|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||


1 Hubrecht Laboratory, Netherlands Institute for Developmental Biology, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands
2 Howard Florey Institute of Experimental Physiology and Medicine, University of Melbourne, Australia
3 Department of Biochemistry, University of Leicester, Leicester LE1 7RH, UK
4 Department of Molecular Cell Biology, Max Planck Institute for Biophysical Chemistry, D-37077 Göttingen, Germany
* Present address: Institute of Hematology, Erasmus University, Dr Molewaterplein 50, 3015 GR, Rotterdam, The Netherlands
Present address: Unité de Biologie Moléculaire du Développement, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France
Author for correspondence (e-mail: jacqueli{at}niob.knaw.nl)
Accepted 12 February 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Mouse Cdx genes, Hox genes, Anteroposterior patterning, Axial elongation
| INTRODUCTION |
|---|
|
|
|---|
Cdx1 starts to be expressed at the late primitive streak stage (day 7.2) in ectodermal and mesodermal cells of the primitive streak (Meyer and Gruss, 1993
). Expression of Cdx2 begins at day 3.5 in the trophectoderm of the blastocyst and later continues in tissues derived from the extra-embryonic ectoderm. Cdx2 transcripts are detected in the embryo proper slightly later than Cdx1 (Beck et al., 1995
) (E. Tolner, B. Roelen and J. D., unpublished). Initiation of Cdx4 expression follows, in the allantois and the posterior part of the primitive streak in the late streak stage embryo (Gamer and Wright, 1993
) (E. Tolner, B. Roelen and J. D., unpublished). The three Cdx genes, although paralogous, exhibit overlapping expression patterns in the neural tube and mesoderm at day 8.5 of development. Their expression domains in these tissues form nested sets, with Cdx1 showing most anterior and Cdx4 most posterior rostral expression boundaries, compatible with a possible differential role in AP patterning (Gamer and Wright, 1993
; Meyer and Gruss, 1993
; Beck et al., 1995
). This has been confirmed by the generation of loss-of-function mutants. Cdx1 null mutant mice are viable and show anterior homeotic transformation of axial skeletal elements from the level of the first cervical (C1) to the level of the eighth thoracic vertebra (T8) (Subramanian et al., 1995
). Cdx2 null mutant mice die at the time of implantation, but heterozygous mice are viable and display anterior homeosis of vertebrae from the level of C6 to the level of T8, and slightly shorter tails. Cdx2 and Cdx4 are expressed in posterior gut endoderm at day 8.5 (Gamer and Wright, 1993
; Beck et al., 1995
). Cdx2 expression has been shown to be maintained in the gut epithelium at later stages, and to persist during adulthood (James and Kazenwadel, 1991
). Cdx1 starts to be expressed later (from day 14.5) in developing intestinal epithelium where it becomes restricted and is maintained in the proliferative crypt compartment (Duprey et al., 1988
; Meyer and Gruss, 1993
; Subramanian et al., 1998
). Cdx2+/ mice develop polypoid lesions in the intestine secondary to homeotic transformation of the distal intestine, showing that Cdx genes have a function in gut development (Chawengsaksophak et al., 1997
; Beck et al., 1999
).
Experiments in mouse and Xenopus suggest that Cdx genes may be directly involved in the regulation of Hox genes (Pownall et al., 1996
; Epstein et al., 1997
; Isaacs et al., 1998
; Charité et al., 1998
). Cdx1 null mice showed posterior shifts in the mesodermal expression boundary of a number of Hox genes (Subramanian et al., 1995
). Cdx-binding sites are present in Hox regulatory sequences (Shashikant et al., 1995
; Subramanian et al., 1995
; Charité et al., 1998
) and Cdx1 can transactivate Hoxa7 reporter constructs (Subramanian et al., 1995
). We have previously shown that Cdx proteins in vitro bind Cdx-binding sites in a regulatory element of Hoxb8. These sites were shown to be necessary for the ability of this element to drive Hox-like expression in transgenic embryos. Expression of both transgene and endogenous Hoxb8 was anteriorised by rostral overexpression of Cdx genes in neurectoderm and mesoderm at day 8.5 (Charité et al., 1998
).
In an attempt to elucidate the relationship between Cdx genes and the Hox genes, we have investigated the effect of loss-of-function mutations in Cdx genes on AP patterning and Hox gene expression. We show that Cdx1//Cdx2+/ double mutants exhibit skeletal defects along the complete vertebral column, with an increased severity compared with single mutants. An associated posterior shift of Hox gene expression is also more extensive in these double mutants than in single mutants, demonstrating a parallel functional redundancy between Cdx genes in regulating Hox gene transcription. Furthermore, we show that mesodermal and neurectodermal expression boundaries of trunk Hox genes are already affected at day 8.5/9.0 in Cdx mutants, suggesting that Cdx genes are involved in modulating the early establishment phase of Hox expression at these levels. However, Cdx1 co-operates with Cdx2 in ensuring proper posterior axis elongation from the tail bud at later stages. We discuss the possibility that Cdx genes could, depending on the time and A-P position, influence early patterning by regulating Hox genes, and act as later mediators of posterior axial extension, directly or as regulators of 5' Hox genes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mice heterozygote for the Hoxb8 null allele wherein lacZ is inserted in frame in the Hoxb8 locus are named Hoxb8lacZ+/. Cdx1-null mice were crossed with Cdx2+/ animals to obtain transheterozygous offspring. These were mated with Cdx1-null mice and the progeny was used for skeletal staining. We also used these crosses to recover single and double mutant day 8.5 and 9.5 embryos for whole mount in situ hybridisation, and day 14.5 embryos for histological analysis on sections. For analysis of the Hoxb8 expression pattern in the Cdx2 mutant background, Hoxb8lacZ+/ mice were crossed with Cdx2+/ mice and the embryos were recovered at day 11.5 and X-gal stained. For analysis of the Hoxb8lacZ pattern in the Cdx1 single and Cdx1/Cdx2 double mutant backgrounds, Cdx1-null mice were first crossed with Hoxb8lacZ+/ mice. Cdx1+//Hoxb8lacZ+/ mice were subsequently crossed with Cdx1-null mice or with Cdx1+//Cdx2+/ mice. The resulting Cdx1//Hoxb8lacZ+/ and Cdx1+//Cdx2+//Hoxb8lacZ+/ mice were crossed with, respectively, Cdx1+//Cdx2+/ and Cdx1-null mice, and embryos were recovered at day 8.5-12.5. The day of the plug was considered as day 0.5 of development, except when the mother had a Cdx1-null genotype. In this case, because we observed a consistent delay in development of approximately 1 day, the day after the day of the plug was considered as day 0.5.
Genotyping mice and embryos
Cdx1 genotypes were determined using PCR as described previously (Subramanian et al., 1995
). Hoxb8 genotypes were determined by PCR as described elsewhere (van den Akker et al., 2001
). For Cdx2 genotyping, reverse primer 5'-TAAAAGTCAACTGTGTTCGGATCC (primer 1) could be used in one PCR reaction with forward primers 5'- AGGGACTATTCAAACTACAGGAG (primer 2) and 5'-ATATTGCTGAAGAGCTTGGCGGC (primer 3). The combination of primers 1,2 and primers 1,3 makes it possible to identify the wild-type (443 bp product) and targeted (636 bp product) Cdx2 loci, respectively. Amplification conditions were denaturation at 96°C for 30 seconds, annealing at 61°C for 60 seconds and extension at 72°C for 120 seconds for 35 cycles.
Comparative amino acid sequence analysis
Amino acid sequences of Cdx, Hox and Evx gene products were compared using Lasergene software (DNASTAR, Madison, WI).
X-gal staining and histology
For analysis of the Hoxb8lacZ expression patterns, day 8.5-12.5 embryos were stained with X-gal as whole mounts (Vogels et al., 1993
). Paraffin wax-embedded sections of whole mount X-gal stained embryos were counterstained with Neutral Red. For analysis of the phenotypes, paraffin wax-embedded sections of day 14.5 embryos were stained with Haematoxylin and Eosin.
Skeletal staining
Newborns were stained for bone and cartilage as described previously (van den Akker et al., 2001
).
In situ hybridisation
Whole mount in situ hybridisation was performed as previously described (Wilkinson, 1992
). The brachyury (T) probe has been described by Wilkinson et al. (Wilkinson et al., 1990
). The Hoxd4 probe was from Featherstone et al. (Featherstone et al., 1988
) and the Hoxb9 probe was from Graham et al. (Graham et al., 1989
).
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
Cdx double mutants exhibit a more extensive caudal shift of Hox expression boundary in paraxial mesoderm than do single mutants
The skeletal phenotypes of Cdx1 null mutants had been shown previously to be accompanied by posterior shifts in the anterior expression boundary of several Hox genes in paraxial mesoderm (Subramanian et al., 1995
). Hoxb8 is one of the Hox genes with a rostral expression boundary at AP levels affected by the Cdx1 and Cdx2 mutations. Its expression boundaries had not been examined so far in either of the two mutants. The upper thoracic vertebrae T1 and T2, which are affected by inactivation of Hoxb8 (van den Akker et al., 1999
), are also affected in Cdx1 and Cdx2 single and double mutants. In particular, fusion between the 1st and 2nd ribs was a characteristic of both Hoxb8 null animals and Cdx1/Cdx2 double mutants (Table 1). Previous work has indicated that Cdx proteins can positively regulate Hoxb8 in vivo (Charité et al., 1998
). We analysed the expression of the Hoxb8lacZ knock in allele (van den Akker et al., 1999
) in Cdx1/Cdx2 single and double mutants. We examined sagittal sections of three day 11.5/12.0 embryos of each genotype. Expression boundaries were identical at day 11.5 and 12 for each genotype. Hoxb8 expression is normally maintained at low levels in prevertebra (pv) 7 and at higher levels in more posterior prevertebrae (van den Akker et al., 1999
). In wild-type mice and Cdx1+/ mice, which generally did not present any defect in the upper thorax, the expression of Hoxb8lacZ was clearly visible in pv7 (Fig. 5A,C). In Cdx1/ and Cdx2+/ mutants, which show relatively mild upper thorax defects we observed either very weak or total loss of Hoxb8lacZ expression in pv7 (Fig. 5B,D). In double heterozygotes, the most anterior Hoxb8lacZ-expressing vertebra was always pv8 (Fig. 5E). In Cdx1// Cdx2+/ mutants, which exhibit more severe upper thorax defects, we observed either very weak expression or no expression at all in pv8, the most rostral strongly expressing vertebra being pv9 (Fig. 5F). The increasing posterior shift of the anterior boundary of Hoxb8, taken as a representative of the Hox genes with rostral boundaries in the upper thorax, correlates well with the progressively more severe abnormal upper thorax phenotypes that we observed in Cdx1Cdx2 compound mutants.
|
|
|
The Cdx1 mutation reinforces the defect of Cdx2 heterozygotes in posterior axis elongation
Cdx2+/ mice have been reported to have slightly shortened tails (Chawengsaksophak et al., 1997
). We counted a total number of 30-32 caudal (of 60-62 total) vertebrae in wild-type animals. Only 26-28 caudal (of 56-58 total) vertebrae were observed in Cdx2+/ mutants. In the double heterozygotes, the number of discernible caudal vertebrae was 15-20 (of a total of 45-50), indicating a more severe truncation of the axis compared with the Cdx2+/ heterozygotes. In Cdx1//Cdx2+/ compound mutants, the number of discernible caudal vertebrae was further reduced to 6-11 (of a total of 36-41). In the most extreme case, only a few caudal vertebrae were observed immediately below the hindlimbs and the rest of the tail consisted of a short continuous cartilaginous structure (see Fig. 8). The severe tail truncation observed in the Cdx1//Cdx2+/ double mutants is reminiscent of the tail defect in brachyury (T) heterozygous mice (Dobrovolskaia-Zavadskaia, 1927
; Herrmann et al., 1990
). Expression of T (Herrmann et al., 1990
) was compared in controls and Cdx double mutants at day 7.5 and 8.5. The T expression level was not altered in Cdx double mutants. The anterior boundary of T expression, which is downregulated when somites form, was examined in several embryos of each genotype that had between 7 and 15 somites. It was always located at a distance one somite length more posteriorly than the last formed somite in both Cdx1 heterozygotes, considered as controls, and in Cdx compound mutants. The T expression domain is less extended in compound mutants compared with controls because of the loss of posteriormost tail bud tissues in the posteriorly truncated Cdx1//Cdx2+/ mutants (Fig. 9). Because the anterior limit of T expression co-localises with the abnormal tail bending in the mutants, it seems that T expression defines the territory affected by the Cdx mutations in the tailbud. This suggests that both T and Cdx genes may be concerned with the same anatomical/morphogenetical territory but that T expression is not directly affected by the Cdx1 and Cdx2 mutations.
|
|
|
|
Examination of the appendicular skeleton revealed that one transheterozygous animal (of a total of 34), and one out of 14 Cdx1//Cdx2+/ double mutant newborns displayed abnormal limb patterning. Digit 1 (the big toe) of one of the hindlimbs was split (Fig. 11A,B, respectively). This polydactyly is compatible with Cdx genes playing a role in patterning the lateral plate mesoderm involved in limb outgrowth, possibly in conjunction with their role in transducing AP positional information to structures along the axis via the Hox genes.
| DISCUSSION |
|---|
|
|
|---|
Cdx expression and function in the nervous system
Cdx genes are expressed in the early CNS and dorsal root ganglia along a restricted AP domain, similar to their relatives the Hox genes. In addition, Cdx genes modulate the extent of the Hox expression domains in the CNS at early stages, as shown by the loss-of-function studies presented here, and by the gain-of-function experiments reported earlier (Charité et al., 1998
). The positive regulation of Cdx gene products on Hox expression in all three germ layers was revealed by the complete loss of expression of a Hox/lacZ transgene upon mutation of the Cdx binding sites present in a crucial enhancer (Charité et al., 1998
). Cdx loss-of-function mutants exhibit a slight posterior shift of the expression boundaries of at least some Hox genes in the neurectoderm. However, this effect is only observed transiently, a subsequent level of regulation probably taking over once Cdx gene expression is downregulated in this tissue. Whether the transient posterior shift of Hox gene expression in the CNS of compound Cdx mutants leads to patterning or neurological consequences is not known.
Cdx genes are expressed in the early CNS, including the neural crest precursors of the spinal ganglia. The fusion of spinal ganglia could result from a function at early stages in these neural crest progenitors, either directly or indirectly via the Hox genes. Gain- and loss-of-function Hox mutants indeed have revealed an involvement of Hox proteins in patterning spinal ganglia (Charité et al., 1994
; van den Akker et al., 1999
). However, Cdx newborn mutants also exhibit fusions between vertebral processes, suggesting either an earlier segmentation defect or partial sclerotome fusion. Such segmentation defects had already been reported for Cdx gain-of-function mutant embryos (Charité et al., 1998
). Fusion between spinal ganglia therefore also could result from abnormal somitic properties interfering with migration of neural crest cells or causing mechanical compression of the spinal ganglia.
Cdx gene products modulate AP vertebral patterning at an early stage
The expression domains of Cdx genes at early somite stages encompass the paraxial mesoderm precursors of the complete vertebral column. The early expression phase of the Cdx genes during gastrulation probably accounts for their patterning action at rostral levels of the vertebral column. The paraxial mesoderm progenitors of the cervical vertebral column (somites 5-11) are found in the epiblast lateral to the anteriormost part of the primitive streak at the late streak to head fold stages (Tam and Beddington, 1987
; Tam 1988
) (K. Lawson, personal communication). Cdx and Hox genes are co-expressed in the nascent paraxial mesoderm lateral to the anterior part of the streak at these embryonic stages. It is therefore likely that the Cdx/Hox regulatory interactions begin at these early, presomitic stages. Interactions between Cdx proteins and Hox genes may go on in areas of co-expression in the unsegmented paraxial mesoderm corresponding to progressively more posterior future somites/vertebrae. Concomitantly with embryonic progression, Cdx proteins would affect more posterior paraxial mesoderm, that express gradually more 5' Hox genes. These interactions would lead to a modulation of Hox gene expression, thereby contributing to the positional identity of the somitic progenitors.
From day 8.5 onwards, these domains rapidly regress away from the sclerotomes at cervical and thoracic levels. Nevertheless, definitive vertebral patterning in the latter areas is affected by the Cdx mutations. The time of action of Cdx products instructing positional identity at rostral and trunk levels therefore must be exclusively early. In agreement with this hypothesis, Cdx mutations were shown to alter the Hox expression boundaries at early stages. It has been shown previously that an early perturbation of Hox expression boundaries could lead to altered vertebral patterning, even if the perturbation is only transient (van der Hoeven et al., 1996
; Kondo and Duboule, 1999
). Altogether, the data are therefore compatible with Cdx affecting early AP somitic patterning via the Hox genes. As expected from the pleiotropic effect of Cdx mutations on many Hox genes (Subramanian et al., 1995
) (this work), the phenotypes in Cdx mutants extend along a more extensive AP domain than that of single Hox mutants. At a single AP level, the upper thorax, for example, the effects of mutations in Cdx1 and Cdx2 on morphogenesis were found to be co-operative, as they were on the posterior shift of the expression of a Hox gene involved in patterning at that level. According to these observations, it is possible that Cdx proteins modulate AP patterning at trunk levels exclusively via the Hox genes.
Cdx function, Hox expression domains and AP vertebral patterning appear well buffered against mutational alterations
As documented in this work, Hox gene expression and AP vertebral patterning show a dose dependence on Cdx function. Instead of the five active Cdx alleles (Cdx4 is X-linked) in wild-type mice, the compound Cdx1//Cdx2+/ mutants carry two functional Cdx alleles. A more severe impact on Hox expression and patterning can be expected in a Cdx-less situation. Nevertheless, the correlation between the loss of functional Cdx alleles and the severity of axial patterning phenotypes absolutely supports a role for Cdx genes in transduction of A-P positional information. The effects of Cdx mutations, together with the impact of Cdx experimental gain of function (Charité et al., 1998
) on Hox gene expression support a role for Cdx gene products as Hox regulators. The comparatively stronger effect of Cdx deregulation on Hox gene expression in the neurectoderm in the Cdx gain-of-function transgenic experiments most probably arises from the relatively more extensive change in Cdx dose by the strong RARbeta promoter driving the transgene, than in the Cdx loss-of-function mutants. The subtlety of the effect of the Cdx mutations on the extent of the Hox expression domains may originate from the probable compensation by the remaining functional Cdx alleles. In addition, Cdx gene products are not the only regulators affecting the establishment of the Hox expression domains, and it seems that the Hox gene patterning system is well buffered against deleterious effects of mutations at one of the numerous regulatory levels.
Are Cdx homeotic genes?
Work on Drosophila and C. elegans has shown that cad/pal-1 is involved in posterior development and patterning only partly by regulating Hox genes. cad is the homeotic gene that mediates correct patterning of the most posterior fly segment, the analia (Moreno and Morata, 1999
), which still develops normally in a HOM-less fly. pal-1 in C. elegans regulates the Hox gene mab-5, but total absence of pal-1 causes more severe, posterior-less worm phenotypes (originally called nob no back end) than mab-5 mutations. cad therefore seems to have a homeotic function by itself. Amphioxus Cdx has been shown to belong to the ParaHox cluster, which would be historically related to the Hox cluster (Brooke et al., 1998
). It is therefore likely that cad-related loci still exert a homeotic function by themselves. If this is so, mouse Cdx genes may be expected to directly pattern the most caudal embryonic structures, as cad does in the fly.
The patterning effect of Cdx genes at rostral levels is more likely to result from the regulatory action of Cdx on 3' Hox genes than from a posterior homeotic role of the Cdx gene products. Work in Drosophila and C. elegans has strongly suggested that Cdx gene products positively regulate several genes of the Hox cluster in the ancestral situation: cad regulates ftz in the fly (Moreno and Morata, 1999
), and pal-1 regulates mab-5 and vab-7 in worms (Edgar et al., 2001
). Cdx target sequences probably already existed in the ancestral Hox cluster, as witnessed by the direct transcriptional activation of mab-5 by pal-1 in the V6 cells of C. elegans (Hunter et al., 1999
). In the mouse, Hox genes with rostral expression boundaries at the level of cervical to sacral levels contain potential Cdx-binding sites in their regulatory regions (Subramanian et al., 1995
). The existence of this molecular crosstalk would have given Cdx gene products the possibility to regulate the 5' Hox genes and posterior development, as well as 3' Hox genes and more anterior patterning. Direct Cdx/Hox regulatory interactions have been observed in vertebrates (Subramanian et al., 1995
; Pownall et al., 1996
; Epstein et al., 1997
; Isaacs et al., 1998
; Charité et al., 1998
). Loss of expression of a Hoxb8/lacZ transgene in mesoderm and neurectoderm upon inactivation of the Cdx-binding sites (Charité et al., 1998
) may indicate a fundamental requirement of Cdx gene products in aiding trunk Hox genes to achieve their correct expression patterns. Whether the Cdx genes directly contribute positional information to paraxial mesoderm cells, or whether they transduce this information via the Hox genes is not easy to establish at this point, in the absence of total Hox disruption, or without inactivating all Cdx binding sites in the Hox clusters.
Evolutionary relationship between Cdx and Hox genes
The early, maximally extending expression domain of Cdx1 corresponds to that of the most 3' Hox genes, with a rostral expression boundary at the level of the preotic sulcus, the limit between rhombomeres 2 and 3 (Meyer and Gruss, 1993
). Cdx1 and Cdx2 are initially and transiently expressed as early as Hoxb1 in the posterior part of the primitive streak at the late streak stage (Meyer and Gruss, 1993
; Beck et al., 1995
). These Cdx genes therefore display features of 3'-most Hox genes, in spite of the fact that they are later involved in generating and patterning posteriormost structures. According to Moreno and Morata (Moreno and Morata, 1999
), cad in the ParaHox cluster might be paralogous to the 5' neighbour of AbdB in the Hox cluster, eve. evx2 has in fact been shown to function as a posterior Hoxd gene in distal structures of the mouse limbs (Herault et al., 1996
). Nevertheless, comparative analysis of the amino acid sequence of the homeodomains reveals that Cdx1 and Cdx2 are closer to Hox paralogy groups 8 and 9, and even to Hox paralogy group 1 and 2 than to the most posterior paralogy group 13 and to Evx proteins. In addition, the Cdx gene products possess a Pbx recognition motif, which is absent in 5'-most Abdb Hox proteins, such as paralogy group 13, and in Evx gene products. This motif in Cdx1 shares four of the five consensus residues with that of Hoxb4. It therefore seems that mammalian Cdx genes are relatively closely related to 3' Hox genes, although to a lesser extent than their 3' neighbours on the ParaHox cluster, Gsh1 and Pdx1. This could possibly explain the existence of similarities in their regulation.
Homeotic versus truncation phenotypes: a biphasic function of Cdx proteins?
Whether or not the Cdx gene products play a homeotic role on their own in the posterior part of the vertebral column, they definitely have a homeotic function along most of the axis, by modulating the position of the expression domain of Hox genes at relatively early stages.
From day 8.5/9.0 onwards, Cdx genes are not expressed any more in sclerotomes and neural tube at rostral and trunk levels, whereas these genes remain expressed in these structures at posterior levels until late embryonic stages. This late phase of Cdx expression may correspond to a different function of Cdx proteins in posterior development and patterning from the tail bud, where axial extension continues in a second phase of gastrulation (Gont et al., 1993
). Persistent Cdx expression in the posteriormost part of the embryo would affect the maintenance and/or instruction of a progenitor population of tail bud-derived caudal structures (Gofflot et al., 1997
; Gont et al., 1993
). Strikingly, the phenotypical traits of Cdx mutants in the posterior structures are no longer homeotic-like anterior transformations but posterior truncations, much more severe in Cdx1//Cdx2+/ than in Cdx2+/ mutant mice. The posterior truncations in these mice are reminiscent of those found in T heterozygotes (Dobrovolskaia-Zavadskaia, 1927
; Herrmann et al., 1990
), Wnt5A null (Yamaguchi et al., 1999
), Lef1/Tcf1 double mutants (Galceran et al., 1999
), and Wnt3A (Takada et al., 1994
) and Fgfr1 (Partanen et al., 1998
) hypomorph mutants. This suggests that these transcription factors and signalling molecules all participate in posterior axial elongation, either by facilitating convergence/extension movements (reviewed by Sokol, 2000
), or by maintaining the progenitor cell population in a proliferative state [as shown for the neural progenitors by Mathis et al. (Mathis et al., 2001
)]. A function of Cdx gene products in proliferation maintenance may apply as well to the 5' AbdB-related Hoxd and Hoxa genes, the removal of which leads to truncations of distal limb, caudal gut and external genital structures (Zákány et al., 1997
; Kondo et al., 1997
; Warot et al., 1997
). The role of Cdx gene products in posterior axial extension, like its role in modulating AP patterning of the complete vertebral axis, cannot therefore be claimed to be either Hox-dependent or independent until the phenotype of extensive Hox deletions is available. Whatever it may be, the data presented in this paper suggest that Cdx genes influence early AP patterning all along the complete vertebral column, and act as later mediators of posterior axial elongation. It could well be that these two functions are intimately linked during the progress of morphogenesis and patterning, which are known to be interdependent, as recently shown in the analysis of the function of FgfR1 (Ciruna and Rossant, 2001
).
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Beck, F., Erler, T., Russell, A. and James, R. (1995). Expression of cdx-2 in the mouse embryo and placenta: Possible role in patterning of the extra-embryonic membranes. Dev. Dyn. 204, 219-227.[Medline]
Beck, F., Chawengsaksophak, K., Waring, P., Playford, R. J. and Furness, J. B. (1999). Reprogramming of intestinal differentiation and intercalary regeneration in cdx2 mutant mice. Proc. Natl. Acad. Sci. USA 96, 7318-7323.
Beck, F., Tata, F. and Chawengsaksophak, K. (2000). Homeobox genes and gut development. BioEssays 22, 431-441.[Medline]
Brooke, N. M., Garcia-Fernandez, J. and Holland, P. W. H. (1998). The ParaHox gene cluster is an evolutionary sister of the Hox gene cluster. Nature 392, 920-922.[Medline]
Charité, J., de Graaff, W., Shen, S. and Deschamps, J. (1994). Ectopic expression of Hoxb8 causes duplication of the ZPA in the forelimb and homeotic transformation of axial structures. Cell 78, 589-601.[Medline]
Charité, J., de Graaff, W., Consten, D., Reijnen, M., Korving, J. and Deschamps, J. (1998). Transducing positional information to the Hox genes: critical interaction of Cdx gene products with position-sensitive regulatory elements. Development 125, 4349-4358.[Abstract]
Chawengsaksophak, K. and Beck, F. (1996). Chromosomal localization of cdx2, a murine homologue of the drosophila gene caudal to mouse chromosome 5. Genomics 34, 270-271.[Medline]
Chawengsaksophak, K., James, R., Hammond, V. E., Kontgen, F. and Beck, F. (1997). Homeosis and intestinal tumours in cdx2 mutant mice. Nature 386, 84-87.[Medline]
Ciruna, B. and Rossant, J. (2001). FGF signaling regulates mesoderm cell fate specification and morphogenetic movement at the primitive streak. Dev. Cell 1, 37-49.[Medline]
Dearolf, C. R., Topol, J. and Parker, C. S. (1989). The caudal gene product is a direct activator of fushi tarazu transcription during Drosophila embryogenesis. Nature 341, 340-343.[Medline]
Deschamps, J., van den Akker, E., Forlani, S., de Graaff, W., Oosterveen, T., Roelen, B. and Roelfsema, J. (1999). Initiation, establishment and maintenance of Hox gene expression patterns in the mouse. Int. J. Dev. Biol. 43, 635-650.[Medline]
Duprey, P., Chowdhury, K., Dressler, G. R., Balling, R., Simon, D., Guenet, J. L. and Gruss, P. (1988). A mouse gene homologous to the Drosophila gene caudal is expressed in epithelial cells from the embryonic intestine. Genes Dev. 2, 1647-1654.
Dobrovolskaia-Zavadskaia, K. O. (1927). Sur la mortification spontanée de la queue chez la souris nouveau-née et sur lexistence dun caractère héréditaire non-viable. C. R. Soc. Biol. 97, 114-116.
Edgar, L. G., Carr, S., Wang, H. and Wood, W. B. (2001). Zygotic expression of the caudal homolog pal-1 is required for posterior patterning in Caenorhabditis elegans embryogenesis. Dev. Biol. 229, 71-88.[Medline]
Epstein, M., Pillemer, G., Yelin, R., Yisraeli, J. K. and Fainsod, A. (1997). Patterning of the embryo along the anterior-posterior axis: the role of the caudal genes. Development 124, 3805-3814.[Abstract]
Featherstone, M. S., Baron, A., Gaunt, S. J., Mattei, M. G. and Duboule, D. (1988). Hox5.1 defines a homeobox-containing gene locus on mouse chromosome 2. Proc. Natl. Acad. Sci. USA 85, 4760-4764.
Galceran, J., Farinas, I., Depew, M. J., Clevers, C. and Grosscheld, R. (1999). Wnt3a/l-like phenotype and limb deficiency in Lef1/ Tcf1/ mice. Genes Dev. 13, 709-717.
Gamer, L. W. and Wright, C. V. E. (1993). Murine cdx-4 bears striking similarities to the Drosophila caudal gene in its homeodomain sequence and early expression pattern. Mech. Dev. 43, 71-81.[Medline]
Gofflot, F., Hall, M. and Morriss-Kay, G. M. (1997). Genetic patterning of the developing mouse tail at the time of posterior neuropore closure. Dev. Dyn. 210, 431-445.[Medline]
Gont, L. K., Steinbeisser, H., Blumberg, B. and De Robertis, E. M. (1993). Tail formation as a continuation of gastrulation. The multiple cell populations of Xenopus tailbud derive from late blastopore lip. Development 119, 991-1004.[Abstract]
Graham, A., Papalopulu, N. and Krumlauf, R. (1989). The murine and Drosophila homeobox gene complexes have common features of organization and expression Cell 57, 367-378.[Medline]
Guz, Y., Montminy, M. R., Stein, R., Leonard, J., Gamer, L. W., Wright, C. V. and Teitelman, G. (1995). Expression of murine STF-1, a putative insulin gene transcription factor, in beta cells and pancreas, duodenal epithelium, and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121, 11-18.[Abstract]
Hérault, Y., Hraba-Renevey, S., van der Hoeven, F. and Duboule, D. (1996). Function of the Evx-2 gene in the morphogenesis of vertebrate limbs. EMBO J. 15, 6727-6738.[Medline]
Herrmann, B. G., Labeit, S., Poustka, A., King, T. R. and Lehrach, H. (1990). Cloning of the T gene required in mesoderm formation in the mouse. Nature 343, 617-622.[Medline]
Hunter, C. P., Harris, J. M., Maloof, J. N. and Kenyon, C. (1999). Hox gene expression in a single Caenorhabdititis elegans cell is regulated by a caudal homolog and intercellular signals that inhibit Wnt signaling. Development 126, 805-814.[Abstract]
Isaacs, H. V., Pownall, M. E. and Slack, J. M. W. (1998). Regulation of Hox gene expression and posterior development by the Xenopus caudal homologue Xcad3. EMBO J. 17, 3413-3427.[Medline]
James, R. and Kazenwadel, J. (1991). Homeobox gene expression in the intestinal epithelium of the adult mouse. J. Biol. Chem. 266, 3246-3251.
Kondo, T., Zákány, J., Innis, J. W. and Duboule, D. (1997). Of fingers, toes and penises. Nature 390, 29.[Medline]
Kondo, T. and Duboule, D. (1999). Breaking colinearity in the mouse HoxD complex. Cell 97 407-417.[Medline]
Li, H., Zeitler, P. S., Valerius, M. T., Small, K. and Potter, S. S. (1996). Gsh-1 is an orphan Hox gene required for normal pituitary development. EMBO J. 15, 714-724.[Medline]
MacDonald, P. M. and Struhl, G. (1986). A molecular gradient in early Drosophila embryos and its role in specifying the body pattern. Nature 324, 537-545.[Medline]
Mathis, L., Kulesa, P. and Fraser, S. E. (2001). FGF receoptor signalling is required to maintain neural progenitors during Hensens node progression. Nat. Cell Biol. 3, 559-566.[Medline]
Meyer, B. I. and Gruss, P. (1993). Mouse cdx-1 expression during gastrulation. Development 117, 191-203.
Mlodzik, M., Fjose, A. and Gehring, W. J. (1985). Isolation of caudal, a Drosophila homeo box-containing gene with maternal expression whose transcripts form a concentration gradient at the pre-blastoderm stage. EMBO J. 4, 2961-2969.[Medline]
Mlodzik, M. and Gehring, W. J. (1987). Expression of the caudal gene in the germ line of Drosophila: formation of an RNA and protein gradient during early embryogenesis. Cell 48, 465-478.[Medline]
Moreno, E. and Morata, G. (1999). The Hox gene caudal specifies the most posterior Drosophila segment and acts in combination with the Hedgehog pathway. Nature 400, 873-877.[Medline]
Partanen, J., Schwartz, L. and Rossant, J. (1998). Opposite phenotypes of hypomorphic and Y766 phosphorylation site mutations reveal a function for Fgfr1 in anteroposterior patterning of mouse embryos. Genes Dev. 12, 2332-2344.
Pownall, M. E., Tucker, A. S., Slack, J. M. W. and Isaacs, H. V. (1996). eFGF, Xcad3 and hox genes form a molecular pathway that establishes the anteroposterior axis in Xenopus. Development 122, 3881-3892.[Abstract]
Rivera-Pomar, R., Xlangyl, L., Perrimon, N., Taubert, H. and Jäckle, H. (1995). Activation of posterior gap gene expression in the Drosophila blastoderm. Nature 376, 253-256.[Medline]
Schulz, C. and Tautz, D. (1995). Zygotic caudal regulation by hunchback and its role in abdominal segment formation of the Drosophila embryo. Development 121, 1023-1028.[Abstract]
Shashikant, C., Bieberich, C. J., Belting, H. G., Wang, J. C. H., Borbely, M. A. and Ruddle, F. H. (1995). Regulation of hoxc-8 during mouse embryonic development: identification and characterization of critical elements involved in early neural tube expression. Development 121, 4339-4347.[Abstract]
Sokol, S. (2000). A role for Wnts in morphogenesis and tissue polarity. Nat. Cell Biol. 2, E124-E126.[Medline]
Subramanian, V., Meyer, B. I. and Gruss, P. (1995). Disruption of the murine homeobox gene cdx1 affects axial skeletal identities by altering the mesodermal expression domains of Hox genes. Cell 83, 641-653.[Medline]
Subramanian, V., Meyer, B. and Evans, G. S. (1998). The murine cdx-1 gene product localises to the proliferative compartment in the developing and regenerating intestinal epithelium. Differentiation 64, 11-18.[Medline]
Takada, S., Stark, K. L., Shea, M. G., Vassileva, G., McMahon, J. A., McMahon, A. P. (1994). Wnt-3a regulates somite and tailbud formation in the mouse embryo. Genes Dev. 8, 174-189.
Tam, P. and Beddington, R. (1987). The formation of mesodermal tissues in the mouse embryo during gastrulation and early organogenesis. Development 99, 109-126.[Abstract]
Tam, P. (1988). The allocation of cells in the presomitic mesoderm during somite segmentation in themouse embryo. Development 103, 379-390.[Abstract]
van den Akker, E., Reijnen, M., Korving, J., Brouwer, A., Meijlink, F. and Deschamps, J. (1999). Targeted inactivation of Hoxb8 affects survival of a spinal ganglion and causes aberrant limb reflexes. Mech. Dev. 89, 103-114.[Medline]
van den Akker, E., Fromental-Ramain, C., de Graaff, W., Le Mouellic, H., Brûlet, P., Chambon, P. and Deschamps, J. (2001). Axial skeletal patterning in mice lacking all paralogous group 8 Hox genes Development 128, 1911-1921.[Abstract]
Vogels, R., Charité, J., de Graaff, W. and Deschamps, J. (1993). Proximal cis-acting elements cooperate to set Hoxb-7 (Hox2.3) expression boundaries in transgenic mice. Development 118, 71-82.[Abstract]
van der Hoeven, F., Zákány, J. and Duboule, D. (1996). Gene transpositions in the HoxD complex reveal a hierarchy of regulatory controls Cell 85, 1025-1035.[Medline]
Warot, X., Fromental-Ramain, C., Fraulob, V., Chambon, P. and Dollé, P. (1997). Gene dosage-dependent effects of the Hoxa-13 and Hoxd-13 mutations on morphogenesis of the terminal parts of the digestive and urogenital tracts. Development 124, 4781-4791.[Abstract]
Wilkinson, D. (1992). In In Situ Hybridization: A Practical Approach, pp 75-83. Oxford: IRL Press.
Wilkinson, D. G., Bhatt, S. and Herrmann, B. G. (1990). Expression pattern of the mouse T gene and its role in mesoderm formation. Nature 343, 657-659.[Medline]
Yamaguchi, T. P, Bradley, A., McMahon, A. P and Jones, S. (1999). A Wnt5a pathway underlies outgrowth of multiple structures in the vertebrate embryo. Development 126, 1211-1223.[Abstract]
Zákány, J., Fromental-Ramain, C., Warot, X. and Duboule, D. (1997). Regulation of number and size of digits by posterior Hox genes: A dose-dependent mechanism with potential evolutionary implications. Proc. Natl. Acad. Sci. USA 94, 13695-13700.
This article has been cited by other articles:
![]() |
V. Wilson, I. Olivera-Martinez, and K. G. Storey Stem cells, signals and vertebrate body axis extension Development, May 15, 2009; 136(10): 1591 - 1604. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Ribes, I. Le Roux, M. Rhinn, B. Schuhbaur, and P. Dolle Early mouse caudal development relies on crosstalk between retinoic acid, Shh and Fgf signalling pathways Development, February 15, 2009; 136(4): 665 - 676. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Gaunt, D. Drage, and R. C. Trubshaw Increased Cdx protein dose effects upon axial patterning in transgenic lines of mice Development, August 1, 2008; 135(15): 2511 - 2520. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, A. Yabuuchi, S. McKinney-Freeman, D. M. K. Ducharme, M. K. Ray, K. Chawengsaksophak, T. K. Archer, and G. Q. Daley Cdx gene deficiency compromises embryonic hematopoiesis in the mouse PNAS, June 3, 2008; 105(22): 7756 - 7761. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. McKinney-Freeman, C. Lengerke, I.-H. Jang, S. Schmitt, Y. Wang, M. Philitas, J. Shea, and G. Q. Daley Modulation of murine embryonic stem cell-derived CD41+c-kit+ hematopoietic progenitors by ectopic expression of Cdx genes Blood, May 15, 2008; 111(10): 4944 - 4953. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Kinkel, S. C. Eames, M. R. Alonzo, and V. E. Prince Cdx4 is required in the endoderm to localize the pancreas and limit {beta}-cell number Development, March 1, 2008; 135(5): 919 - 929. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ezaki, R.-J. Guo, H. Li, A. B. Reynolds, and J. P. Lynch The homeodomain transcription factors Cdx1 and Cdx2 induce E-cadherin adhesion activity by reducing beta- and p120-catenin tyrosine phosphorylation Am J Physiol Gastrointest Liver Physiol, July 1, 2007; 293(1): G54 - G65. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Pilon, K. Oh, J.-R. Sylvestre, J. G. A. Savory, and D. Lohnes Wnt signaling is a key mediator of Cdx1 expression in vivo Development, June 15, 2007; 134(12): 2315 - 2323. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Skromne, D. Thorsen, M. Hale, V. E. Prince, and R. K. Ho Repression of the hindbrain developmental program by Cdx factors is required for the specification of the vertebrate spinal cord Development, June 1, 2007; 134(11): 2147 - 2158. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shimizu, Y.-K. Bae, and M. Hibi Cdx-Hox code controls competence for responding to Fgfs and retinoic acid in zebrafish neural tissue Development, December 1, 2006; 133(23): 4709 - 4719. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shinmyo, T. Mito, T. Uda, T. Nakamura, K. Miyawaki, H. Ohuchi, and S. Noji brachyenteron is necessary for morphogenesis of the posterior gut but not for anteroposterior axial elongation from the posterior growth zone in the intermediate-germband cricket Gryllus bimaculatus Development, November 15, 2006; 133(22): 4539 - 4547. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Glaser, D. Metcalf, L. Wu, A. H. Hart, L. DiRago, S. Mifsud, A. D'Amico, S. Dagger, C. Campo, A. C. Chan, et al. Enforced expression of the homeobox gene Mixl1 impairs hematopoietic differentiation and results in acute myeloid leukemia PNAS, October 31, 2006; 103(44): 16460 - 16465. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. G. Rucker, L. Bullinger, C. Schwaenen, D. B. Lipka, S. Wessendorf, S. Frohling, M. Bentz, S. Miller, C. Scholl, R. F. Schlenk, et al. Disclosure of Candidate Genes in Acute Myeloid Leukemia With Complex Karyotypes Using Microarray-Based Molecular Characterization J. Clin. Oncol., August 20, 2006; 24(24): 3887 - 3894. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. van Nes, W. de Graaff, F. Lebrin, M. Gerhard, F. Beck, and J. Deschamps The Cdx4 mutation affects axial development and reveals an essential role of Cdx genes in the ontogenesis of the placental labyrinth in mice Development, February 1, 2006; 133(3): 419 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakano, H. Furuta, A. Doi, S. Matsuno, T. Nakagawa, H. Shimomura, S. Sakagashira, Y. Horikawa, M. Nishi, H. Sasaki, et al. A Functional Variant in the Human Betacellulin Gene Promoter Is Associated With Type 2 Diabetes Diabetes, December 1, 2005; 54(12): 3560 - 3566. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Carapuco, A. Novoa, N. Bobola, and M. Mallo Hox genes specify vertebral types in the presomitic mesoderm Genes & Dev., September 15, 2005; 19(18): 2116 - 2121. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Deschamps and J. van Nes Developmental regulation of the Hox genes during axial morphogenesis in the mouse Development, July 1, 2005; 132(13): 2931 - 2942. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-L. Wang, M. E. Shin, P. A. Knight, D. Artis, D. G. Silberg, E. Suh, and G. D. Wu Regulation of RELM/FIZZ isoform expression by Cdx2 in response to innate and adaptive immune stimulation in the intestine Am J Physiol Gastrointest Liver Physiol, May 1, 2005; 288(5): G1074 - G1083. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Strumpf, C.-A. Mao, Y. Yamanaka, A. Ralston, K. Chawengsaksophak, F. Beck, and J. Rossant Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst Development, May 1, 2005; 132(9): 2093 - 2102. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Beland and D. Lohnes Chicken Ovalbumin Upstream Promoter-Transcription Factor Members Repress Retinoic Acid-induced Cdx1 Expression J. Biol. Chem., April 8, 2005; 280(14): 13858 - 13862. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Maier, M. R. Dusing, and D. A. Wiginton Cdx Binding Determines the Timing of Enhancer Activation in Postnatal Duodenum J. Biol. Chem., April 1, 2005; 280(13): 13195 - 13202. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tabaries, J. Lapointe, T. Besch, M. Carter, J. Woollard, C. K. Tuggle, and L. Jeannotte Cdx Protein Interaction with Hoxa5 Regulatory Sequences Contributes to Hoxa5 Regional Expression along the Axial Skeleton Mol. Cell. Biol., February 15, 2005; 25(4): 1389 - 1401. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Copf, R. Schroder, and M. Averof From the Cover: Ancestral role of caudal genes in axis elongation and segmentation PNAS, December 21, 2004; 101(51): 17711 - 17715. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Aulehla and B. G. Herrmann Segmentation in vertebrates: clock and gradient finally joined Genes & Dev., September 1, 2004; 18(17): 2060 - 2067. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Beland, N. Pilon, M. Houle, K. Oh, J.-R. Sylvestre, P. Prinos, and D. Lohnes Cdx1 Autoregulation Is Governed by a Novel Cdx1-LEF1 Transcription Complex Mol. Cell. Biol., June 1, 2004; 24(11): 5028 - 5038. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Chawengsaksophak, W. de Graaff, J. Rossant, J. Deschamps, and F. Beck Cdx2 is essential for axial elongation in mouse development PNAS, May 18, 2004; 101(20): 7641 - 7645. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. P. S. Rawat, M. Cusan, A. Deshpande, W. Hiddemann, L. Quintanilla-Martinez, R. K. Humphries, S. K. Bohlander, M. Feuring-Buske, and C. Buske Ectopic expression of the homeobox gene Cdx2 is the transforming event in a mouse model of t(12;13)(p13;q12) acute myeloid leukemia PNAS, January 20, 2004; 101(3): 817 - 822. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Hajihosseini, M. D. Lalioti, S. Arthaud, H. R. Burgar, J. M. Brown, S. R. F. Twigg, A. O. M. Wilkie, and J. K. Heath Skeletal development is regulated by fibroblast growth factor receptor 1 signalling dynamics Development, January 15, 2004; 131(2): 325 - 335. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Houle, J.-R. Sylvestre, and D. Lohnes Retinoic acid regulates a subset of Cdx1 function in vivo Development, December 29, 2003; 130(26): 6555 - 6567. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Copf, N. Rabet, S. E. Celniker, and M. Averof Posterior patterning genes and the identification of a unique body region in the brine shrimp Artemia franciscana Development, December 15, 2003; 130(24): 5915 - 5927. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Forlani, K. A. Lawson, and J. Deschamps Acquisition of Hox codes during gastrulation and axial elongation in the mouse embryo Development, August 15, 2003; 130(16): 3807 - 3819. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||