|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00199


1 Department of Biochemistry, Box 357350, University of Washington, Seattle, WA
98195, USA
2 Department of Cell and Molecular Biology, Section of Developmental Biology,
Lund University, Sweden
Present address: EBC, Jämförande Fysiologi (Comparative Physiology)
Norbyv. 18A, 752 36 Uppsala, Sweden
Author for correspondence (e-mail:
hannele{at}u.washington.edu)
Accepted 11 October 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Polarity, Axis, Asymmetry, Oogenesis, Epithelia, Dystroglycan, Actin, Microtubule, ECM, Planar polarity, Signaling, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
How polarity is established at a cellular level is one of the most
fundamental questions in biology. Many cell types undergo certain degrees of
polarization to fulfill their specific functions. For example, neurons
polarize to form axons and dendrites in order to convey signals; polarization
of T cells is needed for their migration. Epithelial cells, however, have a
pronounced apicobasal polarity, which is needed for them to cope with
different extracellular environments. Studies using genetic model systems such
as Drosophila and mammalian culture cells have revealed three groups
of protein complexes that are involved in the specification and
regionalization of the plasma membrane and cortex of the polarized epithelium:
Crumbs, Par and Lgl complexes (Tepass et
al., 2001
). The transmembrane protein, Crumbs (Crb) and its
cytoplasmic-binding partners, the PDZ domain proteins Discs Lost (Dlt) and
Stardust as well as the Par-complex [Bazooka(Par3)/DmPar6(Par6)/atypical
protein kinase C (aPKC)] are located on the apical membrane and are required
for the establishment of this domain
(Bachmann et al., 2001
;
Bhat et al., 1999
;
Hong et al., 2001
;
Petronczki and Knoblich, 2001
;
Tepass et al., 1990
;
Wodarz et al., 2000
). The
Lgl-complex [Lethal Giant Larvae (Lgl)/Discs Large (Dlg)/Scribble (Scrib)] is
located at the lateral region of the epithelium and is required to restrict
Crb to the apical side (Bilder and
Perrimon, 2000
; Bilder et al.,
2000
; Woods and Bryant,
1991
).
Cell polarity can also be the basis for a body axis. In
Drosophila, the body polarity is built upon the polarity of the
oocyte, and in C. elegans, polarization of the single-cell embryo
determines the anteroposterior (AP) body axis (reviewed by
Wodarz, 2002
). In fact, the
process of polarity formation in the developing Drosophila oocyte
provides an excellent model with which to study how the polarity of the
cytoskeleton is dynamically regulated. The AP asymmetry of the oocyte
cytoskeleton, which is the basis for morphogen localization within different
compartments of the egg, is established by a series of dynamic steps (reviewed
by Riechmann and Ephrussi,
2001
). First, centrioles and the microtubule organizing center
(MTOC) are located at the anterior end of the oocyte at stage 1. By stage 3
the MTOC has moved to the posterior of the oocyte. This posterior movement of
the MTOC requires function of the Par proteins (Par-complex and Par1) and the
action of maelstrom gene product
(Cox et al., 2001a
;
Cox et al., 2001b
;
Huynh et al., 2001a
;
Huynh et al., 2001b
;
Clegg et al., 2001
). At stage
6, posterior follicle cells send an unidentified signal back to the oocyte to
re-orient the oocyte microtubule (MT) polarity, which requires the function of
an ECM protein, Laminin (Deng and
Ruohola-Baker, 2000
). At each step, the proper MT polarity is
required for localization of key molecules in the oocyte. In addition to MTs,
the oocyte has an enriched cortical array of actin cytoskeleton that plays an
important role in localizing posterior morphogens in the oocyte
(Baum et al., 2000
;
Erdelyi et al., 1995
).
Although the oocyte and the epithelial cells differ profoundly in their
morphology and function, polarization of these two cell types uses some of the
same genes. For example, the Par genes are required to establish the polarity
of both the oocyte and epithelial cells
(Cox et al., 2001a
;
Cox et al., 2001b
;
Huynh et al., 2001a
;
Huynh et al., 2001b
;
Petronczki and Knoblich, 2001
;
Wodarz et al., 2000
). This
similarly raises the possibility that some common strategies may exist for
cellular polarization. We show that DG, a receptor for multiple ECM proteins,
is required cell-autonomously to polarize both the epithelial cells and the
oocyte in Drosophila. We also show a separate, non-cell-autonomous
function for DG: disruption of DG affects the organization of the basal actin
cytoskeleton in neighboring cells, which suggests the involvement of DG in
cell-cell communication.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Isolation of deletion mutants at the Dg locus
Drosophila melanogaster stocks were raised on standard
cornmeal-yeast-agar medium at 25°C. Dg alleles
Dg248, Dg62 and
Dg323 were obtained by imprecise excision of EP(2)2241
(Fig. 1A). EP(2)2241 was
mobilized by crossing the line to a
2-3 transposase containing line.
330 White-eyed flies of the F1 generation were established as balanced stocks,
and the homozygous lethal (12%) or semi-lethal lines (5%) were tested for
complementation with a CG8414-allele (EP(2)0525), a deficiency line
Df(2)JP6 and a Rho1 allele (Rho1E3.10)
(Halsell et al., 2000
). All
three alleles contain deletions that remove the putative transcription start
site and the 5'UTR of the Dg gene
(Fig. 1A). The breakpoints of
the deletion mutants were mapped by PCR using combinations of the following
genomic primers: forward, GATCAGGGCCAAGGTGTGTCCAGC and AAGCCGCTTTGGCGTTGC;
reverse, GCTCACTCCCACACAAGCGC and GAGCCCAATGATCCGTGGAAAGCG.
PCR fragments including the breakpoints of Dg248 and Dg323 were sequenced. Dg248 contains a 785 bp deletion between bp 32,514 and bp 33,299 of DS03910. Fifteen basepairs of the inverted repeat of the P element are still present (lowercase in Fig. 1). An A to T mutation and a 2 bp deletion is found at the distal breakpoint: GGAGCATTCCTTGCT--ATGTTatgttatttcatcatgGGCAGGAGAGTCCCGAAT.
Dg323 contains a 3155 bp deletion between bp 32,345 and bp 35,669 of DS03910. A C to T change was found near the proximal breakpoint: AAAATGGCAGCGTACTTTCG/TTTTGCTTTGCGCTTCTCTG.
Construction of the transgenic animals with DG-hairpin
The cDNA corresponding to the cytoplasmic domain and 670 bp of the 3'
UTR of Drosophila Dystroglycan (CTGTTGCCTGCA to
TTGCTTGCATGTTTTTTTTTTTT) was directionally cloned into the
KpnI/HindIII sites in pBluescript II (Stratagene) to form an
intermediate vector pKS-dg. The 1 kb KpnI/BamHI fragment of
pKS-dg was excised and subcloned into pEGFP-N1 (Clontech) and then digested
with NheI and BamHI. The NheI/BamHI
fragment was inserted together with the 148 bp Sau3A fragment of pEGFP-N1 back
into the BamHI/SpeI-digested pKS-dg (triple ligation). The
KpnI 2.2 kb fragment was subcloned into pUAST. Thus, we constructed a
Dg hairpin-loop plasmid (pUAST-dg-L-gd). The construct was verified
by sequencing and then injected to embryos to obtain stable transformant
lines, UAS-dsDG-RNAi (dsDG). To drive expression of
dsDG in animals, we crossed the transgenic flies with the
tubP-Gal4 line (Lee and Luo,
1999
), which shows ubiquitous expression in follicle cells.
tubP-Gal4/dsDG causes reduction of DG expression, leading to
semilethality, consistent with the fact that dg deletion alleles are
homozygous lethal. However, some tubP-Gal4/dsDG escapers were
observed and analyzed for their oogenesis phenotypes.
Loss-of-function mosaic analysis
In order to generate mutant cell clones, Dg alleles were
recombined to the FRT chromosome (Xu and
Rubin, 1993
). To obtain follicle cell clones, 1- to 5-day-old
flies were heat-shocked as adults for 60 minutes at 37°C and put in
freshly yeasted vials with males for 2 or 3 days. To obtain germline clones,
2- to 3-day-old larvae were heat-shocked at 37°C for 2 hours each time
during 2 consecutive days. Ovaries from adult female flies at 3-5 days of age
were harvested. To generate mutant clones in imaginal discs, the flies were
allowed to lay eggs for 24 hours at 25°C and the eggs were allowed to
develop 48 hours at 25°C. Thereafter, the larvae were heat shocked for
30-40 minutes at 38°C and returned to 25°C. After 2 days, wandering
third instar larvae were collected and dissected for antibody staining.
Dystroglycan antibody production
Three antibodies against DG protein were raised in rabbits: one against the
extracellular domain corresponding to exon 8 (amino acids 243-507) and two
against the intracellular regions (one against 18 C-terminal amino acids and
one against 102 C-terminal amino acids). Most of the staining shown in this
paper use the antibody raised against 102 C-terminal amino acids. DG
cytoplasmic domain (102 amino acids) was synthesized by PCR using the primer
pair: CGGGATCCAAAGGAGCGGCAAAATGGAG and GCTCTAGAAAGCGGCCGCCGTACGTCCCAGTAAGT
(Gibco BRL) and the template GH09323. The PCR product was digested using
BamHI and NotI and the fragment was cloned in vector pGEX5X.
The DGcyto-GST fusion protein was produced in JM109 after induction with IPTG.
Then bacteria were harvested and lyzed by French Press. To purify the fusion
protein, GST resin was used to bind the protein, and 10 mM gluthione 50 mM
Tris (pH 7.5) was used to elude the protein. Polyclonal antisera were produced
by R & R rabbitury, and affinity purified by the fusion protein.
Overexpression of Dystroglycan
UAS-DG was constructed by cloning the KpnI/NotI insert of
an EST clone LD11619 into the pUAST transformation vector. UAS-DGcyto contains
a tandem Flag tag sequence inserted at amino acid 37 of DG (amino acids 1-27
constitute the putative signal peptide) fused to the transmembrane (starting
WPIVI...) and cytoplasmic domains. The constructs were injected to embryos to
obtain stable transformant lines. The UAS-DG and UAS-DGcyto fly-lines were
then crossed to different Gal4 driver lines.
To generate DG overexpression follicle cell clones, hsFLP, UAS-Dg
males were crossed to virgin female act<FRT-CD2-FRT<Gal4;
UASGFP flies (Pignoni and Zipursky,
1997
). The F1 progeny were heat shocked at 37°C for
1 hour and raised at 25°C for 3 days, dissected and analyzed.
Histocytochemistry
Ovarian antibody staining and confocal microscopy was performed as
described previously (Deng et al.,
2001
). Basal actin staining was performed according to the
protocol provided by Frydman (Frydman and
Spradling, 2001
). Imaginal disc staining was as described
previously (Woods et al.,
1997
). A two-photon laser scanning microscope (Leica TCS SP/MP)
was used to detect DAPI staining.
The following antibodies were used: rabbit anti-Dlg (1:500)
(Woods and Bryant, 1991
);
mouse anti-Orb (1:20) (Lantz et al.,
1994
); rabbit anti Baz (1:500)
(Wodarz et al., 2000
); mouse
anti-Crb (CQ4,1:20) (Tepass et al.,
1990
); rabbit anti DG (1:3000; this study); mouse or rabbit
anti-ßGal (1:5000, Sigma); mouse anti-Neurotactin (BP102; 1:20)
(Hortsch et al., 1990
); rabbit
anti-Laminin (1:3000) (Fessler et al.,
1987
); ant-Dlt (1:1000) (Bhat
et al., 1999
); anti-ß-HSpectrin (1:1000)
(Thomas and Kiehart, 1994
);
Alexa 488, 568 or 633 goat anti-mouse (Molecular Probes); Alexa 568 or 633
Goat anti-Rabbit or Rat (Molecular Probes); and Alexa 568 or 633 Phalloidin
(Molecular Probes). DAB staining was done with the Vectastain Kit (Vector
Laboratories, CA).
| RESULTS |
|---|
|
|
|---|
Conceptual translation of the longest cDNA (LD11619) reveals an open reading frame of 1179 amino acids (Fig. 1A). This deduced Drosophila DG protein contains all the hallmarks of vertebrate DG: a mucin-like domain, a transmembrane domain and a C-terminal region with WW-, SH2- and SH3-binding domains (Fig. 1B,D). The best conserved region between human and Drosophila is the C-terminal half of the protein showing 31% identity (Fig. 1B). The last 12 amino acids of the C terminus include the WW domain-binding motif (PPxY), which is the Dystrophin binding site. Of 12 amino acids within the C terminus, 10 are perfectly conserved in Drosophila (Fig. 1C). Vertebrate DG contains a second PPxY motif in its cytoplasmic domain, which is also conserved in Drosophila. In addition, two of the six putative SH3 binding sites and all three SH2-binding sites in the cytoplasmic domain of vertebrate DG can be found in Drosophila (Fig. 1D). The putative C. elegans homolog DGN-1 (T21B6.1) shows 20% identity to Drosophila in the C-terminal half. However, T21B6.1 contains no mucin-like domain, Dystrophin-binding site or second PPxY motif (Fig. 1D).
To analyze the expression pattern of DG protein, we raised antibodies
against the cytoplasmic domain. Five major bands can be detected on a western
blot of wild-type embryonic extracts: 75 kDa, 105 kDa, 120 kDa, 180 kDa and
200 kDa (Fig. 1E). None of
these major bands could be seen in the extracts from the deficiency
[Df(2R)JP4, Df(2R)JP6) embryos that completely delete the Dg
locus, suggesting that all five forms are specific for DG
(Fig. 1E)]. Strong Dg
mutants were isolated by imprecise excisions of EP(2)2241 element and
by generating a transgenic line expressing a double-stranded DG-RNA construct
that destroys DG RNA by RNAi-mechanism
(Kennerdell and Carthew, 2000
)
(Fig. 1A). In
Dg248 or Dg323 mutant embryos, of the
five major bands derived from the Dg locus only the 105 kDa band can
be detected weakly (Fig. 1E),
indicating that the level of DG expression is highly reduced in these mutants.
Furthermore, to test the specificity of the antibodies in tissue samples we
analyzed the expression in the follicle cell epithelium. A high level of DG is
observed on the basal side of the epithelium, while a lower level is detected
on the apical side. This signal is absent in follicle cell clones homozygous
for Dg248 or Dg323, suggesting that
the signal observed with the antibody in the tissue is specific for DG (arrow
in Fig. 1F). Similarly,
Dystroglycan protein level was highly reduced or patchy because of the
expression of DG-RNAi construct (tubP-Gal4/dsDG) in follicle cells
(Fig. 1G and data not
shown).
Dystroglycan is required for apical-basal polarity in epithelial
cells
Since DG is highly expressed in the follicle cells, we first asked whether
Drosophila DG plays a role in establishing or maintaining epithelial
morphology in this tissue. The follicle cell epithelium (FE) has a typical
apical-basal polarity, with its apical side facing the germline cells
(Fig. 2A). As all follicle
cells are derived from two to three somatic stem cells, mosaic analysis
provides an excellent tool with which to study gene functions in epithelial
development (Margolis and Spradling,
1995
).
|
We employed the FLP/FRT system (Xu and
Rubin, 1993
) to generate follicle cell clones of all three
Dg alleles and applied the Gal4/UAS-mediated RNAi technique
(Kennerdell and Carthew, 2000
)
to silence DG expression in all follicle cells (tubP-Gal4/dsDG).
Similar phenotypes are observed in these different Dg mutant
backgrounds. Some mutant cells lost their epithelial appearance and formed
multiple layers (Fig. 2B,E), a
typical terminal phenotype for polarity defects in epithelial cells. Within
the multi-layer groups, the mutant cells from the mosaic egg chambers were
frequently excluded from the layer that contacts the germline cells.
Discontinuity of the epithelium was also visible in egg chambers containing
Dg follicle cell clones but not in control egg chambers
(Fig. 2B) (yellow arrow). These
phenotypes are similar to loss-of-function phenotypes of crb, dlt,
dlg or lgl in follicle cells
(Tanentzapf et al., 2000
;
Bilder et al., 2000
) and
suggest that DG is required for proper epithelial polarity. The mutant
follicle cells eventually died off, as we rarely saw mutant clones 9-10 days
after heat shock, while sister clones (twin spots) were readily observed.
To characterize the apicobasal polarity defect in more detail, we examined the expression and distribution of molecular markers in mutant cells that still maintained their columnar shape (Table 1). In Dg follicle cell clones and tubP-Gal4/dsDG follicle cells, mislocalization of apical markers, Dlt and ß-Heavy-Spectrin (ßH-Spec) (Table 1) was observed. Instead of a strict apical localization, Dlt and ßH-Spec were present at both the apical and basal sides of the mutant epithelia (Figs 2C,C',F',F''). Dlg, a basolateral marker, exhibited a significant reduction of staining in the basolateral domain in Dg RNAi follicle cells (Fig. 2G'). The function of DG in apicobasal polarity formation was not restricted to the FE, as mislocalization of Dlt to the lateral and basal sides was also observed in the mutant epithelial cells in an antennal disc (Fig. 2D, arrows). Taken together, these results suggest that DG is required in different epithelial cells for proper formation or maintenance of apicobasal polarity.
|
Overexpression of Dystroglycan in epithelial cells disrupts the
localization of apical markers
To ask whether DG, when overexpressed, is sufficient to interfere with the
epithelial cell polarity we used two UAS constructs, the full-length
DG-construct (UAS-DG; Fig.
3A) and the short construct with cytoplasmic and transmembrane
domains (UAS-DGcyto; Fig.
3B) and expressed them in the FE and in the embryonic salivary
glands (Fig. 3). Both
constructs expressed proteins of the expected sizes
(Fig. 3A,B) and were induced by
the following Gal4 driver lines: daughterlessGal4 (daGal4),
for maternal expression: elavGal4, for the salivary gland expression;
and the flip-out Gal4 system (Pignoni and
Zipursky, 1997
) for the FE expression. Similar defects in
epithelial polarity were observed with all three drivers.
|
In wild-type salivary glands, Crb was localized to the apical membrane of the epithelium, facing the lumen of the gland (Fig. 3D,G), while DG expression was undetectable (Fig. 3G). Embryos that overexpress DG showed strong ectopic DG staining on both the apical and basolateral membranes of the salivary gland (Fig. 3H). In about 75% of these salivary glands, the expression of Crb was strongly reduced (n=50; Fig. 3E,H,H'). Whereas Crb localization was disrupted by overexpression of full-length DG (UAS-DG), it was unaffected by overexpression of the form of DG lacking the extracellular domain (UAS-DGcyto; data not shown). These results suggest that the mislocalization of Crb was not due to nonspecific interference with the secretory apparatus but due to a defect on cell polarity. The lateral membrane domain was unaffected as assayed by the localization of Neurotactin, a lateral marker (Table 1; data not shown). As seen in the salivary glands, we found that follicle cells that overexpressed DG (Fig. 3I, arrow) lost the apical markers: ßH-Spec and Bazooka (Baz), while normal apical localization of these proteins was observed in neighboring wild-type cells (Fig. 3J,J',K,K'; Table 1). Again, overexpression of the DGcyto-form did not cause any obvious defects in the follicle epithelial polarity.
Dystroglycan is required in the germline for oocyte polarity
As Laminin A is required in the posterior follicle cells for proper oocyte
polarity at stages 7-10 (Deng and
Ruohola-Baker, 2000
), we attempted to ask whether DG functions in
the germline cells to receive the polarity signal from the Laminin ECM by
clonal analysis. Unfortunately, egg chambers bearing germline clones of all
deletion alleles are arrested at previtellogenic stages
(Fig. 4A, arrow), prior to the
stage we could detect signaling between the posterior follicle cells and the
oocyte. Therefore, we concentrated on analyzing the establishment of oocyte
polarity in earlier stages, a process that is marked by a posterior movement
of the MTOC (Fig. 4B,C). During
these stages, a low-level expression of DG is detected at the oocyte membrane
(data not shown).
|
To detect whether the early oocyte polarity is properly established in
Dg germline clones, we examined the localization of two MTOC markers,
Nod-ß-Galactosidase (Nod-ß-Gal) and ORB
(Table 1), which (in the wild
type) are localized at the anterior of the oocyte at stage 1
(Fig. 4B) and move to the
posterior in later stages (Fig.
4C,F). Mislocalization of both markers was observed in the mutant
germline clones [Nod-ß-Gal mislocalization: 60%, n=32; ORB
mislocalization: 76% in Dg323 (n=25); 60%
Dg248 (n=38)]. In half of the mislocalization
cases, the markers either remained in the anterior of the oocyte or surrounded
the nuclei after stage 3 (Fig.
4D,E,G). The remaining egg chambers exhibited diffuse staining
(data not shown). Compared with wild type, the staining was significantly
reduced. Furthermore, no accumulation of
-tubulin was observed in the
mutant oocytes, while normal posterior accumulation was detected in the
control oocytes between stages 2 and 6 (data not shown)
(Clegg et al., 2001
;
Cox et al., 2001a
). In
conclusion, these data suggest that DG is required in the early oocyte for the
maintenance or translocation of the MTOC from the anterior to the posterior of
the oocyte (Fig. 4J-K). This
step is crucial in establishing AP polarity in the oocyte and the future
embryo (Riechmann and Ephrussi,
2001
).
Enrichment of the actin cytoskeleton in the oocyte is disrupted in
Dystroglycan germline clones
Although links between DG and MT cytoskeleton have been suggested
(Lumeng et al., 1999
), the
linkage between DG and the actin cytoskeleton via dystrophin/utrophin is far
more evident. We therefore examined the actin distribution in the developing
oocyte in the wild-type and Dg germline clones. Previous studies
demonstrated that actin is enriched at the cortex of early wild-type oocytes
(Fig. 4H)
(González-Reyes and St Johnston,
1998
). Interestingly, this actin enrichment is disrupted in the
Dg germline clones (Fig.
4I). In addition, `spreading' of the ring canals normally observed
in stage 1-2 oocyte is not detected in egg chambers that lack germline DG
(Fig. 4I, arrowhead).
Basal actin array is disrupted non-cell-autonomously in
Dystroglycan follicle cell clones
At the basal side of the FE, actin filaments have a planar polarity that is
perpendicular to the long axis, the AP axis, of the egg chamber
(Fig. 5A,C). Integrins and
receptor tyrosine phosphatase Lar are involved non-cell-autonomously in
organizing this basal actin orientation
(Bateman et al., 2001
). In our
analysis of the ßH-Spec staining in follicle cells that express
dsDG, we noticed that ßH-Spec is mislocalized to the basal side
of the FE to bind the basal actin fibers. Noticeably, the fibers decorated
with ßH-Spec in different follicle cells appeared to be oriented in a
random fashion. To test whether this defect reflects problems in basal actin
orientation, we analyzed planar polarity of the actin arrays in control egg
chambers and in the mutant Dg follicle cell clones. Instead of normal
perpendicular orientation to the AP axis, random misorientation was observed
in the Dg mutant egg chambers
(Fig. 5B,D). Moreover, the
basal actin fibers in follicle cells adjacent to the mutant clones were also
misoriented, revealing a non-cell autonomous requirement for DG function
(Fig. 5E,F). Although the actin
filaments were not organized perpendicular to the AP axis in the mutant cells,
they aligned with the neighboring cells, suggesting that some communication of
the orientation from one cell to the other still existed. These results
suggest that DG has a non-cell-autonomous role in organizing the actin
cytoskeleton in the follicle cells, similar to other receptors such as
Integrin and Lar. Losing any one of these receptors still allows some
orientation transfer but the global direction is defective
(Frydman and Spradling, 2001
;
Bateman et al., 2001
) (this
study) suggesting that multiple receptor-ECM interactions are required for
precise orientation.
|
Previous data have shown that Laminin stripes in the basement membrane of
the FE are organized in the same orientation as the basal actin fibers
(Gutzeit et al., 1991
;
Bateman et al., 2001
)
(Fig. 5C,G), suggesting an
instructive interaction between the actin cytoskeleton and the ECM through a
receptor(s). One explanation for the non-cell-autonomous role of DG in basal
actin organization is that DG functions through organizing the Laminin ECM to
affect the basal actin in the neighboring cell. To test this idea further, we
analyzed the orientation of Laminin stripes in the wild-type and the
Dg mutant follicle cells. Instead of the orientation perpendicular to
the AP axis in the wild type (Fig.
5G), overall reduction and misorganization of Laminin ECM occurred
in the mutant clone and neighboring regions
(Fig. 5H).
To test whether DG is sufficient to organize the Laminin ECM, we asked
whether overexpression of DG had any effect on Laminin localization. In stage
10 follicle cells, the majority of the Laminin staining is observed at the
basal side (Fig. 5I,
arrowhead). Noticeably, Laminin is accumulated at the lateral and apical sides
of the follicle cells that overexpressed DG
(Fig. 5I, arrow), which is
consistent with the fact that high-level DG expression is visible at the
apical and basal surfaces of these cells
(Fig. 3I). This result suggests
that DG can effectively organize the Laminin ECM in Drosophila. The
dotted instead of stripe/line appearance of ectopic Laminin because of DG
overexpression is consistent with a previous report that DG is required for
Laminin binding, while Integrin is required for further formation of the
Laminin stripe/line-like structures (Henry
et al., 2001b
).
| DISCUSSION |
|---|
|
|
|---|
Comparison of Drosophila Dystroglycan to its mammalian
orthologs
Drosophila DG contains most of the hallmarks of vertebrate DG, but
is significantly longer than its vertebrate orthologs, due to a
250 amino
acid duplication in the extracellular domain. The N-terminal half of fly DG
harbors a mucin-like domain, similar to vertebrate DG, but is otherwise only
weakly conserved. As the mucin-like sugars have been implicated in Laminin
binding it is interesting to note that splicing variants of DG that lack exon
8, also lack most of this domain. In addition, altered glycosylation of DG is
related to two forms of congenital muscular dystrophy
(Brockington et al., 2001
;
Hayashi et al., 2001
;
Michele et al., 2002
;
Moore et al., 2002
), and
reduced expression of DG is observed in a mouse model of Duchene's muscular
dystrophy (Ervasti and Campbell,
1993
).
The C-terminal half of Drosophila DG is conserved with 31%
identity (46% similarity, Fig.
1A,B). Especially well conserved are the protein-protein
interaction sites in the cytoplasmic domain of DG, including the binding site
for Dystrophin. Seven of the eight amino residues, which are crucial for
Dystrophin binding (Huang et al.,
2000
) are conserved in Drosophila. Recent studies
demonstrate that phosphorylation of the tyrosine residue within the
dystrophin/utrophin binding motif can interfere with binding to utrophin,
leading to recruitment of SH2 domain proteins
(Sotgia et al., 2001
;
Ilsley et al., 2002
). The
putative SH2-binding motif involved in this interaction is conserved in
Drosophila. The third protein-protein interaction described for
vertebrate DG is the binding of the SH2-SH3 adaptor GRB2. GRB2 helps initiate
the Ras-MAP kinase signal transduction cascade and is involved in controlling
cytoskeletal organization (Yang et al.,
1995
). However, the SH3-binding motif, thought to mediate GRB2
binding, is not fully conserved in Drosophila.
The role of Dystroglycan in epithelial polarity formation
Reduced expression of DG is often associated with tumor formation,
suggesting that DG can act as a tumor suppressor
(Henry et al., 2001a
). It is
likely that loss of DG function in some cancers leads to abnormal cell-ECM
interactions and thus contributes to progression to a metastatic state.
Defects in epithelial interactions normally result in cell death; when
associated with abnormal cell growth and division; however, such defects could
induce metastasis. Our analysis supports this hypothesis: lack of DG function
in Drosophila results in tumor-like structures
(Fig. 2B) and abnormal cell
movement because of the lack of epithelial integrity and cellular
polarity.
Reduction of DG function expands the apical domain and overexpression of DG
reduces this domain in epithelial cells. In Dg loss-of-function
follicle cell clones, a component of the Lgl-complex, Dlg, is mislocalized.
This mislocalization could explain the expansion of apical markers in the
clones, as Dlg and Scrib are each required for the lateral localization of
each other and their function is essential to restrict the apical markers Crb
and Dlt to the apical surface (Bilder et
al., 2000
; Bilder and Perrimon,
2000
). Further experiments are directed to distinguish whether
mislocalization of Dlg is caused directly by lack of physical interaction with
DG or indirectly by lack of proper cytoskeletal arrangements.
The role of Dystroglycan in oocyte polarity formation
Drosophila oocyte polarity is essential for morphogen localization
and therefore for the formation of the major body axes. The establishment of
oocyte polarity is a gradual process that involves multiple steps (reviewed by
Riechmann and Ephrussi, 2001
).
Key events in the process are cytoskeletal rearrangements. First, the MTOC is
present in the anterior region of an early oocyte. By stage 3, the first
rearrangement has occurred and the MTOC is positioned in the posterior portion
of the developing oocyte. By the end of stage 6, a signal from the posterior
follicle cells has initiated a new MT rearrangement, the posterior MTOC
disappears and a new anterior MTOC forms. Although this signaling pathway
remains a mystery, several molecules including Laminin A have been shown to be
involved (Riechmann and Ephrussi,
2001
; Deng and Ruohola-Baker,
2000
). As for the first rearrangement, genes encoding the
Drosophila Par3/Par6/aPKC-complex, Par-1, and Maelstrom are required,
(Cox et al., 2001a
;
Cox et al., 2001b
;
Huynh et al., 2001a
;
Huynh et al., 2001b
;
Clegg et al., 2001
;
Vaccari and Ephrussi, 2002
).
However, the mechanism for the MTOC movement or anchoring is not clear. We
show that DG, similar to the Par proteins, is required in the germline for
this first rearrangement step. As Dg germline clones also exhibited a
defect in cortical actin enrichment in the oocyte, it is possible that the
cortical actin plays an important role in MTOC movement and/or anchoring.
Alternatively, as DGC contains proteins that can interact with either actin or
microtubular cytoskeletons, it could play a role in coordinating actin and
microtubule functions in this process.
Molecular similarities in the establishment of epithelial and oocyte
polarity
The fact that DG is required for both epithelial and oocyte polarity
re-iterates the idea that common strategies may exist for polarizing these two
very different cell types. In addition to DG, Par proteins also act in
polarity formation in both cell types, suggesting that the Par proteins and DG
complex have functional similarities. Interestingly, DG can affect
localization of the Par complex as one of the members, Baz (Par3), is
mislocalized when DG is overexpressed. In addition, both Par-proteins and the
DG-complex interact with molecules that can associate with either actin or
microtubular cytoskeletons. Par-1 associates with Myosin II heavy chain and
also phosphorylates a MT-associated protein
(Drewes et al., 1997
;
Guo and Kemphues, 1996
). DG
can interact with actin through Dystrophin-like proteins. Furthermore, the
Dystrophin-associated protein, Syntrophin, interacts with MT-associated
proteins via a two-hybrid assay (Lumeng et
al., 1999
). It is possible that both Par proteins and the DG
complex facilitate interactions between actin and microtubules and that these
interactions between the two cytoskeletal systems are key regulators for
establishment of polarity in both cell types.
Cell non-autonomous phenotype and the function of DG in signaling to
neighboring cells
To our surprise, Dg mutant follicle cell generated actin defects
in neighboring cells; the basal actin was misoriented in adjacent follicle
cells (Fig. 5F). How would a
defective DG in one cell alter the dynamics of actin organization in the
neighboring cell? We propose that the interaction between ECM and DG is
bi-directional (Fig. 5J): on
one hand, DG organizes the Laminin ECM architecture
(Henry et al., 2001b
; this
study), suggesting that a defect in DG will be transmitted to a defect in ECM
organization; on the other hand, a defective Laminin lattice will extend to
the surface of the neighboring cell and there this architectural information
could be transmitted to the cellular actin cytoskeleton by DG in the
neighboring cell (Colognato et al.,
1999
). Three pieces of evidence support this hypothesis. First,
Drosophila DG is capable of organizing the Laminin lattice
(Fig. 5H,I). Second, the
Laminin lattice in the basal side of follicle cells is oriented in the same
orientation as the underlying basal actin lattice
(Fig. 5C,G)
(Gutzeit et al., 1991
;
Bateman et al., 2001
). Third,
Laminin, similar to DG, could also be involved in basal actin organization
(Bateman et al., 2001
;
Frydman and Spradling, 2001
).
Interestingly, two other Laminin receptors, Integrin and Lar, are also
required for basal actin planar polarity in follicle cells
(Bateman et al., 2001
;
Frydman and Spradling, 2001
).
It is possible that one connector alone would not give enough rigidity or
allow enough flexibility in relaying information between the ECM and the basal
actin.
In summary, we have shown that DG has two separate functions in cell polarity: cell autonomous in apical-basal and anteroposterior polarity, and non-cell-autonomous in planar polarity. Future research aims to take advantage of Drosophila as a model organism to genetically dissect the partners of DG in these two functions.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Bachmann, A., Schneider, M., Theilenberg, E., Grawe, F. and
Knust, E. (2001). Drosophila Stardust is a partner
of Crumbs in the control of epithelial cell polarity.
Nature 414,638
-643.[CrossRef][Medline]
Bateman, J, Reddy, R. S., Saito, H. and van Vactor, D.
(2001). The receptor tyrosine phosphatase Dlar and integrins
organize actin filaments in the Drosophila follicular epithelium.
Curr. Biol. 11,1317
-1327.[CrossRef][Medline]
Baum, B., Li, W. and Perrimon, N. (2000). A
cyclase-associated protein regulates actin and cell polarity during
Drosophila oogenesis and in yeast. Curr.
Biol. 10,964
-973.[CrossRef][Medline]
Bernards, A. and Hariharan, I. K. (2001). Of
flies and men studying human disease in Drosophila. Curr.
Opin. Genet. Dev. 11,274
-278.[CrossRef][Medline]
Bhat, M. A., Izaddoost, S., Lu, Y., Cho, K. O., Choi, K. W. and
Bellen, H. J. (1999). Discs Lost, a novel multi-PDZ domain
protein, establishes and maintains epithelial polarity.
Cell 96,833
-845.[CrossRef][Medline]
Bilder, D. and Perrimon, N. (2000).
Localization of apical epithelial determinants by the basolateral PDZ protein
Scribble. Nature 403,676
-680.[CrossRef][Medline]
Bilder, D., Li, M. and Perrimon, N. (2000).
Cooperative regulation of cell polarity and growth by Drosophila
tumor suppressors. Science
289,113
-116.
Brockington, M., Blake, D. J., Prandini, P., Brown, S. C.,
Torelli, S., Benson, M. A., Ponting, C. P., Estournet, B. and Romero, N. B. et
al. (2001). Mutations in the fukutin-related protein gene
(FKRP) cause a form of congenital muscular dystrophy with secondary laminin 2
deficiency and abnormal glycosylation of Dg. Am. J. Hum.
Genet. 69,1198
-1209.[CrossRef][Medline]
Burton, E. A. and Davies, K. E. (2002).
Muscular dystrophy reason for optimism? Cell
108, 5-8.[CrossRef][Medline]
Clark, I. E., Jan, L. Y. and Jan, Y. N. (1997).
Reciprocal localization of Nod and kinesin fusion proteins indicates
microtubule polarity in the Drosophila oocyte, epithelium, neuron and
muscle. Development.
124,461
-470.[Abstract]
Clegg, N. J., Findley, S. D., Mahowald, A. P. and Ruohola-Baker,
H. (2001). Maelstrom is required to position the MTOC in
stage 2-6 Drosophila oocytes. Dev. Genes
Evol. 211,44
-48.[CrossRef][Medline]
Colognato, H., Winkelmann, D. A. and Yurchenco, P. D.
(1999). Laminin polymerization induces a receptor-cytoskeleton
network. J. Cell Biol.
145,619
-631.
Cox, D. N., Lu, B., Sun, T. Q., Williams, L. T. and Jan, Y.
N. (2001a). Drosophila par-1 is required for oocyte
differentiation and microtubule organization. Curr.
Biol. 11,75
-87.[CrossRef][Medline]
Cox, D. N., Seyfried, S. A., Jan, L. Y. and Jan, Y. N.
(2001b). Bazooka and atypical protein kinase C are required to
regulate oocyte differentiation in the Drosophila ovary.
Proc. Natl. Acad. Sci. USA
98,14475
-14480.
Deng, W. M. and Ruohola-Baker, H. (2000).
Laminin A is required for follicle cell-oocyte signaling that leads to
establishment of the anterior-posterior axis in Drosophila. Curr.
Biol. 10,683
-686.[CrossRef][Medline]
Deng, W. M., Althauser, C. and Ruohola-Baker, H.
(2001). Notch-Delta signaling induces a transition from mitotic
cell cycle to endocycle in Drosophila follicle cells.
Development 128,4737
-4746.
Drewes, G., Ebneth, A., Preuss, U., Mandelkow, E. M. and
Mandelkow, E. (1997). MARK, a novel family of protein kinases
that phosphorylate microtubule-associated proteins and trigger microtubule
disruption. Cell 89,297
-308.[CrossRef][Medline]
Durbeej, M. and Campbell, K. P. (1999).
Biochemical characterization of the epithelial Dg complex. J. Biol.
Chem. 274,26609
-26616.
Durbeej, M., Larsson, E., Ibraghimov-Beskrovnaya, O., Roberds,
S. L., Campbell, K. P. and Ekblom, P. (1995). Non-muscle
alpha-dystroglycan is involved in epithelial development. J. Cell
Biol. 130,79
-91.
Erdelyi, M., Michon, A. M., Guichet, A., Glotzer, J. B. and
Ephrussi, A. (1995). Requirement for Drosophila
cytoplasmic tropomyosin in oskar mRNA localization.
Nature 377,524
-527.[CrossRef][Medline]
Ervasti, J. M. and Campbell, K. P. (1993).
Dystrophin-associated glycoproteins: their possible roles in the pathogenesis
of Duchenne muscular dystrophy. Mol. Cell. Biol. Hum. Dis.
Ser. 3,139
-166.[Medline]
Fessler, L. I., Campbell, A. G., Duncan, K. G. and Fessler, J.
H. (1987). Drosophila laminin: characterization and
localization. J. Cell Biol.
105,2383
-2391.
Frydman, H. M. and Spradling, A. C. (2001). The
receptor-like tyrosine phosphatase lar is required for epithelial planar
polarity and for axis determination within Drosophila ovarian
follicles. Development.
128,3209
-3220.
González-Reyes, A. and St Johnston, D.
(1998). The Drosophila AP axis is polarised by the
cadherin-mediated positioning of the oocyte.
Development 125,3635
-3644.[Abstract]
Guo, S. and Kemphues, K. J. (1996). A
non-muscle myosin required for embryonic polarity in Caenorhabditis elegans.
Nature 382,455
-458.[CrossRef][Medline]
Gutzeit, H. O., Eberhardt, W. and Gratwohl, E.
(1991). Laminin and basement membrane-associated microfilaments
in wildtype and mutant Drosophila ovarian follicles. J.
Cell Sci. 100,781
-788.
Halsell, S. R., Chu, B. I. and Kiehart, D. P.
(2000). Genetic analysis demonstrates a direct link between rho
signaling and nonmuscle myosin function during Drosophila morphogenesis.
Genetics 155,1253
-1265.
Hayashi, Y. K., Ogawa, M., Tagawa, K., Noguchi, S., Ishihara,
T., Nonaka, I. and Arahata, K. (2001). Selective deficiency
of dystroglycan in Fukuyama-type congenital muscular dystrophy.
Neurology 57,115
-121.
Henry, M. D. and Campbell, K. P. (1999).
Dystroglycan inside and out. Curr. Opin. Cell Biol.
11,602
-607.[CrossRef][Medline]
Henry, M. D., Cohen, M. B. and Campbell, K. P.
(2001a). Reduced expression of dystroglycan in breast and
prostate cancer. Hum. Pathol.
32,791
-795.[CrossRef][Medline]
Henry, M. D., Satz, J. S., Brakebusch, C., Costell, M.,
Gustafsson, E., Fassler, R. and Campbell, K. P. (2001b).
Distinct roles for dystroglycan, beta1 integrin and perlecan in cell surface
laminin organization. J. Cell Sci.
114,1137
-1144.[Abstract]
Hong, Y., Stronach, B., Perrimon, N., Jan, L. Y. and Jan, Y.
N. (2001). Drosophila Stardust interacts with Crumbs to
control polarity of epithelia but not neuroblasts.
Nature 414,634
-638.[CrossRef][Medline]
Hortsch, M., Patel, N. H., Bieber, A. J., Traquina, Z. R. and
Goodman, C. S. (1990). Drosophila neurotactin, a
surface glycoprotein with homology to serine esterases, is dynamically
expressed during embryogenesis. Development
110,1327
-1340
Huang, X., Poy, F., Zhang, R., Joachimiak, A., Sudol, M. and
Eck, M. J. (2000). Structure of a WW domain containing
fragment of dystrophin in complex with beta-dystroglycan. Nat.
Struct. Biol. 7,634
-638.[CrossRef][Medline]
Huynh, J., Petronczki, M., Knoblich, J. A. and St Johnston,
D. (2001a). Bazooka and PAR-6 are required with PAR-1 for the
maintenance of oocyte fate in Drosophila. Curr. Biol.
11,901
-906.[CrossRef][Medline]
Huynh, J. R., Shulman, J. M., Benton, R. and St Johnston, D.
(2001b). PAR-1 is required for the maintenance of oocyte fate in
Drosophila. Development
128,1201
-1209.[Abstract]
Ibraghimov-Beskrovnaya, O., Ervasti, J. M., Leveille, C. J.,
Slaughter, C. A., Sernett, S. W. and Campbell, K. P. (1992).
Primary structure of dystrophin-associated glycoproteins linking dystrophin to
the extracellular matrix. Nature
355,696
-702.[CrossRef][Medline]
Ilsley, J. L., Sudol, M. and Winder, S. J.
(2002). The WW domain: Linking cell signalling to the membrane
cytoskeleton. Cell Signal.
14,183
-189.[CrossRef][Medline]
Kennerdell, J. R. and Carthew, R. W. (2000).
Heritable gene silencing in Drosophila using double-stranded RNA.
Nat. Biotechnol. 18,896
-898.[CrossRef][Medline]
Lantz, V., Chang, J. S., Horabain, J. I., Bopp, D. and Schedl,
P. (1994). The Drosophila orb RNA binding protein is
required for the formation of the egg chamber and establishment of polarity.
Genes Dev. 8,598
-613.
Lee, T. and Luo, L. (1999). Mosaic analysis
with a repressible neurotechnique cell marker for studies of gene function in
neuronal morphogenesis. Neuron
22,451
-461.[CrossRef][Medline]
Lumeng, C., Phelps, S., Crawford, G. E., Walden, P. D., Barald,
K. and Chamberlain, J. S. (1999). Interactions between beta
2-syntrophin and a family of microtubule-associated serine/threonine kinases.
Nat. Neurosci. 2,611
-617.[CrossRef][Medline]
Margolis, J. and Spradling, A. (1995).
Identification and behavior of epithelial stem cells in the
Drosophila ovary. Development
121,3797
-3807.[Abstract]
Michele, D. E., Barresi, R., Kanagawa, M., Saito, F., Cohn, R.
D., Satz, J. S., Dollar, J., Nishino, I., Kelley, R. I., Somer, H., Straub,
V., Mathews, K. D., Moore, S. A. and Campbell, K. P. (2002).
Post-translational disruption of dystroglycan-ligand interactions in
congenital muscular dystrophies. Nature
418,417
-422.[CrossRef][Medline]
Moore, S. A., Saito, F., Chen, J., Michele, D. E., Henry, M. D.,
Messing, A., Cohn, R. D., Ross-Barta, S. E., Westra, S., Williamson, R. A.,
Hoshi, T. and Campbell, K. P. (2002). Deletion of brain
dystroglycan recapitulates aspects of congenital muscular dystrophy.
Nature 418,422
-425.[CrossRef][Medline]
Petronczki, M. and Knoblich, J. A. (2001).
DmPAR-6 directs epithelial polarity and asymmetric cell division of
neuroblasts in Drosophila. Nat. Cell Biol.
3, 43-49.[CrossRef][Medline]
Pignoni, F. and Zipursky, S. L. (1997).
Induction of Drosophila eye development by decapentaplegic.Development 124,271
-278.[Abstract]
Riechmann, V. and Ephrussi, A. (2001). Axis
formation during Drosophila oogenesis. Curr. Opin. Genet.
Dev. 11,374
-383.[CrossRef][Medline]
Rørth, P. (1996). A modular
misexpression screen in Drosophila detecting tissue-specific
phenotypes. Proc. Natl. Acad. Sci. USA
93,12418
-12422.
Sotgia, F., Lee, H., Bedford, M. T., Petrucci, T., Sudol, M. and
Lisanti, M. P. (2001).. Tyrosine phosphorylation of
beta-dystroglycan at its WW domain binding motif, PPxY, recruits SH2 domain
containing proteins. Biochemistry
40,14585
-14592.[CrossRef][Medline]
Tanentzapf, G., Smith, C., McGlade, J. and Tepass, U.
(2000). Apical, lateral, and basal polarization cues contribute
to the development of the follicular epithelium during Drosophila
oogenesis. J. Cell Biol.
151,891
-904.
Tepass, U., Theres, C. and Knust, E. (1990).
crumbs encodes an EGF-like protein expressed on apical membranes of
Drosophila epithelial cells and required for organization of
epithelia. Cell 61,787
-799.[CrossRef][Medline]
Tepass, U., Tanentzapf, G., Ward, R. and Fehon, R.
(2001). Epithelial cell polarity and cell junctions in
Drosophila. Annu. Rev. Genet.
35,747
-784.[CrossRef][Medline]
Thomas, G. H. and Kiehart, D. P. (1994). Beta
heavy-spectrin has a restricted tissue and subcellular distribution during
Drosophila embryogenesis. Development
120,2039
-2050.[Abstract]
Vaccari, T. and Ephrussi, A. (2002). The fusome
and microtubules enrich Par-1 in the oocyte, where it effects polarization in
conjunction with Par-3, BicD, Egl, and Dynein. Curr
Biol. 12,1524
-1528.[CrossRef][Medline]
Williamson, R. A., Henry, M. D., Daniels, K. J., Hrstka, R. F.,
Lee, J. C., Sunada, Y., Ibraghimov-Beskrovnaya, O. and Campbell, K. P.
(1997). Dystroglycan is essential for early embryonic
development: disruption of Reichert's membrane in Dag1-null mice.
Hum. Mol. Genet. 6,831
-841.
Winder, S. J. (2001). The complexities of
dystroglycan. Trends Biochem. Sci.
26,118
-124.[CrossRef][Medline]
Wodarz, A. (2002). Establishing cell polarity
in development. Nat. Cell Biol.
4, E39-E44.[CrossRef][Medline]
Wodarz, A., Ramrath, A., Grimm, A. and Knust, E.
(2000). Drosophila atypical protein kinase C associates
with Bazooka and controls polarity of epithelia and neuroblasts. J.
Cell Biol. 150,1361
-1374.
Woods, D. F. and Bryant, P. J. (1991). The
discs-large tumor suppressor gene of Drosophila encodes a
guanylate kinase homolog localized at septate junctions.
Cell 66,451
-464.[CrossRef][Medline]
Woods, D. F., Wu, J. W. and Bryant, P. J.
(1997). Localization of proteins to the apico-lateral junctions
of Drosophila epithelia. Dev. Genet.
20,111
-118.[CrossRef][Medline]
Xu, T. and Rubin, G. M. (1993). Analysis of
genetic mosaics in developing and adult Drosophila tissues.
Development 117,1223
-1237.[Abstract]
Yang, B., Jung, D., Motto, D., Meyer, J., Koretzky, G. and
Campbell, K. P. (1995). SH3 domain-mediated interaction of
dystroglycan and Grb2. J. Biol. Chem.
270,11711
-11714.
This article has been cited by other articles:
![]() |
I. Delon and N. H. Brown The integrin adhesion complex changes its composition and function during morphogenesis of an epithelium J. Cell Sci., December 1, 2009; 122(23): 4363 - 4374. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Woolworth, G. Nallamothu, and T. Hsu The Drosophila Metastasis Suppressor Gene Nm23 Homolog, awd, Regulates Epithelial Integrity during Oogenesis Mol. Cell. Biol., September 1, 2009; 29(17): 4679 - 4690. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Roth and J. A. Lynch Symmetry Breaking During Drosophila Oogenesis Cold Spring Harb Perspect Biol, August 1, 2009; 1(2): a001891 - a001891. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Takeuchi, Y. Nakano, U. Kato, M. Kaneda, M. Aizu, W. Awano, S. Yonemura, S. Kiyonaka, Y. Mori, D. Yamamoto, et al. Changes in Temperature Preferences and Energy Homeostasis in Dystroglycan Mutants Science, March 27, 2009; 323(5922): 1740 - 1743. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. O'Reilly, H.-H. Lee, and M. A. Simon Integrins control the positioning and proliferation of follicle stem cells in the Drosophila ovary J. Cell Biol., August 25, 2008; 182(4): 801 - 815. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Medioni, M. Astier, M. Zmojdzian, K. Jagla, and M. Semeriva Genetic control of cell morphogenesis during Drosophila melanogaster cardiac tube formation J. Cell Biol., July 28, 2008; 182(2): 249 - 261. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. P. Wairkar, L. G. Fradkin, J. N. Noordermeer, and A. DiAntonio Synaptic Defects in a Drosophila Model of Congenital Muscular Dystrophy J. Neurosci., April 2, 2008; 28(14): 3781 - 3789. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Akhavan, S. N. Crivelli, M. Singh, V. R. Lingappa, and J. L. Muschler SEA domain proteolysis determines the functional composition of dystroglycan FASEB J, February 1, 2008; 22(2): 612 - 621. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Allikian, G. Bhabha, P. Dospoy, A. Heydemann, P. Ryder, J. U. Earley, M. J. Wolf, H. A. Rockman, and E. M. McNally Reduced life span with heart and muscle dysfunction in Drosophila sarcoglycan mutants Hum. Mol. Genet., December 1, 2007; 16(23): 2933 - 2943. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Haines, S. Seabrooke, and B. A. Stewart Dystroglycan and Protein O-Mannosyltransferases 1 and 2 Are Required to Maintain Integrity of Drosophila Larval Muscles Mol. Biol. Cell, December 1, 2007; 18(12): 4721 - 4730. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Yatsenko, E. E. Gray, H. R. Shcherbata, L. B. Patterson, V. D. Sood, M. M. Kucherenko, D. Baker, and H. Ruohola-Baker A Putative Src Homology 3 Domain Binding Motif but Not the C-terminal Dystrophin WW Domain Binding Motif Is Required for Dystroglycan Function in Cellular Polarity in Drosophila J. Biol. Chem., May 18, 2007; 282(20): 15159 - 15169. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Mirouse, L. L. Swick, N. Kazgan, D. St Johnston, and J. E. Brenman LKB1 and AMPK maintain epithelial cell polarity under energetic stress J. Cell Biol., May 7, 2007; 177(3): 387 - 392. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hnia, G. Hugon, F. Rivier, A. Masmoudi, J. Mercier, and D. Mornet Modulation of p38 Mitogen-Activated Protein Kinase Cascade and Metalloproteinase Activity in Diaphragm Muscle in Response to Free Radical Scavenger Administration in Dystrophin-Deficient Mdx Mice Am. J. Pathol., February 1, 2007; 170(2): 633 - 643. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Weir, M. L. Oppizzi, M. D. Henry, A. Onishi, K. P. Campbell, M. J. Bissell, and J. L. Muschler Dystroglycan loss disrupts polarity and {beta}-casein induction in mammary epithelial cells by perturbing laminin anchoring J. Cell Sci., October 1, 2006; 119(19): 4047 - 4058. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schneider, A. A. Khalil, J. Poulton, C. Castillejo-Lopez, D. Egger-Adam, A. Wodarz, W.-M. Deng, and S. Baumgartner Perlecan and Dystroglycan act at the basal side of the Drosophila follicular epithelium to maintain epithelial organization Development, October 1, 2006; 133(19): 3805 - 3815. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Poulton and W.-M. Deng Dystroglycan down-regulation links EGF receptor signaling and anterior-posterior polarity formation in the Drosophila oocyte PNAS, August 22, 2006; 103(34): 12775 - 12780. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Johnson, S. H. Kang, and J. M. Kramer C. elegans dystroglycan DGN-1 functions in epithelia and neurons, but not muscle, and independently of dystrophin Development, May 15, 2006; 133(10): 1911 - 1921. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Tremblay and S. Carbonetto An Extracellular Pathway for Dystroglycan Function in Acetylcholine Receptor Aggregation and Laminin Deposition in Skeletal Myotubes J. Biol. Chem., May 12, 2006; 281(19): 13365 - 13373. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fukumoto, J. H. Miner, H. Ida, E. Fukumoto, K. Yuasa, H. Miyazaki, M. P. Hoffman, and Y. Yamada Laminin {alpha}5 Is Required for Dental Epithelium Growth and Polarity and the Development of Tooth Bud and Shape J. Biol. Chem., February 24, 2006; 281(8): 5008 - 5016. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Barresi and K. P. Campbell Dystroglycan: from biosynthesis to pathogenesis of human disease J. Cell Sci., January 15, 2006; 119(2): 199 - 207. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lyalin, K. Koles, S. D. Roosendaal, E. Repnikova, L. Van Wechel, and V. M. Panin The twisted Gene Encodes Drosophila Protein O-Mannosyltransferase 2 and Genetically Interacts With the rotated abdomen Gene Encoding Drosophila Protein O-Mannosyltransferase 1 Genetics, January 1, 2006; 172(1): 343 - 353. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhan, M. R. Tremblay, N. Melian, and S. Carbonetto Evidence That Dystroglycan Is Associated with Dynamin and Regulates Endocytosis J. Biol. Chem., May 6, 2005; 280(18): 18015 - 18024. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ichimiya, H. Manya, Y. Ohmae, H. Yoshida, K. Takahashi, R. Ueda, T. Endo, and S. Nishihara The Twisted Abdomen Phenotype of Drosophila POMT1 and POMT2 Mutants Coincides with Their Heterophilic Protein O-Mannosyltransferase Activity J. Biol. Chem., October 8, 2004; 279(41): 42638 - 42647. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Singh, Y. Itahana, S. Knight-Krajewski, M. Kanagawa, K. P. Campbell, M. J. Bissell, and J. Muschler Proteolytic Enzymes and Altered Glycosylation Modulate Dystroglycan Function in Carcinoma Cells Cancer Res., September 1, 2004; 64(17): 6152 - 6159. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Brumby, J. Secombe, J. Horsfield, M. Coombe, N. Amin, D. Coates, R. Saint, and H. Richardson A Genetic Screen for Dominant Modifiers of a cyclin E Hypomorphic Mutation Identifies Novel Regulators of S-Phase Entry in Drosophila Genetics, September 1, 2004; 168(1): 227 - 251. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Z. Morris, C. Navarro, and R. Lehmann Identification and Analysis of Mutations in bob, Doa and Eight New Genes Required for Oocyte Specification and Development in Drosophila melanogaster Genetics, August 1, 2003; 164(4): 1435 - 1446. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Michele and K. P. Campbell Dystrophin-Glycoprotein Complex: Post-translational Processing and Dystroglycan Function J. Biol. Chem., April 25, 2003; 278(18): 15457 - 15460. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||