|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00185


1 Instituto Cajal, CSIC, Avenida Doctor Arce 37, 28002 Madrid, Spain
2 Developmental Biology Programme, EMBL, Meyerhofstrasse 1, 69012 Heidelberg,
Germany
* Present address: Department of Biochemistry and Biophysics, University of
California San Francisco, 513 Parnassus Avenue, San Francisco, CA 94143,
USA
Authors for correspondence (e-mail:
bovolenta{at}cajal.csic.es;
jochen.wittbrodt{at}EMBL-Heidelberg.de)
Accepted 1 October 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Eye, Aes, Tle1, Transcriptional repression, medaka
| INTRODUCTION |
|---|
|
|
|---|
The evolutionarily conserved importance of Six genes in eye
development is illustrated by gain- and loss-of-function analysis in different
species (Pignoni et al., 1997
;
Pineda et al., 2000
;
Seimiya and Gehring, 2000
). In
vertebrates, Six3 over-expression induces the enlargement of the eye
and the ectopic appearance of retina primordia in medaka fish
(Loosli et al., 1999
) and
Xenopus (Bernier et al.,
2000
) embryos, as well as forebrain expansion in zebrafish
(Kobayashi et al., 1998
). In a
similar way, Six6 over-expression increases the eye size in
Xenopus (Bernier et al.,
2000
; Zuber et al.,
1999
), controlling retinal neuroblast proliferation
(Zuber et al., 1999
) and
induces trans-differentiation of dissociated pigment epithelium cells into
neural retina phenotypes (Toy et al.,
1998
). In human, loss-of-function mutations in SIX3 cause
holoprosencephaly type II (Pasquier et
al., 2000
; Wallis et al.,
1999
), whereas SIX6 has been associated with anophthalmia
and pituitary defects (Gallardo et al.,
1999
). The relevance of Six3 in head bilateralisation is
also demonstrated by loss-of-function experiments in medaka that implicates
Six3 in proximodistal patterning of the eye
(Carl et al., 2002
). Therefore,
while gain-of-function studies point to the capability of both genes to
control eye field growth, loss-of-function analysis and their specific
expression pattern suggest that their function may have diversified.
Comparison between the molecular networks that control Drosophila
and vertebrate eye development and the observation that mutations in the
so gene disrupt the development of the entire fly visual system, had
originally led to the proposal that Six3 may be the functional
counterpart of the Drosophila sine oculis (so) gene
(Oliver et al., 1995
).
However, isolation of two additional Drosophila Six genes,
optix and Dsix4 (Seo et
al., 1999
), and phylogenetic analysis of the Six family
members has shown that Six3 and Six6 are more closely
related to optix than to so, which is instead closely
related to Six1 and Six2
(Gallardo et al., 1999
). To
initiate eye development SO requires the interaction with the product of the
eyes absent gene (eya), which in turn binds to the Dachshund
protein (Chen et al., 1997
;
Pignoni et al., 1997
). This
complex acts downstream of eyeless (ey) and regulates
ey expression with a positive feed-back loop. Functional conservation
of this interaction has been demonstrated in vertebrates in the development of
the somites, where Pax3, Dach2, Eya2 and Six1 act synergistically to induce
muscle formation (Heanue et al.,
1999
). Whereas Six1, Six2, Six4 and Six5 interact with different
Eya proteins, inducing their translocation to the nucleus, Six3 does not
appear to interact with vertebrate Eya proteins
(Ohto et al., 1999
).
Optix, the Drosophila Six3 ortholog, is expressed in the eye
imaginal disk and does not interact with eya, but on its own induces
ectopic eye formation upon over-expression, with a mechanism that is
independent from that of so
(Seimiya and Gehring,
2000
).
These data altogether suggest that the genetic network in which
Six3/Six6 (and possibly optix) operate may include cofactors
other than those described for the fly SO and the vertebrate Six1 products. To
search for these possible components and to compare SIX3 and SIX6
interactions, we have performed a two-hybrid screen using either Six3
(Tessmar et al., 2002
) or
Six6 as a bait. Here, we report the results of the latter screening,
that has identified TLE1, a transcriptional repressor of the groucho
family and AES, a truncated form of TLE proteins
(Chen and Courey, 2000
), as
potential cofactors for both SIX6 and SIX3. The functional significance of
these interactions is supported by biochemical analysis and by the overlapping
distribution of both Tle1 and Aes with those of
Six3 and Six6 within the prospective eye regions.
Furthermore, gain-of-function studies in medaka embryos show a clear synergic
activity between SIX3/SIX6 and TLE1, which, on its own, can
expand the eye field. Conversely, AES alone decreases the eye size
and abrogates the phenotypic consequences of SIX3/6
over-expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The full-length or partial coding sequences of human SIX1
(hSIX1), hSIX3, hSIX6, mouse Six2
(mSix2) and mSix4 were cloned in pGBDUC3, while the
full-length or partial coding sequences of hTLE1, hTLE3 and
hAES were cloned in pVP16f1, using specific primers. The resulting
constructs were used to analyse protein interaction in the two-hybrid assay,
as follows. pGBDUC3 and pVP16f1 plasmids were transformed into the
pJ694
and pJ694a strain, respectively, and the resulting clones were
mated to generate diploid strains that were tested for their ability to grow
on SD-Leu-Ura, SD-Leu-Ura-Ade and SD-Leu-Ura-Ade-His + 3AT. Full-length
TLE1 and TLE3 plasmids were a generous gift from Dr S.
Stifani. The entire hAES coding sequence was amplified by RT-PCR from
human adult muscle mRNA. Point mutations of F87E and V95P, L99P in the Six
domain of the human SIX3, and F9E and V17P, L21P in the Six domain of human
SIX6 were generated by in vitro mutagenesis (Quickchange site-directed
mutagenesis kit; Stratagene) using specific primers and the respective
wild-type plasmids as template. Deletion of amino acids 87-103 of human SIX3
and amino acids 9-25 of human SIX6 were obtained by PCR amplification using
the forward primers SIX3
87-103Fw:
ATGTTCCAGCTGCCCACCCTCAACGACATCGAGCGGCTG and SIX6
9-25Fw:
ACCATGTTCCAGCTGCCCATCTTGAATGATGTGGAGCGCCTG. The amino-terminal deletions of
both SIX3 and SIX6 were obtained by PCR amplification and subsequent
cloning.
GST pull-down assays
pGEX-TLE11-135 (QD) and
pGEX-TLE3490-772 (WDRD) were a generous gift from Dr S.
Stifani. Full-length hAES was cloned into pGEX-A expression vector to
generate a GST-AES fusion protein. Recombinant proteins were purified from
induced cultures and bound to a glutathione resin (AP Biotech). All proteins
were quantified by SDS-PAGE and Coomassie staining, and equivalent amounts (5
µg) of protein were used in each assay. Full-length hSIX3,
hSIX6 and hSIX1 were cloned into pCDNA3-Flag using specific
primers. These plamids were used to generate full-length proteins using the
TnT T7 Coupled Rabbit Reticulocyte Lysate System (Promega). Proteins were
analysed by SDS-PAGE and western blotting using a specific monoclonal
anti-Flag antibody (Sigma) prior to interaction assays. In vitro synthesised
Flag-tagged SIX3, SIX6 and SIX1 proteins were incubated with GST fusion
proteins bound to 30 µl of glutathione resin in binding buffer (PBS, 0,1%
NP-40, 100 µM PMSF, 1 µg/ml leupeptine and 2 µg/ml aprotinine),
overnight at 4°C. Pelleted resins were extensively washed in binding
buffer and PBS, boiled in Laemmli loading buffer and examined by SDS-PAGE.
Gels were transferred to nitrocellulose membranes that were sequentially
incubated with anti-Flag antibody (1:6000), HRP-labelled goat anti-mouse
secondary antibody (1:10000) and ECL chemiluminescent system (AP Biotech).
Blots were exposed on ECL Hyperfilm (AP Biotech).
Cloning of medaka Tle1, Tle3 and Tle4 probes
First strand cDNA was generated by oligo (dT) reverse transcription using
total mRNA from stage 23 medaka embryos. The degenerate primers used for
specific PCR amplification of the different members of the Groucho
family are the followings: Tle1,
5'-AAYATHGARATGCAYAARCARGC-3' and
5'-RAACCAYTTNCCRCARTGNGCRA-3'; Tle3,
5'-AARGGNTNYGTNAARATHTGGGA-3' and
5'-CCNGTIACDATRTAYTTRTCRTC-3'; Tle4,
5'-AARGGNTGYGTNAARGTITGGGA-3' and
5'-RAACCAYTTNCCRCARTGNGCRA-3'. The TD-PCR conditions used are as
follows: 95°C for 30 sec, 60°C 30 sec (-1°C per cycle), 72°C 2
minutes, for 20 cycles, followed by an additional 20 cycles with a constant
annealing temperature of 60°C. Aes probe corresponded to the
medaka EST sequence Olc21.06f (Medaka EST project, University of Tokyo). The
amplified products were cloned into pGEM-T Easy vector (Promega) and
sequenced. The sequences were aligned with those of their orthologues and
paralogues to confirm unequivocally their identity as the Tle1, Tle3
and Tle4 medaka genes. All sequences have been deposited in the
databases with accession numbers AY158892, AY158893 and AY158894.
Whole-mount in situ hybridisation
Whole-mount in situ hybridisation was performed as described previously
using DIG-labelled probes (Loosli et al.,
1998
). Six3, Pax6, Otx2
(Loosli et al., 1998
) and
Rx2 (Loosli et al.,
1999
) probes have been described previously.
mRNA injections
Full-length TLE1, AES, SIX3 and SIX6 were cloned into
pCS2+ vector using specific primers. The plasmids were linearised and in vitro
transcribed using the SP6 Message mMachine kit (Ambion). The synthesised mRNA
was purified using Quiaquick RNeasy columns (Quiagen), precipitated,
quantified and injected in 1x Yamamoto Ringer
(Yamamoto, 1975
) into one
blastomere in the two to four cell stage of medaka embryos. All the injection
solutions included 30 ng/ml of hGFP mRNA as a lineage tracer. Both
TLE1 and AES mRNA were injected at different concentrations
(50-250 ng/µl). The induced phenotypes were dose dependent. Selected
working concentrations were 100 ng/µl for TLE1 mRNA and 200
ng/µl for AES. The corresponding SIX3 and SIX6 plasmids were used
as templates for in vitro mutagenesis, as described above.
| RESULTS |
|---|
|
|
|---|
Drosophila Groucho and its vertebrate homologues, known also as
TLE [transducin-like enhancer of split, according to nomenclature in humans
(Stifani et al., 1992
)], are
long-range co-repressor proteins that do not bind directly to DNA but are
recruited to the template through protein-protein interaction with specific
sets of DNA-binding transcription factors (reviewed by
Chen and Courey, 2000
;
Fisher and Caudy, 1998
). In
vertebrates, there are four different TLE proteins: TLE1, TLE2, TLE3 and TLE4
(Koop et al., 1996
;
Miyasaka et al., 1993
;
Schmidt and Sladek, 1993
;
Stifani et al., 1992
). As
schematised in Fig. 1A, for
human, Groucho/TLE proteins are characterised by the highly conserved
N-terminal Gln-rich (QD) and C-terminal WD-40 repeats (WDR) domains.
Interactions with DNA-binding proteins have been frequently mapped to the WDR
domain, but there are several examples of interactions through the QD and
multiple contact points have been reported for a number of proteins, including
Pax5, BF1, NK3 and UTY (Choi et al.,
1999
; Grbavec et al.,
1999
; Eberhard et al.,
2000
; Yao et al.,
2001
). The QD domain is in addition responsible for
oligomerization between members of the family, a prerequisite for efficient
transcriptional repression. In addition to Groucho/TLE proteins, both
invertebrate and vertebrate genomes code for a truncated family member, known
as AES, composed only of the QD and GP domains
(Fig. 1A). Because AES lacks
most of the domains present in TLE proteins, but is able to associate with
itself and TLE proteins through the QD domain, it has been proposed that AES
behaves as a negative regulator of the repression mediated by TLE, possibly
diminishing the local concentration of repressor units
(Chen and Courey, 2000
;
Fisher and Caudy, 1998
;
Muhr et al., 2001
;
Roose et al., 1998
). Evidence
however exists that AES, when fused to a DNA binding domain, can also behave
as a repressor (Ren et al.,
1999
) and that in some cases fails to compete with the repressor
activity of TLE proteins (Eberhard et al.,
2000
).
|
Differential interaction of SIX3 and SIX6 with AES and TLE1
Six genes code for proteins with two highly conserved domains: the
homeo domain (HD), responsible for DNA binding and the Six domain (SD),
involved in both DNA and protein binding
(Kawakami et al., 1996
). These
two domains are nearly identical in SIX3 and SIX6. The N-terminal portion is
longer in SIX3 and includes a Gly-rich region of unknown function, absent in
SIX6. The C terminus is the most divergent domain with the important exception
of the last nearly identical 15 amino acids
(Rodriguez de Cordoba et al.,
2001
).
Taking advantage of the strong conservation of both the Six and Groucho families of proteins, we have used the human genes to map the interactions between these two classes of molecules. On the basis of the structural and functional domains described above, we generated a series of constructs containing the full-length or specific domains of SIX and groucho/TLE human genes (Fig. 1A). These constructs were used in a yeast two-hybrid analysis, which shows that both full-length SIX3 and SIX6 interact strongly with the entire TLE1 and AES proteins, as judged by growth in highly selective media (Fig. 1B). This interaction is mediated by the QD domain of Gro/TLE proteins and the N-terminal region of SIX proteins, which includes the Six domain (SD). The latter is probably responsible of the interaction, since the N-terminal region of SIX6, which is composed almost exclusively by the SD, behaves similarly to that of SIX3. Comparable results were also obtained with SIX1 and with the mouse Six2 but not with mouse Six4, which, under stringent conditions, interacted only with the isolated QD of TLE1 (Fig. 1B). Interestingly, Drosophila Optix showed similar interactions with Groucho as well as with TLE1 and AES (Fig. 1B).
Interaction between the Six domain of Six3.2 and the isolated WDR domain of
Ggr3, the orthologue of human TLE3, has been described in zebrafish
(Kobayashi et al., 2001
). In
our analysis, a weak interaction between the full-length or
SIX31-205 and TLE1 or TLE3 WDR domain was observed but only under
low stringency conditions (Fig.
1C). A similar weak interaction was detected with mSix4 but, most
interestingly, not with SIX6.
The interactions of SIX3, SIX6 and SIX1 (for comparison) with TLE/AES were further validated with GST pull-down assays, using in vitro synthesised Flag-tagged proteins. Western blot analysis confirmed that the three SIX proteins specifically co-precipitated with AES as well as with the TLE1 QD (Fig. 1D). In agreement with our two hybrid analysis, a lower amount of SIX3, but not of SIX6 or SIX1, co-precipitated with the WDR domain of TLE1 (Fig. 1D).
In conclusion, these data indicate that there is a comparable interaction of SIX3 and SIX6 with AES through the QD domain. However, the interaction of SIX3 with TLE1 is expected to be stronger than that of SIX6 because of the ability of SIX3 to interact with TLE proteins via two different domains.
Medaka Tle1 and Aes genes are expressed since early
stages of eye development
To assess the possible in vivo relevance of these interactions during eye
development, we investigated whether in medaka embryos the expression of
groucho/Tle genes, in particular Tle1 and Aes,
overlaps with that of Six3 and Six6 at different stages of
eye development. To this end we generated probes to the medaka Aes,
Tle1 and the closely related Tle4
(Choudhury et al., 1997
), as
well as for the Tle3 gene.
The results of whole-mount in situ hybridisation analysis are shown in
Fig. 2. Medaka Tle1
transcripts are first detected during early neurula stage, in the most
anterior part of the embryonic body (data not shown). At late neurula stage,
Tle1 but not Tle3 shows a prominent expression in the
anterior brain, including the evaginating optic vesicles
(Fig. 2D,G), overlapping with
the expression domain of Six3
(Fig. 2A-C)
(Loosli et al., 1998
) and of
Six6 at later stages of development
(Fig. 2P-R). Like Six3
and Six6, Tle1 expression was detected at high levels in the eye
domain as well as in the ventral diencephalon through optic cup and eye
differentiation stages (Fig.
2B-C,E-F,Q-R). In contrast, Tle3 mRNA was detected in the
lens but not in other eye structures (Fig.
2H,I). Both Tle1 and Tle3 showed additional
sites of expression in the CNS including, for Tle1, the hindbrain and
the fore-, mid- and hindbrain for Tle3
(Fig. 2D-I). In comparison to
Tle1, Tle4 has a later onset and a weaker expression but this is
confined to the eye, particularly the neural retina and the optic stalk
(Fig. 2K), and to the ventral
diencephalic region, including the optic chiasm
(Fig. 2L).
|
Aes expression was detected in the anterior neural tube, localised to the evaginating optic vesicle and the prospective midbrain region (Fig. 2M). At later stages, Aes mRNA became more widely distributed throughout the embryo with clear levels in the eye and in the ventral diencephalon (Fig. 2N,O), overlapping with Six3 and Six6 expressions.
In conclusion, the spatiotemporal expression of both Tle1 and Aes are compatible with their associations with Six3 and/or Six6 during retina specification and morphogenesis. Tle4 is an additional candidate but only at later stages of development. These ideas are further supported by the observation that similar overlapping distributions are conserved in chick embryos (data not shown). In the medaka eye, the possible interaction between Tle3 and Six3 may be limited to lens tissue, the only site where the expression of the two genes overlaps.
TLE1 over-expression induces an enlargement of the eye field
and reinforces SIX3/SIX6 capability of initiating retina
formation
Biochemical and expression analysis are consistent with the idea that Tle1
and Aes participate in the molecular network that controls eye development, as
potential cofactors for Six3 and Six6. To test the functional significance of
these interactions we over-expressed TLE1 or AES alone or in
combinations with SIX3 or SIX6 in medaka embryos.
The morphological and molecular consequences of TLE1 RNA
injections into a single blastomere of embryos at the two- to four-cell stage
are shown in Fig. 3. The most
prominent phenotypic feature of the injected embryos is an enlargement of the
optic vesicles, which is maintained in more developed eyes and it is often
accompanied by bulging of the midbrain
(Fig. 3A). These morphological
changes were observed in 39% of the injected embryos (91/232) and are similar
to those observed with injections of low doses of Six3 RNA (not
shown) (Loosli et al., 1999
).
In the affected embryos, endogenous Six3 expression domain was
generally enlarged to a variable degree into the midbrain
(Fig. 3B). Similarly, the
expression of both Pax6 (Fig.
3F) and that of Rx2
(Fig. 3D), a retina marker, was
also consistently expanded as compared to controls
(Fig. 3C,E). In addition, while
TLE1 over-expression was not found to induce the appearance of
ectopic Rx2 transcripts in the midbrain, ectopic isolated patches of
Pax6 expression were observed in the midbrain
(Fig. 3F). These alterations
were detected also at later stages of development and were restricted to the
fore- and mid-brain. Thus, in spite of the bulging, the midbrain was normally
specified, as judged by En2 and Pax2 expression (not shown).
Furthermore, the posterior limit of Otx2 expression at the isthmus
was located normally, though somewhat tilted due to midbrain alterations
(Fig. 3H). No patterning
defects were ever observed in more posterior regions of the embryos.
Injections of similar concentrations of TLE2 was not followed by
enlargement of the eye field or by other obvious morphological alterations
(not shown).
|
Injections of Six3 RNA in medaka embryos leads to a
concentration-dependent expansion of the eye and other brain structures, which
is accompanied, at higher doses, by the appearance of additional ectopic
Rx2-positive retina tissue in the dorsal midbrain
(Loosli et al., 1999
).
Six6 over-expressed in Xenopus embryos induces similar
enlargements of the eye field (Bernier et
al., 2000
; Zuber et al.,
1999
), which, in medaka, are also followed by the formation of
ectopic Rx2-positive retina tissue, though with less efficiency than
with Six3 (F. L., J. W., unpublished observations and
Fig. 6C,
Table 1). If Tle1 acts as a
cofactor for either Six3 or Six6, it should be expected that co-injections of
TLE1 with sub-optimal concentrations of either SIX3 or
SIX6 can mimic the phenotypic consequences of injecting higher doses
of SIX3/SIX6 RNA (i.e. the appearance of ectopic
Rx2-positive tissue). As shown in
Table 1, SIX3 or
SIX6 RNA concentrations below 20 ng/µl were ineffective in
inducing ectopic Rx2 expression. About 50 ng/µl of mRNA were
generally required to induce this phenotype in roughly half of the injected
embryos (Fig. 4E). However,
when clearly sub-optimal concentrations (10 ng/µl;
Fig. 4A,C) of either
SIX3 or SIX6 were co-injected with TLE1 (100
ng/µl), a significant number of embryos
(Table 1) presented ectopic
expression of Rx2, besides an enlargement of the eye
(Fig. 4B,D). This synergic
activity was also observed with higher doses of SIX3/SIX6, resulting
in the striking appearance of several independent ectopic
Rx2-positive sites (Fig.
4F). In all the cases analysed, these patches were confined to the
midbrain, as in the SIX3/SIX6 over-expression.
|
|
|
AES over-expression leads to eye hypoplasia and counteracts
SIX3/SIX6 gain of function phenotype
The data described above indicate that TLE1 per se can enlarge the eye
field and its interaction with SIX3/6 boosts the capability of these factors
to initiate ectopic retina tissue formation. In agreement with the idea that
AES may function as a dominant negative form of TLE protein, AES mRNA
injections generated a visible reduction of the eye size in 50/182 (27%) of
the injected embryos (Fig. 5A).
This was not due to a delayed development of the eye since it was observed
also at later developmental stages (Fig.
5B). Consistent with this phenotype, Six3 and
Rx2 expression was reduced in all the affected embryos analysed
(Fig. 5C,F). In a smaller
proportion of the embryos, the effect of AES over-expression was more
dramatic, leading to the presence of a single eye field
(Fig. 5G) or to the loss of
both eyes (Fig. 5D). In the
latter case, the expression of Six3 was restricted to the midline of
the ventral diencephalon, possibly corresponding to prospective hypothalamic
and pituitary region (Fig. 5E).
Mildly affected embryos with a moderate reduction of the eye size presented no
other obvious brain malformations, as judged by normal Pax6
expression (Fig. 5H).
Otx2-positive midbrain tissue appeared morphologically normal, even
though ectopic Otx2 expression into the hindbrain was occasionally
observed (Fig. 5I).
|
Furthermore, AES over-expression abrogated significantly the ectopic formation of Rx2-positive tissue in the midbrain, when co-injected with amounts of either SIX3 or SIX6 mRNA (50 ng/µl) capable of inducing ectopic retina-like tissue (Fig. 6). Thus, in the presence of AES, the frequency of appearance of Rx2-positive tissue in the tectum decreased from 47% to 7% for SIX3 and from 38% to 3% for SIX6 (Table 1). This was an `all-or-none' effect and no intermediate levels of Rx2 expression were observed in the co-injections.
Altogether these data show that TLE1 and AES have opposing effects on SIX3 and SIX6 protein activities and thus uncover how Six3/Six6 act as repressors and function in the determination and maintenance of retinal identity.
Mutant SIX proteins that do not interact with TLE1/AES are unable to
initiate ectopic retina formation
To test whether the overexpression phenotype of SIX3/SIX6 relies on the
recruitment of endogenous Groucho proteins, we generated mutant forms of both
SIX3 and SIX6 in which these interactions were disrupted. Secondary structure
analysis of the Six domain
(http://cubic.bioc.columbia.edu/predictprotein)
reveals its potential folding in four
-helix stretches. Therefore, we
generated a series of N-terminal deletions in both SIX3 and SIX6, carrying
sequential deletions of each of these helical regions and assayed their
interactions by two-hybrid analysis.
SIX3
1-86 and SIX6
1-8 were still able to interact strongly
with both full-length AES and TLE1, as expected given that these constructs
include the entire Six domain. However, the inclusion of the first predicted
-helix in the deletion (SIX3
1-103 and SIX6
1-25), clearly
impaired the interaction of both SIX proteins with TLE1 and AES (not shown).
To further analyse the importance of these region for the interaction, we
specifically deleted only the first helical region in the Six domains of SIX3
and SIX6 (SIX3
87-103 and SIX6
9-25) and generated four different
point mutations in the same stretch of amino acids: SIX3-V95P, L99P;
SIX6-V17P, L21; SIX3F87E and SIX6F9E. The first two double point mutations
affect highly conserved residues and are predicted to lead to the disruption
of the helical structure. The other two point mutations have been described
very recently as being necessary for Six3 interaction with Groucho proteins
(Zhu et al., 2002
). As shown
in Table 2, all six mutations
lead to a loss of interaction with TLE1 and AES, with the exception of
SIX3F87E, which still shows a weak interaction with AES. To assay the
functional relevance of these mutations, we over-expressed them in medake
embryos. Table 2 shows that all
of them are complete loss-of-function mutations, unable to affect eye
development and induce ectopic Rx2-expressing retinal structures in
the midbrain. Moreover, when co-injected with TLE1, no functional synergism is
observed, not even when the amount of mutant RNA is raised to 50 ng/µl.
When co-injected with AES, none of the mutant forms of SIX showed any
functional interaction with AES, in spite of the weak biochemical interaction
shown by SIX3F87E, as mentioned above.
|
These data strongly support the hypothesis that the specific interaction between TLE and Six3/Six6 is crucial for normal eye development and the cause of the over-expression phenotype observed in our studies.
| DISCUSSION |
|---|
|
|
|---|
Six3 and Six6 have different biochemical interactions
The Gro/TLE is a family of conserved transcriptional co-repressors required
for many developmental processes in both invertebrates and vertebrates.
Gro/TLE proteins are capable of interacting with a variety of DNA-binding
transcription factors and, once recruited to DNA, mediate transcriptional
repression through a series of mechanisms. These include multimerization of
TLE proteins along the DNA template and interaction with histones and histone
deacetylases, capable of altering the local chromatin structure (reviewed by
Chen and Courey, 2000
;
Courey and Jia, 2001
). The
repression activity of Gro/TLE proteins is inhibited in many cases by AES, a
shorter version of these proteins, composed essentially of the QD domain that
mediates AES function (Muhr et al.,
2001
; Ren et al.,
1999
; Roose et al.,
1998
). Therefore, Gro/TLE proteins might be considered as
multipurpose modulators of transcription. Our two-hybrid analysis has
identified both Tle1 and Aes as co-factors of Six6. A screen of the same
library, performed in similar conditions, showed that Six3 has the capability
of interacting with the same two Gro/Tle proteins. Interestingly, however,
while no other candidates emerged from the Six6 screen, several additional
proteins were isolated as Six3-interacting factors. These did not include any
Eya proteins, even though PCR analysis confirmed their presence in the yeast
two-hybrid library (Tessmar et al.,
2002
). These results further support the idea that the conserved
SO/Six1 interaction with Eya proteins is not a feature of the Optix/Six3/Six6
branch of the family (Heanue et al.,
1999
; Ohto et al.,
1999
; Seimiya and Gehring,
2000
).
Mapping of the SIX/TLE interaction domains using the human proteins
identified additional differences between SIX3 and SIX6. Both proteins
interact, through the Six domain, with the QD domains of AES and TLE1. The
main but not exclusive function of the QD domain is mediating homo- and
hetero-oligomerization among Gro/Tle proteins
(Pinto and Lobe, 1996
). Our
results showing a specific interaction between the QD domain of TLE and the
first putative alpha helix of the Six domain of SIX3/SIX6 are consistent with
data reported for other transcription factors binding TLE proteins through the
QD domain (McLarren et al.,
2000
; Ren et al.,
1999
). In addition, SIX3, but not SIX6, shows an additional
interaction with the WDRD. Therefore, in spite of their strong homology, SIX3
and SIX6 behave differently in their interaction with other proteins. In
particular, in the case of Gro/TLE interaction, the SIX3/TLE1 complex might be
favoured and more effective than that formed by SIX6/TLE1, since simultaneous
interactions through different domains may be necessary for a more efficient
recruitment of TLE to DNA tethered factors
(Eberhard et al., 2000
).
The nature of Six3 and Six6 as transcriptional repressors has been
previously proposed on the basis of over-expression studies in
Xenopus and zebrafish, where fusions of Six3 or Six6 with the
engrailed repression domain could mimic Six3 or
Six6 over-expression phenotypes
(Kobayashi et al., 2001
;
Zuber et al., 1999
). In
zebrafish, this assumption was further validated showing that in a yeast
two-hybrid assay the Six domain of Six3.2 could interact with the WDR
domain of Tle/Grg3 (Kobayashi et al.,
2001
). Our results confirm and extend these observations
demonstrating, as a result of two-hybrid screens, that both Six3 and Six6
interact with Groucho/Tle proteins through the conserved QD domain.
Furthermore, the identification of a novel interaction between Six3/Six6 and
Aes suggests alternative mechanisms of Six3/Six6 activity, including Six3/Aes-
and/or Six6/Aes-mediated transcriptional derepression strategies.
Tle1 and Aes have opposing activity in retina development
The amino acid sequences of Gro/TLE family members are highly conserved.
For instance, the WDR and QD domains of TLE1 or TLE3 share 93% and 84% of
identity, respectively. Thus, it is not surprising that in vitro both
molecules interact with SIX3 and SIX6. However, expression analysis and
functional data point to Tle1 and Aes as the most likely partners of Six3 and
Six6 activities in the early patterning of the eye in medaka. Thus,
TLE2 over-expression does not perturb eye development, and
Tle3 expression in the eye is limited to the lens vesicle. In
contrast, Tle1 and Aes are expressed from early stages in
the eye field, overlapping with the distribution of Six3 and later
with that of Six6. Tle4, the expression of which was first detected
at optic cup stages, restricted almost exclusively to the eye, is an
additional candidate for Six3/6 functions during retina differentiation.
TLE1 over-expression enlarges the retina field, expanding the
expression of both Six3 and Rx2, without major modifications
in the expression of other anterior markers such as Otx2. Although
the precise function of AES is still controversial
(Eberhard et al., 2000
),
AES over-expression considerably reduces the eye size and the
expression of Six3 and Rx2, supporting the idea that in the
eye, as in dorso-ventral patterning of the neural tube and in Xenopus
axis formation (Muhr et al.,
2001
; Roose et al.,
1998
), Aes might act as an inhibitor of Tle function. A priori, we
cannot exclude that these effects might be mediated, at least in part, by the
interaction with transcription factors expressed in the eye field other than
Six3 and Six6. For example, the sequence of Rx proteins includes an engrailed
homology (eh1) related motif, known to mediate Tle recruitment in other
proteins (Eberhard et al.,
2000
; Muhr et al.,
2001
). In addition, the interaction of Tle1 with En1, En2, Pax2 or
Pax5, all of which are involved in midbrain patterning
(Araki and Nakamura, 1999
;
Eberhard et al., 2000
), may
explain the alteration of this structure that we observed in several
gain-of-function embryos. However, co-injection experiments of wild-type and
mutated SIX proteins with Gro/TLE family members support the idea that
TLE1 and AES overexpression phenotypes are the result of the
modulation of endogenous Six3/Six6 activity by TLE1/AES. Critical
concentrations of either SIX3 or SIX6 induces the ectopic
formation of retina tissue in the anterior brain. The number and size of these
ectopic structures is increased when TLE1 is co-injected.
Furthermore, TLE1 allows the formation of ectopic structures even at
suboptimal concentrations of SIX3/SIX6, an effect that is not
observed with the injections of SIX proteins carrying mutations that abolish
the interaction with TLE1. AES efficiently abrogates this phenotype,
substantiating further the model that TLE1/AES are modulating
SIX3/SIX6 function. In agreement with a specific involvement of
TLE1/AES in eye development, we never observed any malformations in
the posterior regions of the embryos. Furthermore, the reported phenotypes
caused by overexpression of other Gro/Tle are quite distinct from
those we observed. mRNA injection of XGrg4/Tle4 in Xenopus
oocytes inhibits Tcf-dependent axis formation, an event that is
instead enhanced by XGrg5/Aes
(Roose et al., 1998
). In ovo
electroporation of the Grg4/Tle4 chick homologue inhibited
En2 and Pax5 expression, altering mesencephalic borders
(Sugiyama et al., 2000
).
Complementing our observations, while this paper was under revision, Zhu et
al. (Zhu et al., 2002
)
reported that Six3 interaction with Groucho proteins is also relevant for
other steps of vertebrate eye development, namely lens morphogenesis in the
chick and photoreceptors differentiation in the rat retina.
Although we have not addressed this issue, it is likely that Gro/Tle
proteins cooperate with Six3/Six6 in the development of other structures where
these genes are strongly co-expressed. This might be the case for the
pituitary gland, the development of which may require Six3/6 functions
(Gallardo et al., 1999
).
Interestingly, Tle1 is expressed during mouse pituitary organogenesis, where
it has been shown to interact at least with Hesx1 to prevent the activity of
Prop1, a paired-like transcriptional activator related to Hesx1
(Dasen et al., 2001
).
Possible models for Tle/Aes modulation of Six3/Six6 transcriptional
activities
The results of our gain-of-function studies are consistent with a simple
model, in which both Six3 and Six6 can act in combination with either Tle1
and/or Aes. Six3 and Six6 may bind to distinct DNA binding sites. Their
interaction with either Tle1 or Aes will lead to transcriptional repression or
activation, respectively. In a more elaborated possibility, both Six3 and Six6
could be the DNA binding elements of a larger transcriptional repressor
complex, the repressosome (Courey and Jia,
2001
), formed by Tle proteins and additional factors recruited
through interaction with Six3 or Tle1. In agreement with this idea, Six3 is
able to directly contact other nuclear factors including SWI/SNF proteins
(Tessmar et al., 2002
),
involved in the chromatin remodelling required during transcription repression
(Sudarsanam and Winston,
2000
). Aes recruitment into the complex would provide a mechanism
of derepression. Alternatively, other factors could compete with Tle1 for
binding to Six3 (Tessmar et al.,
2002
), thus modulating Six3/Tle activity in a way similar to that
described for TLE1, Cbfa1 and HES1
(McLarren et al., 2000
). These
two models imply that both Six proteins interact with Gro/TLE with a similar
affinity. However, yeast two-hybrid and biochemical analyses suggest that the
SIX3/TLE1 interaction might be stronger than that of SIX6/TLE1, because it is
mediated by an additional binding site. Furthermore, if the homeodomain on its
own confers DNA binding specificity, Six3 and Six6 could compete for the same
DNA binding sites, as only a single amino acid substitution differentiates
their HD (Gallardo et al.,
1999
). Therefore, as a third possibility, the Six3/Tle1 complex
could act as a transcriptional repressor unit, the activity of which could be
regulated by a dominant negative complex formed by Six6/Aes. This model
provides a specific function for both Six3 and Six6 and is compatible with the
available expression, gain- and loss-of-function data on the two molecules.
The Six6 expression pattern is more restricted than that of Six3 and, in
general, occurs later in development
(Gallardo et al., 1999
;
Lopez-Rios et al., 1999
).
Thus, Six3 patterning activities in the anterior neural plate could be
alleviated by subsequent expression of Six6 in this tissue, allowing the
Six6-Aes complex to displace Six3-Tle1 from their binding sites and releasing
the repression state of the regulated loci. This would be in agreement with
the observations that in humans, impairment of either SIX3 or
SIX6 function is associated with different phenotypes
(Gallardo et al., 1999
;
Wallis et al., 1999
). When
over-expressed, however, larger amounts of either SIX3 and SIX6 are readily
available to interact indistinctly with either Tle1 and Aes. This results in a
comparable behaviour where both SIX3 and SIX6 increase neuroblasts
proliferation and impose retinal identity to `competent' neural tissue
(Bernier et al., 2000
;
Loosli et al., 1999
;
Toy et al., 1998
;
Zuber et al., 1999
) (this
report).
This repression-derepression strategy based on the differential interaction of closely related Six family members with Gro/Tle proteins could be extended conceptually to other Six genes. Indeed, Six1, Six2 and Six4 interact with both Tle1 and Aes in vitro.
In conclusion, Gro/Tle proteins participate in the genetic network that
controls eye patterning in vertebrates. We propose that in vivo Tle1 and Aes
do have differential interactions with Six3 and Six6, contributing to
diversify the function of these two closely related Six genes.
Whether the complex of Six3/6 with Tle/Aes is needed for eye specification
throughout evolution, remains to be established. However, as shown here, Optix
interacts with Groucho in a similar fashion and an Aes orthologue is
present in the Drosophila genome
(Chen and Courey, 2000
),
suggesting that optix activity in eye development may also require
these cofactors.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Agatep, R., Kirkpatrick, R. D., Parchaliuk, D. L., Woods, R. A. and Gietz, R. D. (1999). Transformation of Saccharomyces cerevisiae by the lithium acetate/single-stranded carrier DNA/polyethylene glycol (LiAc/ss-DNA/PEG) protocol. Technical Tips Online (http://tto.trends.com).
Araki, I. and Nakamura, H. (1999). Engrailed defines the position of dorsal di-mesencephalic boundary by repressing diencephalic fate. Development 126,5127 -5135.[Abstract]
Bernier, G., Panitz, F., Zhou, X., Hollemann, T., Gruss, P. and Pieler, T. (2000). Expanded retina territory by midbrain transformation upon overexpression of Six6 (Optx2) in Xenopus embryos. Mech. Dev. 93,59 -69.[CrossRef][Medline]
Bovolenta, P., Mallamaci, A., Puelles, L. and Boncinelli, E. (1998). Expression pattern of cSix3, a member of the Six/sine oculis family of transcription factors. Mech. Dev. 70,201 -203.[CrossRef][Medline]
Carl, M., Loosli, F. and Wittbrodt, J. (2002).
Six3 inactivation reveals its essential role for the formation and patterning
of the vertebrate eye. Development
129,4057
-4063.
Chen, G. and Courey, A. J. (2000). Groucho/TLE family proteins and transcriptional repression. Gene 249, 1-16.[CrossRef][Medline]
Chen, R., Amoui, M., Zhang, Z. and Mardon, G. (1997). Dachshund and eyes absent proteins form a complex and function synergistically to induce ectopic eye development in Drosophila. Cell 91,893 -903.[CrossRef][Medline]
Choi, C. Y., Kim, Y. H., Kwon, H. J. and Kim, Y.
(1999). The homeodomain protein NK-3 recruits Groucho and a
histone deacetylase complex to repress transcription. J. Biol.
Chem. 274,33194
-33197.
Choudhury, B. K., Kim, J., Kung, H. F. and Li, S. S. (1997). Cloning and developmental expression of Xenopus cDNAs encoding the Enhancer of split groucho and related proteins. Gene 195,41 -48.[CrossRef][Medline]
Courey, A. J. and Jia, S. (2001).
Transcriptional repression: the long and the short of it. Genes
Dev. 15,2786
-2796.
Dasen, J. S., Barbera, J. P., Herman, T. S., Connell, S. O.,
Olson, L., Ju, B., Tollkuhn, J., Baek, S. H., Rose, D. W. and Rosenfeld, M.
G. (2001). Temporal regulation of a paired-like homeodomain
repressor/TLE corepressor complex and a related activator is required for
pituitary organogenesis. Genes Dev.
15,3193
-3207.
Eberhard, D., Jimenez, G., Heavey, B. and Busslinger, M. (2000). Transcriptional repression by Pax5 (BSAP) through interaction with corepressors of the Groucho family. EMBO J. 19,2292 -2303.[CrossRef][Medline]
Fisher, A. L. and Caudy, M. (1998). Groucho
proteins: transcriptional corepressors for specific subsets of DNA-binding
transcription factors in vertebrates and invertebrates. Genes
Dev. 12,1931
-1940.
Gallardo, M. E., Lopez-Rios, J., Fernaud-Espinosa, I., Granadino, B., Sanz, R., Ramos, C., Ayuso, C., Seller, M. J., Brunner, H. G., Bovolenta, P. et al. (1999). Genomic cloning and characterization of the human homeobox gene SIX6 reveals a cluster of SIX genes in chromosome 14 and associates SIX6 hemizygosity with bilateral anophthalmia and pituitary anomalies. Genomics 61, 82-91.[CrossRef][Medline]
Grbavec, D., Lo, R., Liu, Y., Greenfield, A. and Stifani, S. (1999). Groucho/transducin-like enhancer of split (TLE) family members interact with the yeast transcriptional co-repressor SSN6 and mammalian SSN6-related proteins: implications for evolutionary conservation of transcription repression mechanisms. Biochem. J. 337, 13-17.
Heanue, T. A., Reshef, R., Davis, R. J., Mardon, G., Oliver, G.,
Tomarev, S., Lassar, A. B. and Tabin, C. J. (1999).
Synergistic regulation of vertebrate muscle development by Dach2, Eya2, and
Six1, homologs of genes required for Drosophila eye formation.
Genes Dev. 13,3231
-3243.
Jessell, T. M. (2000). Neuronal specification in the spinal cord: inductive signals and transcriptional codes. Nat. Rev. Genet. 1,20 -29.[CrossRef][Medline]
Kawakami, K., Ohto, H., Ikeda, K. and Roeder, R. G.
(1996). Structure, function and expression of a murine homeobox
protein AREC3, a homologue of Drosophila sine oculis gene product, and
implication in development. Nucleic Acids Res.
24,303
-310.
Kawakami, K., Sato, S., Ozaki, H. and Ikeda, K. (2000). Six family genesstructure and function as transcription factors and their roles in development. BioEssays 22,616 -626.[CrossRef][Medline]
Kobayashi, M., Nishikawa, K., Suzuki, T. and Yamamoto, M. (2001). The homeobox protein Six3 interacts with the Groucho corepressor and acts as a transcriptional repressor in eye and forebrain formation. Dev. Biol. 232,315 -326.[CrossRef][Medline]
Kobayashi, M., Toyama, R., Takeda, H., Dawid, I. B. and Kawakami, K. (1998). Overexpression of the forebrain-specific homeobox gene six3 induces rostral forebrain enlargement in zebrafish. Development 125,2973 -2982.[Abstract]
Koop, K. E., MacDonald, L. M. and Lobe, C. G. (1996). Transcripts of Grg4, a murine groucho-related gene, are detected in adjacent tissues to other murine neurogenic gene homologues during embryonic development. Mech. Dev. 59, 73-87.[CrossRef][Medline]
Loosli, F., Koster, R. W., Carl, M., Krone, A. and Wittbrodt, J. (1998). Six3, a medaka homologue of the Drosophila homeobox gene sine oculis is expressed in the anterior embryonic shield and the developing eye. Mech. Dev. 74,159 -164.[CrossRef][Medline]
Loosli, F., Winkler, S. and Wittbrodt, J.
(1999). Six3 overexpression initiates the formation of ectopic
retina. Genes Dev. 13,649
-654.
Lopez-Rios, J., Gallardo, M. E., Rodriguez de Cordoba, S. and Bovolenta, P. (1999). Six9 (Optx2), a new member of the six gene family of transcription factors, is expressed at early stages of vertebrate ocular and pituitary development. Mech. Dev. 83,155 -159.[CrossRef][Medline]
McLarren, K. W., Lo, R., Grbavec, D., Thirunavukkarasu, K.,
Karsenty, G. and Stifani, S. (2000). The mammalian basic
helix loop helix protein HES-1 binds to and modulates the transactivating
function of the runt-related factor Cbfa1. J. Biol.
Chem. 275,530
-538.
Miyasaka, H., Choudhury, B. K., Hou, E. W. and Li, S. S. (1993). Molecular cloning and expression of mouse and human cDNA encoding AES and ESG proteins with strong similarity to Drosophila enhancer of split groucho protein. Eur. J. Biochem. 216,343 -352.[Medline]
Muhr, J., Andersson, E., Persson, M., Jessell, T. M. and Ericson, J. (2001). Groucho-mediated transcriptional repression establishes progenitor cell pattern and neuronal fate in the ventral neural tube. Cell 104,861 -873.[CrossRef][Medline]
Nakamura, H. (2001). Regionalization of the optic tectum: combinations of gene expression that define the tectum. Trends Neurosci. 24,32 -39.[Medline]
Ohto, H., Kamada, S., Tago, K., Tominaga, S. I., Ozaki, H.,
Sato, S. and Kawakami, K. (1999). Cooperation of six and eya
in activation of their target genes through nuclear translocation of Eya.
Mol. Cell Biol. 19,6815
-6824.
Oliver, G., Mailhos, A., Wehr, R., Copeland, N. G., Jenkins, N. A. and Gruss, P. (1995). Six3, a murine homologue of the sine oculis gene, demarcates the most anterior border of the developing neural plate and is expressed during eye development. Development 121,4045 -4055.[Abstract]
Parchaliuk, D. L., Kirkpatrick, R. D., Agatep, R., Simon, S. L. and Gietz, R. D. (1999). Yeast two-hybrid system screening. Technical Tips Online (http://tto.trends.com).
Pasquier, L., Dubourg, C., Blayau, M., Lazaro, L., Le Marec, B., David, V. and Odent, S. (2000). A new mutation in the six-domain of SIX3 gene causes holoprosencephaly. Eur. J. Hum. Genet. 8,797 -800.[CrossRef][Medline]
Pignoni, F., Hu, B., Zavitz, K. H., Xiao, J., Garrity, P. A. and Zipursky, S. L. (1997). The eye-specification proteins So and Eya form a complex and regulate multiple steps in Drosophila eye development. Cell 91,881 -891.[CrossRef][Medline]
Pineda, D., Gonzalez, J., Callaerts, P., Ikeo, K., Gehring, W.
J. and Salo, E. (2000). Searching for the prototypic eye
genetic network: Sine oculis is essential for eye regeneration in planarians.
Proc. Natl. Acad. Sci. USA
97,4525
-4529.
Pinto, M. and Lobe, C. G. (1996). Products of
the grg (Groucho-related gene) family can dimerize through the amino-terminal
Q domain. J. Biol. Chem.
271,33026
-33031.
Ren, B., Chee, K. J., Kim, T. H. and Maniatis, T.
(1999). PRDI-BF1/Blimp-1 repression is mediated by corepressors
of the Groucho family of proteins. Genes Dev.
13,125
-137.
Rodriguez de Cordoba, S., Gallardo, M. E., Lopez-Rios, J. and Bovolenta, P. (2001). The Human SIX family of Homeobox Genes. Curr. Genomics 2,231 -242.[CrossRef]
Roose, J., Molenaar, M., Peterson, J., Hurenkamp, J., Brantjes, H., Moerer, P., van de Wetering, M., Destree, O. and Clevers, H. (1998). The Xenopus Wnt effector XTcf-3 interacts with Groucho-related transcriptional repressors. Nature 395,608 -612.[CrossRef][Medline]
Schmidt, C. J. and Sladek, T. E. (1993). A rat
homolog of the Drosophila enhancer of split (groucho) locus lacking WD-40
repeats. J. Biol. Chem.
268,25681
-25686.
Seimiya, M. and Gehring, W. J. (2000). The Drosophila homeobox gene optix is capable of inducing ectopic eyes by an eyeless-independent mechanism. Development 127,1879 -1886.[Abstract]
Seo, H. C., Curtiss, J., Mlodzik, M. and Fjose, A. (1999). Six class homeobox genes in drosophila belong to three distinct families and are involved in head development. Mech. Dev. 83,127 -139.[CrossRef][Medline]
Simeone, A. (2000). Positioning the isthmic organizer where Otx2 and Gbx2 meet. Trends Genet. 16,237 -240.[CrossRef][Medline]
Stifani, S., Blaumueller, C. M., Redhead, N. J., Hill, R. E. and Artavanis-Tsakonas, S. (1992). Human homologs of a Drosophila Enhancer of split gene product define a novel family of nuclear proteins. Nat. Genet. 2,119 -127.[CrossRef][Medline]
Sudarsanam, P. and Winston, F. (2000). The Swi/Snf family nucleosome-remodeling complexes and transcriptional control. Trends Genet. 16,345 -351.[CrossRef][Medline]
Sugiyama, S., Funahashi, J. and Nakamura, H. (2000). Antagonizing activity of chick Grg4 against tectum-organizing activity. Dev. Biol. 221,168 -180.[CrossRef][Medline]
Tessmar, K., Loosli, F. and Wittbrodt, J. (2002). A screen identifies basic helix loop helix proteins as biochemical interactors of Six3. Mech. Dev. (in press).
Toy, J., Yang, J. M., Leppert, G. S. and Sundin, O. H.
(1998). The optx2 homeobox gene is expressed in early precursors
of the eye and activates retina-specific genes. Proc. Natl. Acad.
Sci. USA 95,10643
-10648.
Wallis, D. E., Roessler, E., Hehr, U., Nanni, L., Wiltshire, T., Richieri-Costa, A., Gillessen-Kaesbach, G., Zackai, E. H., Rommens, J. and Muenke, M. (1999). Mutations in the homeodomain of the human SIX3 gene cause holoprosencephaly. Nat. Genet. 22,196 -198.[CrossRef][Medline]
Yamamoto, T. (1975). Medaka (Killifish), Biology and Strains. Tokyo, Japan: Keigaku Publishing Company.
Yao, J., Lai, E. and Stifani, S. (2001). The
winged-helix protein brain factor 1 interacts with groucho and hes proteins to
repress transcription. Mol. Cell. Biol.
21,1962
-1972.
Yost, C., Farr, G. H., 3rd, Pierce, S. B., Ferkey, D. M., Chen, M. M. and Kimelman, D. (1998). GBP, an inhibitor of GSK-3, is implicated in Xenopus development and oncogenesis. Cell 93,1031 -1041.[CrossRef][Medline]
Zhu, C. C., Dyer, M. A., Uchikawa, M., Kondoh, H., Lagutin, O.
V. and Oliver, G. (2002). Six3-mediated auto repression and
eye development requires its interaction with members of the Groucho-related
family of co-repressors. Development
129,2835
-2849.
Zuber, M. E., Perron, M., Philpott, A., Bang, A. and Harris, W. A. (1999). Giant eyes in Xenopus laevis by overexpression of XOptx2. Cell 98,341 -352.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. Domene, E. Roessler, K. B. El-Jaick, M. Snir, J. L. Brown, J. I. Velez, S. Bale, F. Lacbawan, M. Muenke, and B. Feldman Mutations in the human SIX3 gene in holoprosencephaly are loss of function Hum. Mol. Genet., December 15, 2008; 17(24): 3919 - 3928. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Gamm, L. S. Wright, E. E. Capowski, R. L. Shearer, J. S. Meyer, H.-J. Kim, B. L. Schneider, J. N. Melvan, and C. N. Svendsen Regulation of Prenatal Human Retinal Neurosphere Growth and Cell Fate Potential by Retinal Pigment Epithelium and Mash1 Stem Cells, December 1, 2008; 26(12): 3182 - 3193. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sajedi, C. Gaston-Massuet, M. Signore, C. L. Andoniadou, D. Kelberman, S. Castro, H. C. Etchevers, D. Gerrelli, M. T. Dattani, and J. P. Martinez-Barbera Analysis of mouse models carrying the I26T and R160C substitutions in the transcriptional repressor HESX1 as models for septo-optic dysplasia and hypopituitarism Dis. Model. Mech., November 1, 2008; 1(4-5): 241 - 254. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Appolloni, F. Calzolari, G. Corte, R. Perris, and P. Malatesta Six3 Controls the Neural Progenitor Status in the Murine CNS Cereb Cortex, March 1, 2008; 18(3): 553 - 562. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Schlosser How old genes make a new head: redeployment of Six and Eya genes during the evolution of vertebrate cranial placodes Integr. Comp. Biol., September 1, 2007; 47(3): 343 - 359. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Heimbucher, C. Murko, B. Bajoghli, N. Aghaallaei, A. Huber, R. Stebegg, D. Eberhard, M. Fink, A. Simeone, and T. Czerny Gbx2 and Otx2 Interact with the WD40 Domain of Groucho/Tle Corepressors Mol. Cell. Biol., January 1, 2007; 27(1): 340 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hirata, M. Nakazawa, O. Muraoka, R. Nakayama, Y. Suda, and M. Hibi Zinc-finger genes Fez and Fez-like function in the establishment of diencephalon subdivisions Development, October 15, 2006; 133(20): 3993 - 4004. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Bricaud and A. Collazo The Transcription Factor six1 Inhibits Neuronal and Promotes Hair Cell Fate in the Developing Zebrafish (Danio rerio) Inner Ear J. Neurosci., October 11, 2006; 26(41): 10438 - 10451. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gestri, M. Carl, I. Appolloni, S. W. Wilson, G. Barsacchi, and M. Andreazzoli Six3 functions in anterior neural plate specification by promoting cell proliferation and inhibiting Bmp4 expression Development, May 15, 2005; 132(10): 2401 - 2413. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Silver and I. Rebay Signaling circuitries in development: insights from the retinal determination gene network Development, January 1, 2005; 132(1): 3 - 13. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Aijaz, B. J. Clark, K. Williamson, V. van Heyningen, D. Morrison, D. FitzPatrick, R. Collin, N. Ragge, A. Christoforou, A. Brown, et al. Absence of SIX6 Mutations in Microphthalmia, Anophthalmia, and Coloboma Invest. Ophthalmol. Vis. Sci., November 1, 2004; 45(11): 3871 - 3876. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Silver, E. L. Davies, L. Doyon, and I. Rebay Functional Dissection of Eyes absent Reveals New Modes of Regulation within the Retinal Determination Gene Network Mol. Cell. Biol., September 1, 2003; 23(17): 5989 - 5999. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||