding Domain Science, April 8, 2005; 308(5719): 260 - 263. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tanahashi, N. Sumikawa, M. Kato, and M. Hasebe Diversification of gene function: homologs of the floral regulator FLO/LFY control the first zygotic cell division in the moss Physcomitrella patens Development, April 1, 2005; 132(7): 1727 - 1736. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gomez-Mena, S. de Folter, M. M. R. Costa, G. C. Angenent, and R. Sablowski Transcriptional program controlled by the floral homeotic gene AGAMOUS during early organogenesis Development, February 1, 2005; 132(3): 429 - 438. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Lee, S. F. Baum, J. Alvarez, A. Patel, D. H. Chitwood, and J. L. Bowman Activation of CRABS CLAW in the Nectaries and Carpels of Arabidopsis PLANT CELL, January 1, 2005; 17(1): 25 - 36. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Champagne and N. Sinha Compound leaves: equal to the sum of their parts? Development, September 15, 2004; 131(18): 4401 - 4412. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jack Molecular and Genetic Mechanisms of Floral Control PLANT CELL, June 1, 2004; 16(suppl_1): S1 - S17. [Full Text] [PDF] |
||||
![]() |
D. A. William, Y. Su, M. R. Smith, M. Lu, D. A. Baldwin, and D. Wagner Genomic identification of direct target genes of LEAFY PNAS, February 10, 2004; 101(6): 1775 - 1780. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Kramer, M. A. Jaramillo, and V. S. Di Stilio Patterns of Gene Duplication and Functional Evolution During the Diversification of the AGAMOUS Subfamily of MADS Box Genes in Angiosperms Genetics, February 1, 2004; 166(2): 1011 - 1023. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chujo, Z. Zhang, H. Kishino, K. Shimamoto, and J. Kyozuka Partial Conservation of LFY Function between Rice and Arabidopsis Plant Cell Physiol., December 15, 2003; 44(12): 1311 - 1319. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schmid, N. H. Uhlenhaut, F. Godard, M. Demar, R. Bressan, D. Weigel, and J. U. Lohmann Dissection of floral induction pathways using global expression analysis Development, December 15, 2003; 130(24): 6001 - 6012. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-Y. Tzeng, C.-C. Hsiao, P.-J. Chi, and C.-H. Yang Two Lily SEPALLATA-Like Genes Cause Different Effects on Floral Formation and Floral Transition in Arabidopsis Plant Physiology, November 1, 2003; 133(3): 1091 - 1101. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li and X. Chen PAUSED, a Putative Exportin-t, Acts Pleiotropically in Arabidopsis Development But Is Dispensable for Viability Plant Physiology, August 1, 2003; 132(4): 1913 - 1924. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, S. Feng, N. Nakayama, W. L. Crosby, V. Irish, X. W. Deng, and N. Wei The COP9 Signalosome Interacts with SCFUFO and Participates in Arabidopsis Flower Development PLANT CELL, May 1, 2003; 15(5): 1071 - 1082. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||