spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

doi: 10.1242/10.1242/dev.00199


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, W.-M.
Right arrow Articles by Ruohola-Baker, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, W.-M.
Right arrow Articles by Ruohola-Baker, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Development 130, 173-184 (2003)
Copyright © 2003 The Company of Biologists Limited

Dystroglycan is required for polarizing the epithelial cells and the oocyte in Drosophila

Wu-Min Deng1,*, Martina Schneider2,*, Richard Frock1, Casimiro Castillejo-Lopez2,{dagger}, Emily Anne Gaman1, Stefan Baumgartner2 and Hannele Ruohola-Baker1,{ddagger}

1 Department of Biochemistry, Box 357350, University of Washington, Seattle, WA 98195, USA
2 Department of Cell and Molecular Biology, Section of Developmental Biology, Lund University, Sweden
{dagger} Present address: EBC, Jämförande Fysiologi (Comparative Physiology) Norbyv. 18A, 752 36 Uppsala, Sweden

{ddagger} Author for correspondence (e-mail: hannele{at}u.washington.edu)

Accepted 11 October 2002


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The transmembrane protein Dystroglycan is a central element of the dystrophin-associated glycoprotein complex, which is involved in the pathogenesis of many forms of muscular dystrophy. Dystroglycan is a receptor for multiple extracellular matrix (ECM) molecules such as Laminin, agrin and perlecan, and plays a role in linking the ECM to the actin cytoskeleton; however, how these interactions are regulated and their basic cellular functions are poorly understood. Using mosaic analysis and RNAi in the model organism Drosophila melanogaster, we show that Dystroglycan is required cell-autonomously for cellular polarity in two different cell types, the epithelial cells (apicobasal polarity) and the oocyte (anteroposterior polarity). Loss of Dystroglycan function in follicle and disc epithelia results in expansion of apical markers to the basal side of cells and overexpression results in a reduced apical localization of these same markers. In Dystroglycan germline clones early oocyte polarity markers fail to be localized to the posterior, and oocyte cortical F-actin organization is abnormal. Dystroglycan is also required non-cell-autonomously to organize the planar polarity of basal actin in follicle cells, possibly by organizing the Laminin ECM. These data suggest that the primary function of Dystroglycan in oogenesis is to organize cellular polarity; and this study sets the stage for analyzing the Dystroglycan complex by using the power of Drosophila molecular genetics.

Key words: Polarity, Axis, Asymmetry, Oogenesis, Epithelia, Dystroglycan, Actin, Microtubule, ECM, Planar polarity, Signaling, Drosophila


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Muscular dystrophies are genetic disorders that are characterized by progressive muscle degeneration. These diseases are caused by mutations in different members of the Dystrophin-associated glycoprotein complex (DGC), which is composed of multiple cytocortical, transmembrane and extracellular proteins (Burton and Davies, 2002Go; Henry and Campbell, 1999Go; Winder, 2001Go). How these mutations cause the observed muscle defects is not fully understood and no cures for the diseases exist. In addition to muscle cells, the DGC is required in other cell types such as epithelial cells and neural cells (Durbeej et al., 1995Go; Durbeej and Campbell, 1999Go; Williamson et al., 1997Go; Michele et al., 2002Go; Moore et al., 2002Go). Reduced expression of the DGC components is observed in breast and prostate cancers (Henry et al., 2001aGo). Dystroglycan (DG), a transmembrane protein, is a central player of the DGC. It acts as a receptor for the extracellular matrix (ECM) component Laminin (Ibraghimov-Beskrovnaya et al., 1992Go), and connects to the actin cytoskeleton through an actin-binding protein, Dystrophin. The cellular function and regulation of these interactions remain elusive, however. Drosophila melanogaster is an excellent model organism with which to study basic cellular functions of evolutionarily conserved genes, particularly human disease genes (Bernards and Hariharan, 2001Go). We have analyzed the DG homolog in Drosophila and shown that it is required for the establishment of cellular polarity.

How polarity is established at a cellular level is one of the most fundamental questions in biology. Many cell types undergo certain degrees of polarization to fulfill their specific functions. For example, neurons polarize to form axons and dendrites in order to convey signals; polarization of T cells is needed for their migration. Epithelial cells, however, have a pronounced apicobasal polarity, which is needed for them to cope with different extracellular environments. Studies using genetic model systems such as Drosophila and mammalian culture cells have revealed three groups of protein complexes that are involved in the specification and regionalization of the plasma membrane and cortex of the polarized epithelium: Crumbs, Par and Lgl complexes (Tepass et al., 2001Go). The transmembrane protein, Crumbs (Crb) and its cytoplasmic-binding partners, the PDZ domain proteins Discs Lost (Dlt) and Stardust as well as the Par-complex [Bazooka(Par3)/DmPar6(Par6)/atypical protein kinase C (aPKC)] are located on the apical membrane and are required for the establishment of this domain (Bachmann et al., 2001Go; Bhat et al., 1999Go; Hong et al., 2001Go; Petronczki and Knoblich, 2001Go; Tepass et al., 1990Go; Wodarz et al., 2000Go). The Lgl-complex [Lethal Giant Larvae (Lgl)/Discs Large (Dlg)/Scribble (Scrib)] is located at the lateral region of the epithelium and is required to restrict Crb to the apical side (Bilder and Perrimon, 2000Go; Bilder et al., 2000Go; Woods and Bryant, 1991Go).

Cell polarity can also be the basis for a body axis. In Drosophila, the body polarity is built upon the polarity of the oocyte, and in C. elegans, polarization of the single-cell embryo determines the anteroposterior (AP) body axis (reviewed by Wodarz, 2002Go). In fact, the process of polarity formation in the developing Drosophila oocyte provides an excellent model with which to study how the polarity of the cytoskeleton is dynamically regulated. The AP asymmetry of the oocyte cytoskeleton, which is the basis for morphogen localization within different compartments of the egg, is established by a series of dynamic steps (reviewed by Riechmann and Ephrussi, 2001Go). First, centrioles and the microtubule organizing center (MTOC) are located at the anterior end of the oocyte at stage 1. By stage 3 the MTOC has moved to the posterior of the oocyte. This posterior movement of the MTOC requires function of the Par proteins (Par-complex and Par1) and the action of maelstrom gene product (Cox et al., 2001aGo; Cox et al., 2001bGo; Huynh et al., 2001aGo; Huynh et al., 2001bGo; Clegg et al., 2001Go). At stage 6, posterior follicle cells send an unidentified signal back to the oocyte to re-orient the oocyte microtubule (MT) polarity, which requires the function of an ECM protein, Laminin (Deng and Ruohola-Baker, 2000Go). At each step, the proper MT polarity is required for localization of key molecules in the oocyte. In addition to MTs, the oocyte has an enriched cortical array of actin cytoskeleton that plays an important role in localizing posterior morphogens in the oocyte (Baum et al., 2000Go; Erdelyi et al., 1995Go).

Although the oocyte and the epithelial cells differ profoundly in their morphology and function, polarization of these two cell types uses some of the same genes. For example, the Par genes are required to establish the polarity of both the oocyte and epithelial cells (Cox et al., 2001aGo; Cox et al., 2001bGo; Huynh et al., 2001aGo; Huynh et al., 2001bGo; Petronczki and Knoblich, 2001Go; Wodarz et al., 2000Go). This similarly raises the possibility that some common strategies may exist for cellular polarization. We show that DG, a receptor for multiple ECM proteins, is required cell-autonomously to polarize both the epithelial cells and the oocyte in Drosophila. We also show a separate, non-cell-autonomous function for DG: disruption of DG affects the organization of the basal actin cytoskeleton in neighboring cells, which suggests the involvement of DG in cell-cell communication.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Identifying the Drosophila Dystroglycan gene
Drosophila Dystroglycan (Dg) gene was identified by EP (Rørth, 1996Go) screen and independently by homology to mouse DG using the Protein Blast program. LD04782 that maps to the genomic region identified by this search contains the 3' half of the gene. We therefore isolated several cDNAs from the 5' region by PCR using an embryonic cDNA library. The 5' end of Dg was mapped near the insertion site of EP(2)2241 and ca.4 kb downstream of Rho 1 (Fig. 1A). Several EST 5' sequences overlap the 5' UTR of Dg. We analyzed the following ESTs: LD11619, GH09323 and SD06707. We fully sequenced LD11619 and partially sequenced three of the cDNAs isolated and found the intron-exon structure to be different from the Gadfly prediction in two incidents (Gadfly annotation has been corrected). We further noticed that at least two exons [exon 8 (265 amino acids) and 9 (83 amino acids)] are subjected to alternative splicing (Fig. 1A). We tested five different cDNAs for presence of exon 8 and 9. Two lacked exon 9, among them LD11619 (1179 amino acids). Two lacked both exon 8 and exon 9, among them SD06707 (914 amino acids). One lacked exon 8 (GH09323, 997 amino acids). None of the cDNAs tested contained both exon 8 and exon 9 (Fig. 1A shows the exon/intron structure and the alternatively spliced exons).



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 1. The Drosophila Dystroglycan gene and protein. (A) Schematic drawing of the Dystroglycan genomic region, deletion alleles and the dsDG RNAi construct. The scale bar refers to P1 clone DS03910. (B) Comparison of DG from human, Drosophila (D.m DG) and C. elegans (C.e, T21B6.1). Through Psi Blast search with D.m DG protein sequence, the following E values were obtained after the third reiteration: human DG, e-134; C.e, T21B6.1, e-112. The dark-green box indicates the region of highest amino acid identity (human DG to D.m DG, 31%; D.m DG to T21B6.1, 20%). The light-green box indicates a duplicated region in D.m DG with 25% amino acid identity to amino acids 492-733 of human DG (broken green line). Blue box, mucin-like domain; gray box, putative transmembrane domain. (C) The last 13 amino acids of the DG C terminus, including the Dystrophin-binding site, are highly conserved between human, mouse and Drosophila. (D) Alignment of the cytoplasmic domains of human DG, mouse DG, Drosophila DG and C.e hypothetical protein T21B6.1 with ClustalW program at EBI. (E) Western blot of 6-20 hour embryonic protein extracts probed with the DG antibody. Five bands at molecular weight of ~79, ~105, ~120, ~200 and >200 kDa are detected in wild-type (OrR, lane 4, marked by red dots) and the heterozygous mutant (lanes 5-7) embryos, respectively. All five bands are missing in homozygous deficiency (Df (2R)JP4 and Df(2R)JP6) embryos (lanes 1 and 2). However, this antibody detects a background band at ~110 kDa. In the homozygous Dg248 embryos (lane 3), only a remnant of the 105 kDa band is detected in addition to the background band. A similar banding pattern is observed in Dg323 embryos (data not shown). An antibody against {alpha}-Tubulin was used as a loading control, while an antibody against ß-Galatosidase was used as a control to examine the purity of the homozygous mutant embryos. (F) A stage 4-5 egg chamber with Dg323 follicle cell clones marked by lack of GFP (green). DG staining (red) is strongly reduced in the clone (broken line, arrow). (G) DG staining (red) is strongly reduced in follicle cells carrying tubP-Gal4/dsDG to target-silence DG expression by RNAi. Blue, DAPI staining in the nuclei.

 

Isolation of deletion mutants at the Dg locus
Drosophila melanogaster stocks were raised on standard cornmeal-yeast-agar medium at 25°C. Dg alleles Dg248, Dg62 and Dg323 were obtained by imprecise excision of EP(2)2241 (Fig. 1A). EP(2)2241 was mobilized by crossing the line to a {Delta}2-3 transposase containing line. 330 White-eyed flies of the F1 generation were established as balanced stocks, and the homozygous lethal (12%) or semi-lethal lines (5%) were tested for complementation with a CG8414-allele (EP(2)0525), a deficiency line Df(2)JP6 and a Rho1 allele (Rho1E3.10) (Halsell et al., 2000Go). All three alleles contain deletions that remove the putative transcription start site and the 5'UTR of the Dg gene (Fig. 1A). The breakpoints of the deletion mutants were mapped by PCR using combinations of the following genomic primers: forward, GATCAGGGCCAAGGTGTGTCCAGC and AAGCCGCTTTGGCGTTGC; reverse, GCTCACTCCCACACAAGCGC and GAGCCCAATGATCCGTGGAAAGCG.

PCR fragments including the breakpoints of Dg248 and Dg323 were sequenced. Dg248 contains a 785 bp deletion between bp 32,514 and bp 33,299 of DS03910. Fifteen basepairs of the inverted repeat of the P element are still present (lowercase in Fig. 1). An A to T mutation and a 2 bp deletion is found at the distal breakpoint: GGAGCATTCCTTGCT--ATGTTatgttatttcatcatgGGCAGGAGAGTCCCGAAT.

Dg323 contains a 3155 bp deletion between bp 32,345 and bp 35,669 of DS03910. A C to T change was found near the proximal breakpoint: AAAATGGCAGCGTACTTTCG/TTTTGCTTTGCGCTTCTCTG.

Construction of the transgenic animals with DG-hairpin
The cDNA corresponding to the cytoplasmic domain and 670 bp of the 3' UTR of Drosophila Dystroglycan (CTGTTGCCTGCA to TTGCTTGCATGTTTTTTTTTTTT) was directionally cloned into the KpnI/HindIII sites in pBluescript II (Stratagene) to form an intermediate vector pKS-dg. The 1 kb KpnI/BamHI fragment of pKS-dg was excised and subcloned into pEGFP-N1 (Clontech) and then digested with NheI and BamHI. The NheI/BamHI fragment was inserted together with the 148 bp Sau3A fragment of pEGFP-N1 back into the BamHI/SpeI-digested pKS-dg (triple ligation). The KpnI 2.2 kb fragment was subcloned into pUAST. Thus, we constructed a Dg hairpin-loop plasmid (pUAST-dg-L-gd). The construct was verified by sequencing and then injected to embryos to obtain stable transformant lines, UAS-dsDG-RNAi (dsDG). To drive expression of dsDG in animals, we crossed the transgenic flies with the tubP-Gal4 line (Lee and Luo, 1999Go), which shows ubiquitous expression in follicle cells. tubP-Gal4/dsDG causes reduction of DG expression, leading to semilethality, consistent with the fact that dg deletion alleles are homozygous lethal. However, some tubP-Gal4/dsDG escapers were observed and analyzed for their oogenesis phenotypes.

Loss-of-function mosaic analysis
In order to generate mutant cell clones, Dg alleles were recombined to the FRT chromosome (Xu and Rubin, 1993Go). To obtain follicle cell clones, 1- to 5-day-old flies were heat-shocked as adults for 60 minutes at 37°C and put in freshly yeasted vials with males for 2 or 3 days. To obtain germline clones, 2- to 3-day-old larvae were heat-shocked at 37°C for 2 hours each time during 2 consecutive days. Ovaries from adult female flies at 3-5 days of age were harvested. To generate mutant clones in imaginal discs, the flies were allowed to lay eggs for 24 hours at 25°C and the eggs were allowed to develop 48 hours at 25°C. Thereafter, the larvae were heat shocked for 30-40 minutes at 38°C and returned to 25°C. After 2 days, wandering third instar larvae were collected and dissected for antibody staining.

Dystroglycan antibody production
Three antibodies against DG protein were raised in rabbits: one against the extracellular domain corresponding to exon 8 (amino acids 243-507) and two against the intracellular regions (one against 18 C-terminal amino acids and one against 102 C-terminal amino acids). Most of the staining shown in this paper use the antibody raised against 102 C-terminal amino acids. DG cytoplasmic domain (102 amino acids) was synthesized by PCR using the primer pair: CGGGATCCAAAGGAGCGGCAAAATGGAG and GCTCTAGAAAGCGGCCGCCGTACGTCCCAGTAAGT (Gibco BRL) and the template GH09323. The PCR product was digested using BamHI and NotI and the fragment was cloned in vector pGEX5X. The DGcyto-GST fusion protein was produced in JM109 after induction with IPTG. Then bacteria were harvested and lyzed by French Press. To purify the fusion protein, GST resin was used to bind the protein, and 10 mM gluthione 50 mM Tris (pH 7.5) was used to elude the protein. Polyclonal antisera were produced by R & R rabbitury, and affinity purified by the fusion protein.

Overexpression of Dystroglycan
UAS-DG was constructed by cloning the KpnI/NotI insert of an EST clone LD11619 into the pUAST transformation vector. UAS-DGcyto contains a tandem Flag tag sequence inserted at amino acid 37 of DG (amino acids 1-27 constitute the putative signal peptide) fused to the transmembrane (starting WPIVI...) and cytoplasmic domains. The constructs were injected to embryos to obtain stable transformant lines. The UAS-DG and UAS-DGcyto fly-lines were then crossed to different Gal4 driver lines.

To generate DG overexpression follicle cell clones, hsFLP, UAS-Dg males were crossed to virgin female act<FRT-CD2-FRT<Gal4; UASGFP flies (Pignoni and Zipursky, 1997Go). The F1 progeny were heat shocked at 37°C for 1 hour and raised at 25°C for 3 days, dissected and analyzed.

Histocytochemistry
Ovarian antibody staining and confocal microscopy was performed as described previously (Deng et al., 2001Go). Basal actin staining was performed according to the protocol provided by Frydman (Frydman and Spradling, 2001Go). Imaginal disc staining was as described previously (Woods et al., 1997Go). A two-photon laser scanning microscope (Leica TCS SP/MP) was used to detect DAPI staining.

The following antibodies were used: rabbit anti-Dlg (1:500) (Woods and Bryant, 1991Go); mouse anti-Orb (1:20) (Lantz et al., 1994Go); rabbit anti Baz (1:500) (Wodarz et al., 2000Go); mouse anti-Crb (CQ4,1:20) (Tepass et al., 1990Go); rabbit anti DG (1:3000; this study); mouse or rabbit anti-ßGal (1:5000, Sigma); mouse anti-Neurotactin (BP102; 1:20) (Hortsch et al., 1990Go); rabbit anti-Laminin (1:3000) (Fessler et al., 1987Go); ant-Dlt (1:1000) (Bhat et al., 1999Go); anti-ß-HSpectrin (1:1000) (Thomas and Kiehart, 1994Go); Alexa 488, 568 or 633 goat anti-mouse (Molecular Probes); Alexa 568 or 633 Goat anti-Rabbit or Rat (Molecular Probes); and Alexa 568 or 633 Phalloidin (Molecular Probes). DAB staining was done with the Vectastain Kit (Vector Laboratories, CA).


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Dystroglycan gene structure and protein
To identify genes that affect the polarity of the Drosophila oocyte, we used the EP/Gal4 system (Rørth, 1996Go) to screen for genes that, when overexpressed in follicle cells, cause a polarity defect in the underlying oocyte. From the over 2000 EP insertions screened, two components of the mammalian DGC were identified: Laminin A (Deng and Ruohola-Baker, 2001) and Drosophila DG (EP(2)2241; Fig. 1A). An independent homology search with mouse DG protein verified the identification of CG18250 as the Drosophila homolog of the mammalian Dystroglycan gene.

Conceptual translation of the longest cDNA (LD11619) reveals an open reading frame of 1179 amino acids (Fig. 1A). This deduced Drosophila DG protein contains all the hallmarks of vertebrate DG: a mucin-like domain, a transmembrane domain and a C-terminal region with WW-, SH2- and SH3-binding domains (Fig. 1B,D). The best conserved region between human and Drosophila is the C-terminal half of the protein showing 31% identity (Fig. 1B). The last 12 amino acids of the C terminus include the WW domain-binding motif (PPxY), which is the Dystrophin binding site. Of 12 amino acids within the C terminus, 10 are perfectly conserved in Drosophila (Fig. 1C). Vertebrate DG contains a second PPxY motif in its cytoplasmic domain, which is also conserved in Drosophila. In addition, two of the six putative SH3 binding sites and all three SH2-binding sites in the cytoplasmic domain of vertebrate DG can be found in Drosophila (Fig. 1D). The putative C. elegans homolog DGN-1 (T21B6.1) shows 20% identity to Drosophila in the C-terminal half. However, T21B6.1 contains no mucin-like domain, Dystrophin-binding site or second PPxY motif (Fig. 1D).

To analyze the expression pattern of DG protein, we raised antibodies against the cytoplasmic domain. Five major bands can be detected on a western blot of wild-type embryonic extracts: 75 kDa, 105 kDa, 120 kDa, 180 kDa and 200 kDa (Fig. 1E). None of these major bands could be seen in the extracts from the deficiency [Df(2R)JP4, Df(2R)JP6) embryos that completely delete the Dg locus, suggesting that all five forms are specific for DG (Fig. 1E)]. Strong Dg mutants were isolated by imprecise excisions of EP(2)2241 element and by generating a transgenic line expressing a double-stranded DG-RNA construct that destroys DG RNA by RNAi-mechanism (Kennerdell and Carthew, 2000Go) (Fig. 1A). In Dg248 or Dg323 mutant embryos, of the five major bands derived from the Dg locus only the 105 kDa band can be detected weakly (Fig. 1E), indicating that the level of DG expression is highly reduced in these mutants. Furthermore, to test the specificity of the antibodies in tissue samples we analyzed the expression in the follicle cell epithelium. A high level of DG is observed on the basal side of the epithelium, while a lower level is detected on the apical side. This signal is absent in follicle cell clones homozygous for Dg248 or Dg323, suggesting that the signal observed with the antibody in the tissue is specific for DG (arrow in Fig. 1F). Similarly, Dystroglycan protein level was highly reduced or patchy because of the expression of DG-RNAi construct (tubP-Gal4/dsDG) in follicle cells (Fig. 1G and data not shown).

Dystroglycan is required for apical-basal polarity in epithelial cells
Since DG is highly expressed in the follicle cells, we first asked whether Drosophila DG plays a role in establishing or maintaining epithelial morphology in this tissue. The follicle cell epithelium (FE) has a typical apical-basal polarity, with its apical side facing the germline cells (Fig. 2A). As all follicle cells are derived from two to three somatic stem cells, mosaic analysis provides an excellent tool with which to study gene functions in epithelial development (Margolis and Spradling, 1995Go).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 2. Dystroglycan function is required for apicobasal polarity in epithelial cells. (A) Schematic drawing of an ovariole and an eye-antennal imaginal disc. The ovariole contains egg chambers at different developmental stages (st). A layer of somatically derived follicle cells (FC), the majority of which have a typical epithelial apicobasal polarity, covers the germline cells (GC). Epithelial cells in the imaginal discs also show apical-basal polarity. (B-D) Mosaic analysis of Dg mutations. GFP in green marks wild-type cells. (E-G') RNAi analysis. (B) In a Dg mutant clone (broken lines in B, Dg248), the apicobasal polarity of the FE is disrupted, as mutant cells form a multi-layer epithelium (white arrow) and also cause discontinuance in the epithelium (yellow arrow) (red, actin; blue, DNA). White arrowheads show the wild-type region. (C,C') In a Dg323 follicle cell clone where follicle cells have not lost their columnar shape yet, an apical marker Dlt (red in C and white in C') is detected at both the apical and basal (white arrow in C and green arrow in C') side. C' is an enlarged view of the mutant clone region (broken yellow line) and vicinity shown in C. (D) In a Dg248 clone in an antennal imaginal disc (inset, the white box indicates where the mutant clone is) Dlt (red) is also mislocalized, expanding from the apical (arrowhead) to lateral side (arrow). (E) Multi-layered FE is also detected in tubPGal4/dsDG flies. (F,F',F'') An apical marker ßH-Spec (red; F shows the wild-type pattern, arrow) is mislocalized to the basal side (arrowheads in F' and F'') in dsDG follicle cells. F'' shows a more severe loss-of-polarity phenotype than does F'. (G,G') A basolateral marker, Dlg (red in G shows the wild-type pattern; arrow), is greatly reduced at the basolateral membrane (arrow in G'). DNA is shown in blue at B and E-G'.

 

We employed the FLP/FRT system (Xu and Rubin, 1993Go) to generate follicle cell clones of all three Dg alleles and applied the Gal4/UAS-mediated RNAi technique (Kennerdell and Carthew, 2000Go) to silence DG expression in all follicle cells (tubP-Gal4/dsDG). Similar phenotypes are observed in these different Dg mutant backgrounds. Some mutant cells lost their epithelial appearance and formed multiple layers (Fig. 2B,E), a typical terminal phenotype for polarity defects in epithelial cells. Within the multi-layer groups, the mutant cells from the mosaic egg chambers were frequently excluded from the layer that contacts the germline cells. Discontinuity of the epithelium was also visible in egg chambers containing Dg follicle cell clones but not in control egg chambers (Fig. 2B) (yellow arrow). These phenotypes are similar to loss-of-function phenotypes of crb, dlt, dlg or lgl in follicle cells (Tanentzapf et al., 2000Go; Bilder et al., 2000Go) and suggest that DG is required for proper epithelial polarity. The mutant follicle cells eventually died off, as we rarely saw mutant clones 9-10 days after heat shock, while sister clones (twin spots) were readily observed.

To characterize the apicobasal polarity defect in more detail, we examined the expression and distribution of molecular markers in mutant cells that still maintained their columnar shape (Table 1). In Dg follicle cell clones and tubP-Gal4/dsDG follicle cells, mislocalization of apical markers, Dlt and ß-Heavy-Spectrin (ßH-Spec) (Table 1) was observed. Instead of a strict apical localization, Dlt and ßH-Spec were present at both the apical and basal sides of the mutant epithelia (Figs 2C,C',F',F''). Dlg, a basolateral marker, exhibited a significant reduction of staining in the basolateral domain in Dg RNAi follicle cells (Fig. 2G'). The function of DG in apicobasal polarity formation was not restricted to the FE, as mislocalization of Dlt to the lateral and basal sides was also observed in the mutant epithelial cells in an antennal disc (Fig. 2D, arrows). Taken together, these results suggest that DG is required in different epithelial cells for proper formation or maintenance of apicobasal polarity.


View this table:
[in this window]
[in a new window]
 
Table 1. Nomenclature and putative gene functions for molecular markers used in this study

 

Overexpression of Dystroglycan in epithelial cells disrupts the localization of apical markers
To ask whether DG, when overexpressed, is sufficient to interfere with the epithelial cell polarity we used two UAS constructs, the full-length DG-construct (UAS-DG; Fig. 3A) and the short construct with cytoplasmic and transmembrane domains (UAS-DGcyto; Fig. 3B) and expressed them in the FE and in the embryonic salivary glands (Fig. 3). Both constructs expressed proteins of the expected sizes (Fig. 3A,B) and were induced by the following Gal4 driver lines: daughterlessGal4 (daGal4), for maternal expression: elavGal4, for the salivary gland expression; and the flip-out Gal4 system (Pignoni and Zipursky, 1997Go) for the FE expression. Similar defects in epithelial polarity were observed with all three drivers.



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 3. Ectopic expression of Dystroglycan interferes with epithelial cell polarity. (A) A schematic drawing of the UAS-DG construct and a Western blot to detect overexpression of UAS-DG driven by a Gal4 driver. (B) UAS-DGcyto contains the cytoplasmic and the transmembrane domain of DG linked to a FLAG-tag. Western blot analysis of UAS-DGcyto (20kDa) driven by daGal4 using anti-Flag antibody. (C) Drawing of an embryo at stage 13 to show the location of the salivary gland. The apical surface of the salivary epithelium is indicated by green line (in the center of the salivary gland). (D) A Nomarski image of a wild-type embryo at stage 12-13 stained with the Crb antibody, which shows apical staining (arrow). (E) Stage 13 embryo derived from da-GAL4 x UAS-DG cross. No Crb staining in the salivary gland can be detected (arrow). Notice that Crb staining in the pharynx is normal (arrowhead). (F) An enlarged drawing of an embryonic salivary gland at stage 13. The apical surface of the epithelial cells is shown in green. (G) A confocal image of the wild-type salivary gland around stage 13 stained with Crb (green) and DG (red) antibodies. Wild-type DG expression is below detection level. (H,H') Salivary gland of stage 13 embryo expressing UAS-DG driven by elav-GAL4. Notice the strong staining of DG (red, H) and the strong reduction of Crb (green, H; white, H') at the apical membrane. (I) Stage 10 follicle cells that overexpress UAS-DG (marked with GFP, green) accumulate high levels of DG protein (red) both in the apical (arrow) and basal surfaces. By contrast, stage 10 wild-type follicle cells express very low levels of DG (arrowhead). (J,J') Apical localization of ßH-Spec (red in J, white in J') is reduced in DG-overexpressing follicle cells (green; arrow). (K,K') Overexpression of DG in follicle cells also causes reduction (arrow) of the apical localization (arrowhead) of Baz (red in K, white in K'). (L) Summary of the localization of apical markers (red line) in the wild-type (i), Dg mutant epithelial cell clones (ii) and cells that overexpress DG (iii). Apical markers are expanded to the basolateral surface of the epithelium in Dg mutant clones, and their apical localization is substantially reduced because of DG overexpression.

 

In wild-type salivary glands, Crb was localized to the apical membrane of the epithelium, facing the lumen of the gland (Fig. 3D,G), while DG expression was undetectable (Fig. 3G). Embryos that overexpress DG showed strong ectopic DG staining on both the apical and basolateral membranes of the salivary gland (Fig. 3H). In about 75% of these salivary glands, the expression of Crb was strongly reduced (n=50; Fig. 3E,H,H'). Whereas Crb localization was disrupted by overexpression of full-length DG (UAS-DG), it was unaffected by overexpression of the form of DG lacking the extracellular domain (UAS-DGcyto; data not shown). These results suggest that the mislocalization of Crb was not due to nonspecific interference with the secretory apparatus but due to a defect on cell polarity. The lateral membrane domain was unaffected as assayed by the localization of Neurotactin, a lateral marker (Table 1; data not shown). As seen in the salivary glands, we found that follicle cells that overexpressed DG (Fig. 3I, arrow) lost the apical markers: ßH-Spec and Bazooka (Baz), while normal apical localization of these proteins was observed in neighboring wild-type cells (Fig. 3J,J',K,K'; Table 1). Again, overexpression of the DGcyto-form did not cause any obvious defects in the follicle epithelial polarity.

Dystroglycan is required in the germline for oocyte polarity
As Laminin A is required in the posterior follicle cells for proper oocyte polarity at stages 7-10 (Deng and Ruohola-Baker, 2000Go), we attempted to ask whether DG functions in the germline cells to receive the polarity signal from the Laminin ECM by clonal analysis. Unfortunately, egg chambers bearing germline clones of all deletion alleles are arrested at previtellogenic stages (Fig. 4A, arrow), prior to the stage we could detect signaling between the posterior follicle cells and the oocyte. Therefore, we concentrated on analyzing the establishment of oocyte polarity in earlier stages, a process that is marked by a posterior movement of the MTOC (Fig. 4B,C). During these stages, a low-level expression of DG is detected at the oocyte membrane (data not shown).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 4. Dystroglycan is required for the establishment of oocyte polarity. (A) Dg germline clones are usually arrested at around stage 6 of oogenesis (arrow, a Dg248 germline clone is smaller than the two neighboring egg chambers). (B,C) Nod-ß-Gal (red), a marker that co-localizes with the MTOC in early oocytes, moves from the anterior of the oocyte (red in B) to the posterior and stays there until stage 6 (arrow in C). (D,E) In Dg248 germline clones, Nod-ß-Gal (red) is frequently mislocalized (arrows). (F) ORB (red), is also localized to the posterior of the oocyte at stages 2-6 (arrow). (G) In a Dg323 germline clone, ORB (red) is mislocalized (surrounds the oocyte nucleus, arrow) or undetectable (not shown). (H,I) DG is required for the enrichment of the actin cytoskeleton in the oocyte (marked by an asterisk). In the wild-type oocyte (H), actin (red; white in inset) is enriched at the posterior of the oocyte (arrows). In a Dg323 germline clone (I), actin (red; white in inset) failed to be enriched at the posterior of the oocyte (arrow), and ring canals accumulate tightly in the anterior of the oocyte (arrowhead). (J) Schematic drawing depicting the anterior-to-posterior migration of MTOC in an early wild-type oocyte. This movement is defective and correlates with defect in posterior enrichment of actin in Dg germline clones (K).

 

To detect whether the early oocyte polarity is properly established in Dg germline clones, we examined the localization of two MTOC markers, Nod-ß-Galactosidase (Nod-ß-Gal) and ORB (Table 1), which (in the wild type) are localized at the anterior of the oocyte at stage 1 (Fig. 4B) and move to the posterior in later stages (Fig. 4C,F). Mislocalization of both markers was observed in the mutant germline clones [Nod-ß-Gal mislocalization: 60%, n=32; ORB mislocalization: 76% in Dg323 (n=25); 60% Dg248 (n=38)]. In half of the mislocalization cases, the markers either remained in the anterior of the oocyte or surrounded the nuclei after stage 3 (Fig. 4D,E,G). The remaining egg chambers exhibited diffuse staining (data not shown). Compared with wild type, the staining was significantly reduced. Furthermore, no accumulation of {alpha}-tubulin was observed in the mutant oocytes, while normal posterior accumulation was detected in the control oocytes between stages 2 and 6 (data not shown) (Clegg et al., 2001Go; Cox et al., 2001aGo). In conclusion, these data suggest that DG is required in the early oocyte for the maintenance or translocation of the MTOC from the anterior to the posterior of the oocyte (Fig. 4J-K). This step is crucial in establishing AP polarity in the oocyte and the future embryo (Riechmann and Ephrussi, 2001Go).

Enrichment of the actin cytoskeleton in the oocyte is disrupted in Dystroglycan germline clones
Although links between DG and MT cytoskeleton have been suggested (Lumeng et al., 1999Go), the linkage between DG and the actin cytoskeleton via dystrophin/utrophin is far more evident. We therefore examined the actin distribution in the developing oocyte in the wild-type and Dg germline clones. Previous studies demonstrated that actin is enriched at the cortex of early wild-type oocytes (Fig. 4H) (González-Reyes and St Johnston, 1998Go). Interestingly, this actin enrichment is disrupted in the Dg germline clones (Fig. 4I). In addition, `spreading' of the ring canals normally observed in stage 1-2 oocyte is not detected in egg chambers that lack germline DG (Fig. 4I, arrowhead).

Basal actin array is disrupted non-cell-autonomously in Dystroglycan follicle cell clones
At the basal side of the FE, actin filaments have a planar polarity that is perpendicular to the long axis, the AP axis, of the egg chamber (Fig. 5A,C). Integrins and receptor tyrosine phosphatase Lar are involved non-cell-autonomously in organizing this basal actin orientation (Bateman et al., 2001Go). In our analysis of the ßH-Spec staining in follicle cells that express dsDG, we noticed that ßH-Spec is mislocalized to the basal side of the FE to bind the basal actin fibers. Noticeably, the fibers decorated with ßH-Spec in different follicle cells appeared to be oriented in a random fashion. To test whether this defect reflects problems in basal actin orientation, we analyzed planar polarity of the actin arrays in control egg chambers and in the mutant Dg follicle cell clones. Instead of normal perpendicular orientation to the AP axis, random misorientation was observed in the Dg mutant egg chambers (Fig. 5B,D). Moreover, the basal actin fibers in follicle cells adjacent to the mutant clones were also misoriented, revealing a non-cell autonomous requirement for DG function (Fig. 5E,F). Although the actin filaments were not organized perpendicular to the AP axis in the mutant cells, they aligned with the neighboring cells, suggesting that some communication of the orientation from one cell to the other still existed. These results suggest that DG has a non-cell-autonomous role in organizing the actin cytoskeleton in the follicle cells, similar to other receptors such as Integrin and Lar. Losing any one of these receptors still allows some orientation transfer but the global direction is defective (Frydman and Spradling, 2001Go; Bateman et al., 2001Go) (this study) suggesting that multiple receptor-ECM interactions are required for precise orientation.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 5. Laminin and basal actin organization in the follicle cell epithelium is disrupted in a Dystroglycan mutant clone. (A) Drawing of a wild-type egg chamber with a basal surface view of three follicle cells. The basal actin fibers (red lines) in these cells are arrayed at a direction perpendicular to the long (AP) axis of the egg chamber from stage 8 to 12. Laminin stripes in the ECM (blue lines) shows the same orientation. (B) Drawing of a Dg follicle cell clone with misoriented basal actin fibers and Laminin stripes. (C) Phalloidin staining shows the basal actin array in the wild-type FE. Three cells are outlined. (D) In a Dg323 mutant egg chamber, the basal actin organization is disrupted. (E,F) The role of DG in basal actin organization is non-cell-autonomous, as cells adjacent to the follicle cell clone (broken outline) also frequently show a disrupted basal actin distribution (arrow in F). In wild-type egg chambers, Laminin is oriented in stripes (surface stripes in G), similar to the basal actin. This Laminin orientation is disrupted in Dg mutant clones (H). The left-hand image in H shows where the mutant follicle cell clone (black area) is located. (I) At stage 10, Laminin is mainly detected at the basal surface (arrowhead) of the wild-type FE (area lacking green). However, overexpression of DG (marked by co-expression of GFP, green) causes accumulation of Laminin ECM to the apical and lateral surfaces (arrow). (J) A model for Dystroglycan function in planar polarity (basal actin organization). In this study, we have shown that the DG function is involved in cell-cell communication, which is essential for basal actin planar polarity. This communication probably involves the cyto-architecture of the Laminin ECM. DG directs the orientation of the Laminin stripes. This information is transmitted into a neighboring cell to coordinate the orientation of the actin fibers. GFP (green) marks the wild-type cells in E and H; Actin is white in C,D,F; Laminin is turquoise in G,H.

 

Previous data have shown that Laminin stripes in the basement membrane of the FE are organized in the same orientation as the basal actin fibers (Gutzeit et al., 1991Go; Bateman et al., 2001Go) (Fig. 5C,G), suggesting an instructive interaction between the actin cytoskeleton and the ECM through a receptor(s). One explanation for the non-cell-autonomous role of DG in basal actin organization is that DG functions through organizing the Laminin ECM to affect the basal actin in the neighboring cell. To test this idea further, we analyzed the orientation of Laminin stripes in the wild-type and the Dg mutant follicle cells. Instead of the orientation perpendicular to the AP axis in the wild type (Fig. 5G), overall reduction and misorganization of Laminin ECM occurred in the mutant clone and neighboring regions (Fig. 5H).

To test whether DG is sufficient to organize the Laminin ECM, we asked whether overexpression of DG had any effect on Laminin localization. In stage 10 follicle cells, the majority of the Laminin staining is observed at the basal side (Fig. 5I, arrowhead). Noticeably, Laminin is accumulated at the lateral and apical sides of the follicle cells that overexpressed DG (Fig. 5I, arrow), which is consistent with the fact that high-level DG expression is visible at the apical and basal surfaces of these cells (Fig. 3I). This result suggests that DG can effectively organize the Laminin ECM in Drosophila. The dotted instead of stripe/line appearance of ectopic Laminin because of DG overexpression is consistent with a previous report that DG is required for Laminin binding, while Integrin is required for further formation of the Laminin stripe/line-like structures (Henry et al., 2001bGo).


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Disruption of DGC function is tightly linked with the pathogenesis of various forms of muscular dystrophy. Previous work has revealed a central role for the transmembrane protein DG in this protein complex (reviewed by Winder, 2001Go). The cellular function and regulation of DG interactions remain elusive, however. In this paper, we describe the isolation and analysis of Drosophila mutants of Dg. Using genetic tools in this model organism, we show that DG is required cell-autonomously for polarizing two different cell types: epithelial cells and the oocyte. In Dg mutant epithelial cells, apicobasal polarity is disrupted, while in oocytes, anteroposterior polarity is abnormal. Loss of DG function in follicle and disc epithelia results in expansion of apical markers to the basal side of the cells and overexpression results in a seemingly opposite phenotype, reduced localization of apical markers. Dg mutations in the germline, however, disturb the enrichment of the oocyte cortical actin and the movement of the MTOC to the posterior oocyte: a process that is the prerequisite for the establishment of all polarity within the egg chamber and embryo. In addition, DG has a non-cell-autonomous effect on the planar polarity of basal F-actin in follicle cells. The non-cell-autonomous phenotype probably results from a lack of instructive interaction between the actin cytoskeleton and the ECM, as DG is required for and sufficient in organizing Laminin in follicle cells (Fig. 5H-J).

Comparison of Drosophila Dystroglycan to its mammalian orthologs
Drosophila DG contains most of the hallmarks of vertebrate DG, but is significantly longer than its vertebrate orthologs, due to a ~250 amino acid duplication in the extracellular domain. The N-terminal half of fly DG harbors a mucin-like domain, similar to vertebrate DG, but is otherwise only weakly conserved. As the mucin-like sugars have been implicated in Laminin binding it is interesting to note that splicing variants of DG that lack exon 8, also lack most of this domain. In addition, altered glycosylation of DG is related to two forms of congenital muscular dystrophy (Brockington et al., 2001Go; Hayashi et al., 2001Go; Michele et al., 2002Go; Moore et al., 2002Go), and reduced expression of DG is observed in a mouse model of Duchene's muscular dystrophy (Ervasti and Campbell, 1993Go).

The C-terminal half of Drosophila DG is conserved with 31% identity (46% similarity, Fig. 1A,B). Especially well conserved are the protein-protein interaction sites in the cytoplasmic domain of DG, including the binding site for Dystrophin. Seven of the eight amino residues, which are crucial for Dystrophin binding (Huang et al., 2000Go) are conserved in Drosophila. Recent studies demonstrate that phosphorylation of the tyrosine residue within the dystrophin/utrophin binding motif can interfere with binding to utrophin, leading to recruitment of SH2 domain proteins (Sotgia et al., 2001Go; Ilsley et al., 2002Go). The putative SH2-binding motif involved in this interaction is conserved in Drosophila. The third protein-protein interaction described for vertebrate DG is the binding of the SH2-SH3 adaptor GRB2. GRB2 helps initiate the Ras-MAP kinase signal transduction cascade and is involved in controlling cytoskeletal organization (Yang et al., 1995Go). However, the SH3-binding motif, thought to mediate GRB2 binding, is not fully conserved in Drosophila.

The role of Dystroglycan in epithelial polarity formation
Reduced expression of DG is often associated with tumor formation, suggesting that DG can act as a tumor suppressor (Henry et al., 2001aGo). It is likely that loss of DG function in some cancers leads to abnormal cell-ECM interactions and thus contributes to progression to a metastatic state. Defects in epithelial interactions normally result in cell death; when associated with abnormal cell growth and division; however, such defects could induce metastasis. Our analysis supports this hypothesis: lack of DG function in Drosophila results in tumor-like structures (Fig. 2B) and abnormal cell movement because of the lack of epithelial integrity and cellular polarity.

Reduction of DG function expands the apical domain and overexpression of DG reduces this domain in epithelial cells. In Dg loss-of-function follicle cell clones, a component of the Lgl-complex, Dlg, is mislocalized. This mislocalization could explain the expansion of apical markers in the clones, as Dlg and Scrib are each required for the lateral localization of each other and their function is essential to restrict the apical markers Crb and Dlt to the apical surface (Bilder et al., 2000Go; Bilder and Perrimon, 2000Go). Further experiments are directed to distinguish whether mislocalization of Dlg is caused directly by lack of physical interaction with DG or indirectly by lack of proper cytoskeletal arrangements.

The role of Dystroglycan in oocyte polarity formation
Drosophila oocyte polarity is essential for morphogen localization and therefore for the formation of the major body axes. The establishment of oocyte polarity is a gradual process that involves multiple steps (reviewed by Riechmann and Ephrussi, 2001Go). Key events in the process are cytoskeletal rearrangements. First, the MTOC is present in the anterior region of an early oocyte. By stage 3, the first rearrangement has occurred and the MTOC is positioned in the posterior portion of the developing oocyte. By the end of stage 6, a signal from the posterior follicle cells has initiated a new MT rearrangement, the posterior MTOC disappears and a new anterior MTOC forms. Although this signaling pathway remains a mystery, several molecules including Laminin A have been shown to be involved (Riechmann and Ephrussi, 2001Go; Deng and Ruohola-Baker, 2000Go). As for the first rearrangement, genes encoding the Drosophila Par3/Par6/aPKC-complex, Par-1, and Maelstrom are required, (Cox et al., 2001aGo; Cox et al., 2001bGo; Huynh et al., 2001aGo; Huynh et al., 2001bGo; Clegg et al., 2001Go; Vaccari and Ephrussi, 2002Go). However, the mechanism for the MTOC movement or anchoring is not clear. We show that DG, similar to the Par proteins, is required in the germline for this first rearrangement step. As Dg germline clones also exhibited a defect in cortical actin enrichment in the oocyte, it is possible that the cortical actin plays an important role in MTOC movement and/or anchoring. Alternatively, as DGC contains proteins that can interact with either actin or microtubular cytoskeletons, it could play a role in coordinating actin and microtubule functions in this process.

Molecular similarities in the establishment of epithelial and oocyte polarity
The fact that DG is required for both epithelial and oocyte polarity re-iterates the idea that common strategies may exist for polarizing these two very different cell types. In addition to DG, Par proteins also act in polarity formation in both cell types, suggesting that the Par proteins and DG complex have functional similarities. Interestingly, DG can affect localization of the Par complex as one of the members, Baz (Par3), is mislocalized when DG is overexpressed. In addition, both Par-proteins and the DG-complex interact with molecules that can associate with either actin or microtubular cytoskeletons. Par-1 associates with Myosin II heavy chain and also phosphorylates a MT-associated protein (Drewes et al., 1997Go; Guo and Kemphues, 1996Go). DG can interact with actin through Dystrophin-like proteins. Furthermore, the Dystrophin-associated protein, Syntrophin, interacts with MT-associated proteins via a two-hybrid assay (Lumeng et al., 1999Go). It is possible that both Par proteins and the DG complex facilitate interactions between actin and microtubules and that these interactions between the two cytoskeletal systems are key regulators for establishment of polarity in both cell types.

Cell non-autonomous phenotype and the function of DG in signaling to neighboring cells
To our surprise, Dg mutant follicle cell generated actin defects in neighboring cells; the basal actin was misoriented in adjacent follicle cells (Fig. 5F). How would a defective DG in one cell alter the dynamics of actin organization in the neighboring cell? We propose that the interaction between ECM and DG is bi-directional (Fig. 5J): on one hand, DG organizes the Laminin ECM architecture (Henry et al., 2001bGo; this study), suggesting that a defect in DG will be transmitted to a defect in ECM organization; on the other hand, a defective Laminin lattice will extend to the surface of the neighboring cell and there this architectural information could be transmitted to the cellular actin cytoskeleton by DG in the neighboring cell (Colognato et al., 1999Go). Three pieces of evidence support this hypothesis. First, Drosophila DG is capable of organizing the Laminin lattice (Fig. 5H,I). Second, the Laminin lattice in the basal side of follicle cells is oriented in the same orientation as the underlying basal actin lattice (Fig. 5C,G) (Gutzeit et al., 1991Go; Bateman et al., 2001Go). Third, Laminin, similar to DG, could also be involved in basal actin organization (Bateman et al., 2001Go; Frydman and Spradling, 2001Go). Interestingly, two other Laminin receptors, Integrin and Lar, are also required for basal actin planar polarity in follicle cells (Bateman et al., 2001Go; Frydman and Spradling, 2001Go). It is possible that one connector alone would not give enough rigidity or allow enough flexibility in relaying information between the ECM and the basal actin.

In summary, we have shown that DG has two separate functions in cell polarity: cell autonomous in apical-basal and anteroposterior polarity, and non-cell-autonomous in planar polarity. Future research aims to take advantage of Drosophila as a model organism to genetically dissect the partners of DG in these two functions.


    ACKNOWLEDGMENTS
 
We thank Drs Chamberlain and Hauschka for helpful discussions during this study. We are grateful for technical help from C. Althauser, M. Mogren and T. Ho. We also thank Drs Hauschka, Angelo, Campbell, Berg, Cheng, Schaeffer and Baker for helpful comments on the manuscript; and Drs Bhat, Bilder, Bryant, Edgar, Fessler, Giniger, Goodman, Knoblich, Knust, Laverty, Oda, Peifer, Parkhurst, Schedl, Tepass, Thomas, Volk, Warrior and Wodarz; the Bloomington stock center; and Developmental Studies Hybridoma Bank for fly-lines and antibodies. This work was supported by grants from Swedish natural science research council (NFR) to S. B.; Crafoodska stiftelsen and Kungl Fysiografiska Sällskapet i Lund to M. S.; and by grants from the National Institutes of Health, American Heart Association, American Cancer Society and Pew Memorial Trust and Pew Scholarship in the Biomedical Sciences to H.R.-B.


    Footnotes
 
* These authors contributed equally to this work Back


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Bachmann, A., Schneider, M., Theilenberg, E., Grawe, F. and Knust, E. (2001). Drosophila Stardust is a partner of Crumbs in the control of epithelial cell polarity. Nature 414,638 -643.[CrossRef][Medline]
Bateman, J, Reddy, R. S., Saito, H. and van Vactor, D. (2001). The receptor tyrosine phosphatase Dlar and integrins organize actin filaments in the Drosophila follicular epithelium. Curr. Biol. 11,1317 -1327.[CrossRef][Medline]
Baum, B., Li, W. and Perrimon, N. (2000). A cyclase-associated protein regulates actin and cell polarity during Drosophila oogenesis and in yeast. Curr. Biol. 10,964 -973.[CrossRef][Medline]
Bernards, A. and Hariharan, I. K. (2001). Of flies and men — studying human disease in Drosophila. Curr. Opin. Genet. Dev. 11,274 -278.[CrossRef][Medline]
Bhat, M. A., Izaddoost, S., Lu, Y., Cho, K. O., Choi, K. W. and Bellen, H. J. (1999). Discs Lost, a novel multi-PDZ domain protein, establishes and maintains epithelial polarity. Cell 96,833 -845.[CrossRef][Medline]
Bilder, D. and Perrimon, N. (2000). Localization of apical epithelial determinants by the basolateral PDZ protein Scribble. Nature 403,676 -680.[CrossRef][Medline]
Bilder, D., Li, M. and Perrimon, N. (2000). Cooperative regulation of cell polarity and growth by Drosophila tumor suppressors. Science 289,113 -116.[Abstract/Free Full Text]
Brockington, M., Blake, D. J., Prandini, P., Brown, S. C., Torelli, S., Benson, M. A., Ponting, C. P., Estournet, B. and Romero, N. B. et al. (2001). Mutations in the fukutin-related protein gene (FKRP) cause a form of congenital muscular dystrophy with secondary laminin 2 deficiency and abnormal glycosylation of Dg. Am. J. Hum. Genet. 69,1198 -1209.[CrossRef][Medline]
Burton, E. A. and Davies, K. E. (2002). Muscular dystrophy — reason for optimism? Cell 108, 5-8.[CrossRef][Medline]
Clark, I. E., Jan, L. Y. and Jan, Y. N. (1997). Reciprocal localization of Nod and kinesin fusion proteins indicates microtubule polarity in the Drosophila oocyte, epithelium, neuron and muscle. Development. 124,461 -470.[Abstract]
Clegg, N. J., Findley, S. D., Mahowald, A. P. and Ruohola-Baker, H. (2001). Maelstrom is required to position the MTOC in stage 2-6 Drosophila oocytes. Dev. Genes Evol. 211,44 -48.[CrossRef][Medline]
Colognato, H., Winkelmann, D. A. and Yurchenco, P. D. (1999). Laminin polymerization induces a receptor-cytoskeleton network. J. Cell Biol. 145,619 -631.[Abstract/Free Full Text]
Cox, D. N., Lu, B., Sun, T. Q., Williams, L. T. and Jan, Y. N. (2001a). Drosophila par-1 is required for oocyte differentiation and microtubule organization. Curr. Biol. 11,75 -87.[CrossRef][Medline]
Cox, D. N., Seyfried, S. A., Jan, L. Y. and Jan, Y. N. (2001b). Bazooka and atypical protein kinase C are required to regulate oocyte differentiation in the Drosophila ovary. Proc. Natl. Acad. Sci. USA 98,14475 -14480.[Abstract/Free Full Text]
Deng, W. M. and Ruohola-Baker, H. (2000). Laminin A is required for follicle cell-oocyte signaling that leads to establishment of the anterior-posterior axis in Drosophila. Curr. Biol. 10,683 -686.[CrossRef][Medline]
Deng, W. M., Althauser, C. and Ruohola-Baker, H. (2001). Notch-Delta signaling induces a transition from mitotic cell cycle to endocycle in Drosophila follicle cells. Development 128,4737 -4746.[Abstract/Free Full Text]
Drewes, G., Ebneth, A., Preuss, U., Mandelkow, E. M. and Mandelkow, E. (1997). MARK, a novel family of protein kinases that phosphorylate microtubule-associated proteins and trigger microtubule disruption. Cell 89,297 -308.[CrossRef][Medline]
Durbeej, M. and Campbell, K. P. (1999). Biochemical characterization of the epithelial Dg complex. J. Biol. Chem. 274,26609 -26616.[Abstract/Free Full Text]
Durbeej, M., Larsson, E., Ibraghimov-Beskrovnaya, O., Roberds, S. L., Campbell, K. P. and Ekblom, P. (1995). Non-muscle alpha-dystroglycan is involved in epithelial development. J. Cell Biol. 130,79 -91.[Abstract/Free Full Text]
Erdelyi, M., Michon, A. M., Guichet, A., Glotzer, J. B. and Ephrussi, A. (1995). Requirement for Drosophila cytoplasmic tropomyosin in oskar mRNA localization. Nature 377,524 -527.[CrossRef][Medline]
Ervasti, J. M. and Campbell, K. P. (1993). Dystrophin-associated glycoproteins: their possible roles in the pathogenesis of Duchenne muscular dystrophy. Mol. Cell. Biol. Hum. Dis. Ser. 3,139 -166.[Medline]
Fessler, L. I., Campbell, A. G., Duncan, K. G. and Fessler, J. H. (1987). Drosophila laminin: characterization and localization. J. Cell Biol. 105,2383 -2391.[Abstract/Free Full Text]
Frydman, H. M. and Spradling, A. C. (2001). The receptor-like tyrosine phosphatase lar is required for epithelial planar polarity and for axis determination within Drosophila ovarian follicles. Development. 128,3209 -3220.[Abstract/Free Full Text]
González-Reyes, A. and St Johnston, D. (1998). The Drosophila AP axis is polarised by the cadherin-mediated positioning of the oocyte. Development 125,3635 -3644.[Abstract]
Guo, S. and Kemphues, K. J. (1996). A non-muscle myosin required for embryonic polarity in Caenorhabditis elegans. Nature 382,455 -458.[CrossRef][Medline]
Gutzeit, H. O., Eberhardt, W. and Gratwohl, E. (1991). Laminin and basement membrane-associated microfilaments in wildtype and mutant Drosophila ovarian follicles. J. Cell Sci. 100,781 -788.[Abstract/Free Full Text]
Halsell, S. R., Chu, B. I. and Kiehart, D. P. (2000). Genetic analysis demonstrates a direct link between rho signaling and nonmuscle myosin function during Drosophila morphogenesis. Genetics 155,1253 -1265.[Abstract/Free Full Text]
Hayashi, Y. K., Ogawa, M., Tagawa, K., Noguchi, S., Ishihara, T., Nonaka, I. and Arahata, K. (2001). Selective deficiency of —dystroglycan in Fukuyama-type congenital muscular dystrophy. Neurology 57,115 -121.[Abstract/Free Full Text]
Henry, M. D. and Campbell, K. P. (1999). Dystroglycan inside and out. Curr. Opin. Cell Biol. 11,602 -607.[CrossRef][Medline]
Henry, M. D., Cohen, M. B. and Campbell, K. P. (2001a). Reduced expression of dystroglycan in breast and prostate cancer. Hum. Pathol. 32,791 -795.[CrossRef][Medline]
Henry, M. D., Satz, J. S., Brakebusch, C., Costell, M., Gustafsson, E., Fassler, R. and Campbell, K. P. (2001b). Distinct roles for dystroglycan, beta1 integrin and perlecan in cell surface laminin organization. J. Cell Sci. 114,1137 -1144.[Abstract]
Hong, Y., Stronach, B., Perrimon, N., Jan, L. Y. and Jan, Y. N. (2001). Drosophila Stardust interacts with Crumbs to control polarity of epithelia but not neuroblasts. Nature 414,634 -638.[CrossRef][Medline]
Hortsch, M., Patel, N. H., Bieber, A. J., Traquina, Z. R. and Goodman, C. S. (1990). Drosophila neurotactin, a surface glycoprotein with homology to serine esterases, is dynamically expressed during embryogenesis. Development 110,1327 -1340[Abstract/Free Full Text]
Huang, X., Poy, F., Zhang, R., Joachimiak, A., Sudol, M. and Eck, M. J. (2000). Structure of a WW domain containing fragment of dystrophin in complex with beta-dystroglycan. Nat. Struct. Biol. 7,634 -638.[CrossRef][Medline]
Huynh, J., Petronczki, M., Knoblich, J. A. and St Johnston, D. (2001a). Bazooka and PAR-6 are required with PAR-1 for the maintenance of oocyte fate in Drosophila. Curr. Biol. 11,901 -906.[CrossRef][Medline]
Huynh, J. R., Shulman, J. M., Benton, R. and St Johnston, D. (2001b). PAR-1 is required for the maintenance of oocyte fate in Drosophila. Development 128,1201 -1209.[Abstract]
Ibraghimov-Beskrovnaya, O., Ervasti, J. M., Leveille, C. J., Slaughter, C. A., Sernett, S. W. and Campbell, K. P. (1992). Primary structure of dystrophin-associated glycoproteins linking dystrophin to the extracellular matrix. Nature 355,696 -702.[CrossRef][Medline]
Ilsley, J. L., Sudol, M. and Winder, S. J. (2002). The WW domain: Linking cell signalling to the membrane cytoskeleton. Cell Signal. 14,183 -189.[CrossRef][Medline]
Kennerdell, J. R. and Carthew, R. W. (2000). Heritable gene silencing in Drosophila using double-stranded RNA. Nat. Biotechnol. 18,896 -898.[CrossRef][Medline]
Lantz, V., Chang, J. S., Horabain, J. I., Bopp, D. and Schedl, P. (1994). The Drosophila orb RNA binding protein is required for the formation of the egg chamber and establishment of polarity. Genes Dev. 8,598 -613.[Abstract/Free Full Text]
Lee, T. and Luo, L. (1999). Mosaic analysis with a repressible neurotechnique cell marker for studies of gene function in neuronal morphogenesis. Neuron 22,451 -461.[CrossRef][Medline]
Lumeng, C., Phelps, S., Crawford, G. E., Walden, P. D., Barald, K. and Chamberlain, J. S. (1999). Interactions between beta 2-syntrophin and a family of microtubule-associated serine/threonine kinases. Nat. Neurosci. 2,611 -617.[CrossRef][Medline]
Margolis, J. and Spradling, A. (1995). Identification and behavior of epithelial stem cells in the Drosophila ovary. Development 121,3797 -3807.[Abstract]
Michele, D. E., Barresi, R., Kanagawa, M., Saito, F., Cohn, R. D., Satz, J. S., Dollar, J., Nishino, I., Kelley, R. I., Somer, H., Straub, V., Mathews, K. D., Moore, S. A. and Campbell, K. P. (2002). Post-translational disruption of dystroglycan-ligand interactions in congenital muscular dystrophies. Nature 418,417 -422.[CrossRef][Medline]
Moore, S. A., Saito, F., Chen, J., Michele, D. E., Henry, M. D., Messing, A., Cohn, R. D., Ross-Barta, S. E., Westra, S., Williamson, R. A., Hoshi, T. and Campbell, K. P. (2002). Deletion of brain dystroglycan recapitulates aspects of congenital muscular dystrophy. Nature 418,422 -425.[CrossRef][Medline]
Petronczki, M. and Knoblich, J. A. (2001). DmPAR-6 directs epithelial polarity and asymmetric cell division of neuroblasts in Drosophila. Nat. Cell Biol. 3, 43-49.[CrossRef][Medline]
Pignoni, F. and Zipursky, S. L. (1997). Induction of Drosophila eye development by decapentaplegic.Development 124,271 -278.[Abstract]
Riechmann, V. and Ephrussi, A. (2001). Axis formation during Drosophila oogenesis. Curr. Opin. Genet. Dev. 11,374 -383.[CrossRef][Medline]
Rørth, P. (1996). A modular misexpression screen in Drosophila detecting tissue-specific phenotypes. Proc. Natl. Acad. Sci. USA 93,12418 -12422.[Abstract/Free Full Text]
Sotgia, F., Lee, H., Bedford, M. T., Petrucci, T., Sudol, M. and Lisanti, M. P. (2001).. Tyrosine phosphorylation of beta-dystroglycan at its WW domain binding motif, PPxY, recruits SH2 domain containing proteins. Biochemistry 40,14585 -14592.[CrossRef][Medline]
Tanentzapf, G., Smith, C., McGlade, J. and Tepass, U. (2000). Apical, lateral, and basal polarization cues contribute to the development of the follicular epithelium during Drosophila oogenesis. J. Cell Biol. 151,891 -904.[Abstract/Free Full Text]
Tepass, U., Theres, C. and Knust, E. (1990). crumbs encodes an EGF-like protein expressed on apical membranes of Drosophila epithelial cells and required for organization of epithelia. Cell 61,787 -799.[CrossRef][Medline]
Tepass, U., Tanentzapf, G., Ward, R. and Fehon, R. (2001). Epithelial cell polarity and cell junctions in Drosophila. Annu. Rev. Genet. 35,747 -784.[CrossRef][Medline]
Thomas, G. H. and Kiehart, D. P. (1994). Beta heavy-spectrin has a restricted tissue and subcellular distribution during Drosophila embryogenesis. Development 120,2039 -2050.[Abstract]
Vaccari, T. and Ephrussi, A. (2002). The fusome and microtubules enrich Par-1 in the oocyte, where it effects polarization in conjunction with Par-3, BicD, Egl, and Dynein. Curr Biol. 12,1524 -1528.[CrossRef][Medline]
Williamson, R. A., Henry, M. D., Daniels, K. J., Hrstka, R. F., Lee, J. C., Sunada, Y., Ibraghimov-Beskrovnaya, O. and Campbell, K. P. (1997). Dystroglycan is essential for early embryonic development: disruption of Reichert's membrane in Dag1-null mice. Hum. Mol. Genet. 6,831 -841.[Abstract/Free Full Text]
Winder, S. J. (2001). The complexities of dystroglycan. Trends Biochem. Sci. 26,118 -124.[CrossRef][Medline]
Wodarz, A. (2002). Establishing cell polarity in development. Nat. Cell Biol. 4, E39-E44.[CrossRef][Medline]
Wodarz, A., Ramrath, A., Grimm, A. and Knust, E. (2000). Drosophila atypical protein kinase C associates with Bazooka and controls polarity of epithelia and neuroblasts. J. Cell Biol. 150,1361 -1374.[Abstract/Free Full Text]
Woods, D. F. and Bryant, P. J. (1991). The discs-large tumor suppressor gene of Drosophila encodes a guanylate kinase homolog localized at septate junctions. Cell 66,451 -464.[CrossRef][Medline]
Woods, D. F., Wu, J. W. and Bryant, P. J. (1997). Localization of proteins to the apico-lateral junctions of Drosophila epithelia. Dev. Genet. 20,111 -118.[CrossRef][Medline]
Xu, T. and Rubin, G. M. (1993). Analysis of genetic mosaics in developing and adult Drosophila tissues. Development 117,1223 -1237.[Abstract]
Yang, B., Jung, D., Motto, D., Meyer, J., Koretzky, G. and Campbell, K. P. (1995). SH3 domain-mediated interaction of dystroglycan and Grb2. J. Biol. Chem. 270,11711 -11714.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Cell Sci.Home page
I. Delon and N. H. Brown
The integrin adhesion complex changes its composition and function during morphogenesis of an epithelium
J. Cell Sci., December 1, 2009; 122(23): 4363 - 4374.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. A. Woolworth, G. Nallamothu, and T. Hsu
The Drosophila Metastasis Suppressor Gene Nm23 Homolog, awd, Regulates Epithelial Integrity during Oogenesis
Mol. Cell. Biol., September 1, 2009; 29(17): 4679 - 4690.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb. Perspect. Biol.Home page
S. Roth and J. A. Lynch
Symmetry Breaking During Drosophila Oogenesis
Cold Spring Harb Perspect Biol, August 1, 2009; 1(2): a001891 - a001891.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
K.-i. Takeuchi, Y. Nakano, U. Kato, M. Kaneda, M. Aizu, W. Awano, S. Yonemura, S. Kiyonaka, Y. Mori, D. Yamamoto, et al.
Changes in Temperature Preferences and Energy Homeostasis in Dystroglycan Mutants
Science, March 27, 2009; 323(5922): 1740 - 1743.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
A. M. O'Reilly, H.-H. Lee, and M. A. Simon
Integrins control the positioning and proliferation of follicle stem cells in the Drosophila ovary
J. Cell Biol., August 25, 2008; 182(4): 801 - 815.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
C. Medioni, M. Astier, M. Zmojdzian, K. Jagla, and M. Semeriva
Genetic control of cell morphogenesis during Drosophila melanogaster cardiac tube formation
J. Cell Biol., July 28, 2008; 182(2): 249 - 261.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Y. P. Wairkar, L. G. Fradkin, J. N. Noordermeer, and A. DiAntonio
Synaptic Defects in a Drosophila Model of Congenital Muscular Dystrophy
J. Neurosci., April 2, 2008; 28(14): 3781 - 3789.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. Akhavan, S. N. Crivelli, M. Singh, V. R. Lingappa, and J. L. Muschler
SEA domain proteolysis determines the functional composition of dystroglycan
FASEB J, February 1, 2008; 22(2): 612 - 621.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. J. Allikian, G. Bhabha, P. Dospoy, A. Heydemann, P. Ryder, J. U. Earley, M. J. Wolf, H. A. Rockman, and E. M. McNally
Reduced life span with heart and muscle dysfunction in Drosophila sarcoglycan mutants
Hum. Mol. Genet., December 1, 2007; 16(23): 2933 - 2943.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
N. Haines, S. Seabrooke, and B. A. Stewart
Dystroglycan and Protein O-Mannosyltransferases 1 and 2 Are Required to Maintain Integrity of Drosophila Larval Muscles
Mol. Biol. Cell, December 1, 2007; 18(12): 4721 - 4730.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. S. Yatsenko, E. E. Gray, H. R. Shcherbata, L. B. Patterson, V. D. Sood, M. M. Kucherenko, D. Baker, and H. Ruohola-Baker
A Putative Src Homology 3 Domain Binding Motif but Not the C-terminal Dystrophin WW Domain Binding Motif Is Required for Dystroglycan Function in Cellular Polarity in Drosophila
J. Biol. Chem., May 18, 2007; 282(20): 15159 - 15169.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
V. Mirouse, L. L. Swick, N. Kazgan, D. St Johnston, and J. E. Brenman
LKB1 and AMPK maintain epithelial cell polarity under energetic stress
J. Cell Biol., May 7, 2007; 177(3): 387 - 392.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. Hnia, G. Hugon, F. Rivier, A. Masmoudi, J. Mercier, and D. Mornet
Modulation of p38 Mitogen-Activated Protein Kinase Cascade and Metalloproteinase Activity in Diaphragm Muscle in Response to Free Radical Scavenger Administration in Dystrophin-Deficient Mdx Mice
Am. J. Pathol., February 1, 2007; 170(2): 633 - 643.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. L. Weir, M. L. Oppizzi, M. D. Henry, A. Onishi, K. P. Campbell, M. J. Bissell, and J. L. Muschler
Dystroglycan loss disrupts polarity and {beta}-casein induction in mammary epithelial cells by perturbing laminin anchoring
J. Cell Sci., October 1, 2006; 119(19): 4047 - 4058.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Schneider, A. A. Khalil, J. Poulton, C. Castillejo-Lopez, D. Egger-Adam, A. Wodarz, W.-M. Deng, and S. Baumgartner
Perlecan and Dystroglycan act at the basal side of the Drosophila follicular epithelium to maintain epithelial organization
Development, October 1, 2006; 133(19): 3805 - 3815.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. S. Poulton and W.-M. Deng
Dystroglycan down-regulation links EGF receptor signaling and anterior-posterior polarity formation in the Drosophila oocyte
PNAS, August 22, 2006; 103(34): 12775 - 12780.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
R. P. Johnson, S. H. Kang, and J. M. Kramer
C. elegans dystroglycan DGN-1 functions in epithelia and neurons, but not muscle, and independently of dystrophin
Development, May 15, 2006; 133(10): 1911 - 1921.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. R. Tremblay and S. Carbonetto
An Extracellular Pathway for Dystroglycan Function in Acetylcholine Receptor Aggregation and Laminin Deposition in Skeletal Myotubes
J. Biol. Chem., May 12, 2006; 281(19): 13365 - 13373.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Fukumoto, J. H. Miner, H. Ida, E. Fukumoto, K. Yuasa, H. Miyazaki, M. P. Hoffman, and Y. Yamada
Laminin {alpha}5 Is Required for Dental Epithelium Growth and Polarity and the Development of Tooth Bud and Shape
J. Biol. Chem., February 24, 2006; 281(8): 5008 - 5016.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
R. Barresi and K. P. Campbell
Dystroglycan: from biosynthesis to pathogenesis of human disease
J. Cell Sci., January 15, 2006; 119(2): 199 - 207.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. Lyalin, K. Koles, S. D. Roosendaal, E. Repnikova, L. Van Wechel, and V. M. Panin
The twisted Gene Encodes Drosophila Protein O-Mannosyltransferase 2 and Genetically Interacts With the rotated abdomen Gene Encoding Drosophila Protein O-Mannosyltransferase 1
Genetics, January 1, 2006; 172(1): 343 - 353.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zhan, M. R. Tremblay, N. Melian, and S. Carbonetto
Evidence That Dystroglycan Is Associated with Dynamin and Regulates Endocytosis
J. Biol. Chem., May 6, 2005; 280(18): 18015 - 18024.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Ichimiya, H. Manya, Y. Ohmae, H. Yoshida, K. Takahashi, R. Ueda, T. Endo, and S. Nishihara
The Twisted Abdomen Phenotype of Drosophila POMT1 and POMT2 Mutants Coincides with Their Heterophilic Protein O-Mannosyltransferase Activity
J. Biol. Chem., October 8, 2004; 279(41): 42638 - 42647.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Singh, Y. Itahana, S. Knight-Krajewski, M. Kanagawa, K. P. Campbell, M. J. Bissell, and J. Muschler
Proteolytic Enzymes and Altered Glycosylation Modulate Dystroglycan Function in Carcinoma Cells
Cancer Res., September 1, 2004; 64(17): 6152 - 6159.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Brumby, J. Secombe, J. Horsfield, M. Coombe, N. Amin, D. Coates, R. Saint, and H. Richardson
A Genetic Screen for Dominant Modifiers of a cyclin E Hypomorphic Mutation Identifies Novel Regulators of S-Phase Entry in Drosophila
Genetics, September 1, 2004; 168(1): 227 - 251.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Z. Morris, C. Navarro, and R. Lehmann
Identification and Analysis of Mutations in bob, Doa and Eight New Genes Required for Oocyte Specification and Development in Drosophila melanogaster
Genetics, August 1, 2003; 164(4): 1435 - 1446.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. E. Michele and K. P. Campbell
Dystrophin-Glycoprotein Complex: Post-translational Processing and Dystroglycan Function
J. Biol. Chem., April 25, 2003; 278(18): 15457 - 15460.
[Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, W.-M.
Right arrow Articles by Ruohola-Baker, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, W.-M.
Right arrow Articles by Ruohola-Baker, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?