|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00432

Howard Hughes Medical Institute, Department of Human Genetics, University
of Utah, Salt Lake City, Utah 84112, USA
* Present address: Center for Advanced Biotechnology and Medicine, UMDNJ-Robert
Wood Johnson Medical School, Piscataway, NJ 08854, USA
Author for correspondence (e-mail:
mario.capecchi{at}genetics.utah.edu)
Accepted 19 February 2002
| SUMMARY |
|---|
|
|
|---|
Key words: Prostate, Hox genes, Secretory proteins, Hoxb13, Mouse
| INTRODUCTION |
|---|
|
|
|---|
The murine prostate is divided into four distinct lobes, the ventral
prostate, the dorsal prostate, the lateral prostate and the anterior prostate
(coagulating gland) (Abate-Shen and Shen,
2000
). These lobes function independently to supply proteins to
the seminal fluid (Takeda et al.,
1990
). The anterior, dorsal and lateral prostates secrete many of
the same proteins while the ventral prostate has a distinct secretory protein
profile (Donjacour et al.,
1990
). The major proteins that are secreted by the ventral
prostate are p12 (Mills et al.,
1987a
), a 6 kDa kazal-type serine protease inhibitor
(Chen et al., 1998
;
Mirosevich et al., 2001
), and
p25, a 25 kDa spermine-binding protein that is N-linked glycosylated
(Mills et al., 1987b
). An
additional feature that distinguishes the ventral prostate from all other
lobes is the relative absence of PINs in Nkx3.1 mutants
(Bhatia-Gaur et al., 1999
;
Abdulkadir et al., 2002
) and
the absence of carcinogenesis in Nkx3.1/PTEN compound mutants
(Kim et al., 2002
).
To study the role of Hoxb13 in the developing and adult prostate,
we generated loss-of-function alleles of Hoxb13 by disrupting the
homeodomain. Mice homozygous for mutant Hoxb13 alleles show, with
100% penetrance, complete absence of the secretory proteins p12 and p25 in the
ventral prostates. Moreover, the luminal cells of the ventral prostate
epithelium are simple cuboidal in appearance in contrast to the tall columnar
morphology of these cells in wild-type or heterozygote animals. We show that
the defective secretory function of the ventral prostate is unique to
Hoxb13 mutants by comparing and crossing Hoxb13 mutants to a
previously described mutant, Hoxd13
(Davis and Capecchi, 1994
). We
also determined whether Nkx3.1 expression is affected in
Hoxb13 mutants and propose that in Hoxb13 homozygous
mutants, the ventral prostate is partially transformed into anterior
prostate.
| MATERIALS AND METHODS |
|---|
|
|
|---|
X-gal staining of prostates
The bladder and the male accessory organs (seminal vesicles, ductii
deferens, anterior, dorsal, dorsolateral and ventral prostates) were dissected
from adult male mice. Organs were stained for lacZ activity with
X-gal as described previously (Mansour et
al., 1993
), but stained for only 1.5 hours at 37°C to avoid
background staining typical of adult prostatic ducts (M. Reynon and M. Shen,
personal communication).
Prostate microdissections
Ventral prostate and attached urethra were placed in phosphate-buffered
saline (PBS) containing 0.2-0.4% collagenase. Stromal cells were gently teased
away until only prostate ducts remained. Prostate ducts were teased apart and
photographed under bright-field and dark-field optics. Duct tips were counted
directly.
Immunofluorescence of tissue sections
Ventral prostates were removed in cold PBS, washed, and immediately frozen
in OCT. Prostates were sectioned (10 µm) and mounted on VWR Superfrost Plus
slides. Sections were fixed in fresh cold 4% paraformaldehyde/PBS for 5
minutes, and rinsed three times for 5 minutes in cold PBS. Sections were then
blocked in PBS/3% goat serum/0.5% Triton X-100, for 30 minutes at room
temperature and incubated overnight with block and primary antibodies at the
following dilutions: 1:1000 anti-ß-gal (Rockland cat. 100-4136), 1:250
anti-AR (ABR-Affinity Bio Reagents) 1:50 CD44 (Supernatant-Developmental
Hybridoma). Sections were washed three times for 5 minutes in PBS and blocked
again in PBS/3% goat serum/0.5% Triton X-100. Sections were incubated in
anti-mouse or anti-rabbit FITC or Texas Red (1:500, Molecular Probes), washed
again, mounted with Vectashield (Vector Labs) and examined by confocal
microscopy.
Examination of ventral prostate secretory proteins
Secretory proteins were isolated by modification of the method of Donjacour
et. al. (Donjacour et al.,
1990
). Briefly, prostates were washed in PBS and 3-5 mm sections
were cut with a razor into 500 µl PBS containing a protease inhibitor
cocktail (Roche Complete mini-EDTA free). Cut prostates in protease inhibitor
solution were transferred to 1.5 ml Eppendorf tubes and spun at 12,000
g for 2 minutes at 4°C. Supernatants were removed to new
tubes, sodium dodecyl sulphate (SDS) was added to 1% and samples were boiled
for 10 minutes. Proteins from pellets were also extracted by sonication in
extraction buffer (20 mM Hepes pH 7.5, 450 mM NaCl, 0.2 mM EDTA, 0.5 mM DTT,
25% glycerol). Microsequencing of protein bands was performed by transfer of
proteins to polyvinylidene fluoride (PVDF) and Edmund degradation followed by
HPLC.
RT-PCR
Total RNA was extracted from prostates by dounce homogenization in Trizol
(Gibco-BRL). First strand synthesis was performed using reverse-transcriptase
with poly(dT) primers (Fermentas). RT-PCR primers for p12 were
5'GCACCCTGTATAGTTCTTCTGG3' (sense) and
5'AAGTGTTCATGAAGCGATTTATTCAA3' (antisense), for p25 were
5'TCCTGGCCAGTCCCACATGCA3' (sense) and
5'CGCCCCTTGTTTGTAGTGAAGG (antisense) and were designed across introns.
Primers for GAPDH were 5'ACCACAGTCCATGCCATCAC3' (sense) and
5'TCCACCACCCTGTTGCTGTA3' (antisense). The conditions for the
RT-PCR were 94°C for 5 minutes (94°C 30 seconds, 60°C 30 seconds,
72°C 60 seconds) 25 cycles.
Western blots
Total proteins or cellular-only proteins (from secretory protein isolation
pellets) were electrophoresed on Novex 4-12% acrylamide gels in MES-SDS
(Invitrogen). 20 µg of each sample was loaded. Gels were stained with
Coomassie Blue and volumes were readjusted to a reference band (murine serum
albumin). Proteins were electrophoresed and electroblotted to nitrocellulose.
Equal loading and transfer were confirmed by staining with PonceuS Red.
Nitrocellulose membranes were blocked in 3% milk/Tris-buffered saline with
0.1% Tween (TBST) for 1 hour and incubated O/N with primary antibodies Nkx3.1
(1:6000) or anti-VP (1:20,000) (kind gifts from C. Abate-Shen and M. Kim).
| RESULTS |
|---|
|
|
|---|
Hoxb13 mutant phenotypes
Females and males homozygous for both Hoxb13 mutant alleles are
viable and fertile. Hoxd13 mutants, in contrast, have severe limb
malformations and the males are infertile
(Dolle et al., 1993
). Mice
homozygous for Hoxb13 loss-of-function mutations show overgrowth in
all major structures derived from the tail bud, including the developing
secondary neural tube, the caudal spinal ganglia and the caudal vertebrae
(Economides et al., 2003
).
Because mice carrying mutations in both Hoxd13 and Hoxa13
have defects in the development of male accessory sex organs
(Podlasek et al., 1997
;
Warot et al., 1997
;
Podlasek et al., 1999
) and
Hoxb13 is expressed in the developing and adult prostate
(Sreenath et al., 1999
;
Prinsac et al., 2001
),
analyses of Hoxb13 mutants for defects in the formation and/or
function of the prostate were carried out.
Gross analysis of male secondary sexual organs
Seminal vesicles, dorsolateral prostates, dorsal prostates and anterior
prostates from Hoxb13 homozygous mutants appeared normal. The ventral
prostates from Hoxb13 homozygous mutants were normal in size and
morphology (i.e., number of duct tips) but the ducts had a transparent
appearance (Fig. 1B). X-gal
staining of reproductive organs of adult Hoxb13lacZ
heterozygotes revealed preferential expression in the ventral prostate of
adult males (Fig. 1C). Ventral
prostates from heterozygous and homozygous mutants strongly expressed the
reporter gene for ß-galactosidase in a dosage-dependent manner
(Fig. 1D-F). In addition, ducts
from prostates of older homozygous mutant males (>1 year old) frequently
were swollen (4/7) (Fig.
1F).
|
Defects in the morphology of epithelial cells
Ventral prostate sections were examined for changes in morphology and
overall appearance through analysis by Hematoxylin and Eosin staining
(Fig. 2A,B) and for
Hoxb13 reporter expression by X-gal staining
(Fig. 2C,D). Histology revealed
reduced protein content within the prostatic ducts
(Fig. 2A, black arrows, compare
with 2B), indicating a reduction in secretory function of the ventral
prostate. The reporter allele was expressed strongly within the luminal cells
of prostate ducts. Mutant epithelial cells appeared simple cuboidal in
contrast to the tall columnar epithelia seen in normal prostates
(Fig. 2C,D; white arrowheads).
The morphology of mutant prostate epithelia is similar to that seen in the
prostatic epithelium of castrated mice
(Mirosevich et al., 1999
).
Degeneration of the ventral prostate, which is a characteristic of castrated
mice, however, was not evident in Hoxb13 homozygous mutants. Tissue
sections of Hoxb13 mutant mice did not reveal any evidence of PINs
similar to those described in Nkx3.1 mutants in any prostate
lobe.
|
|
Luminal epithelial markers are present in Hoxb13
mutants
One possibility for the absence of secretory proteins in the ventral
prostate of Hoxb13 homozygous mutants is that the luminal cells fail
to differentiate properly. Expression patterns of luminal cell markers were
examined in homozygous mutant and heterozygous ventral prostates. Antibodies
to ß-galactosidase were used to determine localization of the
Hoxb13-ß-gal fusion protein within the luminal cells and anti-androgen
receptor (anti-AR) antibodies were used to determine if this luminal
epithelial-specific marker was present. In both homozygous mutants and
heterozygotes, AR and the Hoxb13-ß-gal fusion protein appear intact and
properly localized to the nucleus (Fig.
4). Using CD44 as a marker for the basal cell layer, however,
yielded a surprising result. In Hoxb13 mutant ventral prostates CD44
was localized to both the apical and basal surfaces of luminal cells. This
result suggests that although the markers for luminal epithelium are
expressed, mutant epithelial cells appear to lack polarity.
|
|
| DISCUSSION |
|---|
|
|
|---|
Hox genes in general play a role in providing identity to
developing organs along the anterior-posterior axis of an embryo.
Hoxd13 and Hoxa13 have roles in the development of accessory
sex organs in the male (Kondo et al.,
1997
; Podlasek et al.,
1997
; Warot et al.,
1997
; Podlasek et al.,
1999
). Hoxd13 and Hoxa13 appear to be involved
in the outgrowth and branching morphology of the prostate by controlling local
cell proliferation rates within the developing ducts. Our study suggests that
Hoxb13 shares a redundant function with Hoxd13 in the
developing prostate based on the severe truncations and branching defects
observed in Hoxb13/Hoxd13 double mutants. The expression pattern of
Hoxb13 in the prostates of young mice coincides with a period of
extensive branching morphogenesis. Defects in branching morphogenesis,
however, do not correlate with impaired secretory function. While
Hoxd13 homozygous mutants show developmental defects in the ventral
prostate, secretory function is intact. Additionally, Hoxd13 shows a
dramatic decrease in its expression during the progression from birth to adult
(Podlasek et al., 1997
),
whereas Hoxb13 continues to be expressed at high levels in adult
tissues (our observations) (Sreenath et
al., 1999
).
It is clear from the absence of ventral secretory protein expression that
the luminal epithelium is not appropriately specified. Ventral prostate
luminal cells are present and branching morphogenesis appears normal in
Hoxb13 homozygous mutants. The epithelial cells express luminal
cell-specific markers such as AR, Nkx3.1, and are positive for the
Hoxb13lacZ reporter. However, they misexpress a basal cell
marker, CD44, on their apical surface, indicating loss of cellular polarity.
The simple cuboidal epithelium evident in the Hoxb13 homozygous
mutant luminal cells, in contrast to the tall columnar epithelium found in
normal cells, may be secondary to the absence of secretory function in these
mutant cells. This hypothesis is supported by the observation that castrated
mice develop a very similar cellular morphology in the prostate epithelium and
that these changes in cellular morphology can be reverted to a tall columnar
morphology by treatment of the castrated mice with testosterone
(Mirosevich et al., 1999
). The
abnormal balloon-like ducts evident in older males may be explained by the
altered cellular morphology and swelling due to osmotic changes within the
duct.
Another homeobox gene involved in prostate development and ventral prostate
function is Nkx3.1. Mice homozygous for mutations in Nkx3.1
show reduced branching in all lobes and reduced ventral prostate secretion,
but not complete absence of the major secretory proteins as observed in
Hoxb13 mutants. Frequently, Nkx3.1 homozygous mutants
display balloon-like swelling of individual ducts. Nkx3.1 mutants
also develop prostatic intraepithelial neoplasias (PINs), which are an early
step in prostate tumor progression. Interestingly, PINs are not detected in
the ventral prostate of Nkx3.1 mutant homozygotes
(Bhatia-Gaur et al., 1999
;
Abdulkadir et al., 2002
). The
expression of Nkx3.1 is more robust in anterior prostate lobes when
compared to ventral prostates, which suggests that Nkx3.1 may have a
more extended role in anterior prostate development than in ventral prostate
development. In contrast, the expression of Hoxb13 is more robust in
the ventral prostate than in the anterior prostate, indicating a more extended
role for Hoxb13 in the development of the ventral prostate.
The similarity in the ventral prostate phenotypes observed in
Nkx3.1 and Hoxb13 homozygous mutants suggests a common
pathway for secretory protein production. It is important to note, however,
ventral prostate proteins p12 and p25 are androgen dependent, as is expression
of Nkx3.1, while Hoxb13 expression has been reported to be androgen
independent (Sreenath et al.,
1999
). A potential model would be that Hoxb13 functions in a
parallel pathway with androgen receptor signaling, directly affecting Nkx3.1
expression which in turn affects the expression of secretory protein genes.
This clearly is not the case since expression of Nkx3.1 is not decreased in
Hoxb13 mutants. The result that Nkx3.1 is still expressed in the
absence of functional Hoxb13 leads to three important conclusions. (1) The
ventral prostate secretory defect is not due to loss of Nkx3.1 expression. (2)
The presence of Nkx3.1, the earliest known marker for prostate epithelium,
confirms that the epithelium in Hoxb13 homozygous mutants is in fact
prostatic. (3) Finally, and most importantly, the presence of Nkx3.1 in
Hoxb13 homozygous mutant prostates implies that the androgen
signaling pathways are still intact in these prostates since the expression of
Nkx3.1 is androgen dependent.
The simplest explanation for our observations is that Hoxb13 acts
in a hierarchy of homeobox genes to assign ventral prostate fates to cells in
the ventral luminal epithelium. Nkx3.1, Hoxa13, Hoxd13, and
Hoxb13 all cooperate to form the prostate, but only Hoxb13
is necessary to mediate the final steps in ventral prostate differentiation.
One possibility is that anterior and dorsolateral prostate fates are `default'
pathways and that elevated levels of Hoxb13 direct a ventral-specific
differentiation. Consistent with this hypothesis is the observation that the
total protein profiles of mutant ventral prostates resemble those of anterior
prostates. However, this cannot be entirely explained by a simple
transformation to another type of lobe, because cells of the homozygous mutant
ventral prostates also have a secretory defect. Ventral prostates in
Hoxb13 mutants do not secrete anterior- or dorsolateral-specific
secretory proteins, although they do secrete novel proteins such as polymeric
immunoglobulin receptor (pIgR) and androgen binding protein beta subunit
(ABPß). pIgR is a receptor molecule that is involved in binding dimeric
IgA and transcytosis across epithelial cell layers. pIgR expression has been
observed in many mucosal epithelia including uterine, mammary and lung
epithelia, and has been implicated in viral infection
(Kaetzel et al., 1991
;
Mostov, 1994
;
Lamm et al., 1995
;
de Groot et al., 1999
;
Kaetzel, 2001
). Although pIgR
has been shown to have important functions in female reproductive organs
(Kaushic et al., 1995
;
Richardson et al., 1995
;
Kaushic et al., 1997
), no
known function of pIgR has been described in the prostate. We do not detect
pIgR in the ventral secretions of wild-type and heterozygous ventral
prostates. One possibility is that the proposed immunosuppressive function
(Maccioni et al., 2001
) of the
ventral secretions is compromised in Hoxb13 homozygous mutants and
pIgR is trancytosed from the basal surface in response.
The other misexpressed protein, the beta subunit of androgen binding
protein (ABPß) (Karn and Russell,
1993
) is one of three known subunits of ABP
(Dlouhy et al., 1987
) which
has been shown to form heterodimeric complexes with ABP
or ABP
and is expressed in both male and female salivary glands in response to
testosterone treatment (Dlouhy and Karn,
1984
). The question this finding poses is: why is the mutant
ventral prostate secreting one subunit of a salivary androgen-binding protein?
One possibility is that ABPß expression represents a default state for
mucosal epithelia and is expressed in these mutant cells because of the
absence of specification to a ventral prostatic fate by Hoxb13.
A question of particular interest is: what is the function of the ventral
prostate? Clearly, in a controlled environment, a properly functioning ventral
prostate is not required to confer fertility to males as no decreases in
litter size or mating frequency were observed. The ability to form copulatory
plugs was also unaffected (data not shown), although the major component of
these plugs is from secretory proteins of the seminal vesicle
(Bradshaw and Wolfe, 1977
)
which appears to be unaffected by the Hoxb13 mutation. The major
proteins that the ventral prostate supplies to the seminal fluid are the
protease inhibitor, p12, and the spermine binding protein, p25. The absence of
p12 may be compensated for by the contribution of this protein from the
seminal vesicle, but the other major secretory protein, p25, is produced only
by the ventral prostate. In an environment with controlled breeding and no
competition from other males, Hoxb13 homozygous mutants lacking p25
appear not to be compromised in their ability to generate offspring. This may
not be the case in the wild.
In this study, the function of Hoxb13 in the mouse ventral
prostate was examined. Hoxb13 is expressed strongly and localized to
the nuclei of ventral prostate luminal cells in which it directs
differentiation of prostate epithelium into a ventral prostate-specific
tissue. In the absence of Hoxb13, genes encoding ventral-specific
secretory proteins are not expressed, while genes not normally expressed in
this tissue such as pIgR and ABPß are misexpressed. Secretory function in
general is also affected and the luminal cells are transformed from a tall
columnar morphology to a simple cuboidal morphology. The expression of CD44, a
basal cell marker, on the apical surface, suggests loss of polarity in these
cells. Although total protein profiles of the mutant ventral prostates show
some similarity to other prostatic lobes, secretory profiles for the mutant
ventral prostate are unique. Given these data, it is likely that there is a
loss of identity and impaired secretory function of cells in the luminal
epithelium rather than a complete transformation to a different prostatic
lobe. The misexpression of CD44 on the apical surface in luminal cells in the
Hoxb13 homozygous mutant ventral prostate is consistent with
preneoplastic lesions in many tissue types
(Sugar et al., 1997
;
Lagorce-Pages et al., 1998
;
Wimmel et al., 2001
) and in
prostate tumors (Paradis et al.,
1998
). Interestingly, loss of heterozygosity of the 17q21 locus,
which spans the Hoxb cluster, in humans is linked to early events of
prostate carcinogenesis such as preneoplastic lesions
(Brothman et al., 1995
;
Brothman, 1997
;
Deubler et al., 1997
). A
database search of the Serial Analysis of Gene Expression (SAGE) at the Cancer
Genome Anatomy Project (CGAP) at the NIH reveals that Hoxb13 is expressed in
virtually all human prostate cancers as well as normal prostates listed within
the SAGE database
(http://cgap.nci.nih.gov/).
It is interesting to note that Nkx3.1 mutations do not cause PINs in
the VP. The commitment of prostate tissues to a ventral prostate fate by
Hoxb13 may provide protection to this tissue from neoplasia. Future
work will address how Hoxb13 interacts with other homeobox genes such
as Nkx3.1 in the formation and function of the prostatic lobes and
the potential role of these genes in the early events of prostate
carcinogenesis.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abate-Shen, C. and Shen, M. M. (2000).
Molecular genetics of prostate cancer. Genes Dev.
14,2410
-2434.
Abdulkadir, S. A., Magee, J. A., Peters, T. J., Kaleem, Z.,
Naughton, C. K., Humphrey, P. A. and Milbrandt, J.
(2002). Conditional loss of Nkx3.1 in adult mice induces
prostatic intraepithelial neoplasia. Mol. Cell. Biol.
22,1495
-1503.
Bhatia-Gaur, R., Donjacour, A. A., Sciavolino, P. J., Kim, M.,
Desai, N., Young, P., Norton, C. R., Gridley, T., Cardiff, R. D.,
Cunha, G. R. et al. (1999). Roles for Nkx3.1 in prostate
development and cancer. Genes Dev.
13,966
-977.
Bieberich, C. J., Fujita, K., He, W. W. and Jay, G.
(1996). Prostate-specific and androgen-dependent expression of a
novel homeobox gene. J. Biol. Chem.
271,31779
-31782.
Bradshaw, B. S. and Wolfe, H. G. (1977). Coagulation proteins in the seminal vesicle and coagulating gland of the mouse. Biol. Reprod. 16,292 -297.[Abstract]
Brothman, A. R. (1997). Cytogenetic studies in prostate cancer: are we making progress? Cancer Genet Cytogenet. 95,116 -121.[CrossRef][Medline]
Brothman, A. R., Steele, M. R., Williams, B. J., Jones, E., Odelberg, S., Albertsen, H. M., Jorde, L. B., Rohr, L. R. and Stephenson, R. A. (1995). Loss of chromosome 17 loci in prostate cancer detected by polymerase chain reaction quantitation of allelic markers. Genes Chromosomes Cancer 13,278 -284.[Medline]
Chen, F. and Capecchi, M. R. (1999). Paralogous
mouse Hox genes, Hoxa9, Hoxb9, and Hoxd9, function together to control
development of the mammary gland in response to pregnancy. Proc.
Natl. Acad. Sci. USA 96,541
-546.
Chen, L. Y., Lin, Y. H., Lai, M. L. and Chen, Y. H.
(1998). Developmental profile of a caltrin-like protease
inhibitor, P12, in mouse seminal vesicle and characterization of its binding
sites on sperm surface. Biol. Reprod.
59,1498
-1505.
Chisaka, O., Musci, T. S. and Capecchi, M. R. (1992). Developmental defects of the ear, cranial nerves and hindbrain resulting from targeted disruption of the mouse homeobox gene Hox-1.6. Nature 355,516 -520.[CrossRef][Medline]
Cohen-Tannoudji, M., Vandormael-Pournin, S., Drezen, J., Mercier, P., Babinet, C. and Morello, D. (2000). lacZ sequences prevent regulated expression of housekeeping genes. Mech. Dev. 90,29 -39.[CrossRef][Medline]
Davis, A. P. and Capecchi, M. R. (1994). Axial homeosis and appendicular skeleton defects in mice with a targeted disruption of hoxd-11. Development 120,2187 -2198.[Abstract]
Davis, A. P., Witte, D. P., Hsieh-Li, H. M., Potter, S. S. and Capecchi, M. R. (1995). Absence of radius and ulna in mice lacking hoxa-11 and hoxd-11. Nature 375,791 -795.[CrossRef][Medline]
de Groot, N., van Kuik-Romeijn, P., Lee, S. H. and de Boer, H. A. (1999). Over-expression of the murine polymeric immunoglobulin receptor gene in the mammary gland of transgenic mice. Transgenic Res. 8,125 -135.[CrossRef][Medline]
Deubler, D. A., Williams, B. J., Zhu, X. L., Steele, M. R., Rohr, L. R., Jensen, J. C., Stephenson, R. A., Changus, J. E., Miller, G. J., Becich, M. J. et al. (1997). Allelic loss detected on chromosomes 8, 10, and 17 by fluorescence in situ hybridization using single-copy P1 probes on isolated nuclei from paraffin-embedded prostate tumors. Am. J. Pathol. 150,841 -850.[Abstract]
Dlouhy, S. R. and Karn, R. C. (1984). Multiple gene action determining a mouse salivary protein phenotype: identification of the structural gene for androgen binding protein (Abp). Biochem. Genet. 22,657 -667.[CrossRef][Medline]
Dlouhy, S. R., Taylor, B. A. and Karn, R. C.
(1987). The genes for mouse salivary androgen-binding protein
(ABP) subunits alpha and gamma are located on chromosome 7.
Genetics 115,535
-543.
Dolle, P., Dierich, A., LeMeur, M., Schimmang, T., Schuhbaur, B., Chambon, P. and Duboule, D. (1993). Disruption of the Hoxd-13 gene induces localized heterochrony leading to mice with neotenic limbs. Cell 75,431 -441.[CrossRef][Medline]
Donjacour, A. A., Rosales, A., Higgins, S. J. and Cunha, G.
R. (1990). Characterization of antibodies to
androgen-dependent secretory proteins of the mouse dorsolateral prostate.
Endocrinology 126,1343
-1354.
Duboule, D. (1995). Vertebrate Hox genes and proliferation: an alternative pathway to homeosis? Curr. Opin. Genet. Dev. 5,525 -528.[CrossRef][Medline]
Economides, K. D., Zeltser, L. and Capecchi, M. R. (2003). Hoxb13 mutations cause overgrowth of caudal spinal cord and tail vertebrae. Dev. Biol. (in press).
Garcia-Gasca, A. and Spyropoulos, D. D. (2000). Differential mammary morphogenesis along the anteroposterior axis in Hoxc6 gene targeted mice. Dev. Dyn. 219,261 -276.[CrossRef][Medline]
Greer, J. M. and Capecchi, M. R. (2002). Hoxb8 is required for normal grooming behavior in mice. Neuron 33,23 -34.[CrossRef][Medline]
Kaetzel, C. S. (2001). Polymeric Ig receptor: defender of the fort or Trojan horse? Curr. Biol. 11, R35-38.[CrossRef][Medline]
Kaetzel, C. S., Robinson, J. K., Chintalacharuvu, K. R.,
Vaerman, J. P. and Lamm, M. E. (1991). The polymeric
immunoglobulin receptor (secretory component) mediates transport of immune
complexes across epithelial cells: a local defense function for IgA.
Proc. Natl. Acad. Sci. USA
88,8796
-8800.
Karn, R. C. and Russell, R. (1993). The amino acid sequence of the alpha subunit of mouse salivary androgen-binding protein (ABP), with a comparison to the partial sequence of the beta subunit and to other ligand-binding proteins. Biochem. Genet. 31,307 -319.[CrossRef][Medline]
Kaushic, C., Richardson, J. M. and Wira, C. R. (1995). Regulation of polymeric immunoglobulin A receptor messenger ribonucleic acid expression in rodent uteri: effect of sex hormones. Endocrinology 136,2836 -2844.[Abstract]
Kaushic, C., Frauendorf, E. and Wira, C. R. (1997). Polymeric immunoglobulin A receptor in the rodent female reproductive tract: influence of estradiol in the vagina and differential expression of messenger ribonucleic acid during estrous cycle. Biol. Reprod. 57,958 -966.[Abstract]
Kim, M. J., Cardiff, R. D., Desai, N., Banach-Petrosky, W. A.,
Parsons, R., Shen, M. M. and Abate-Shen, C. (2002).
Cooperativity of Nkx3.1 and Pten loss of function in a mouse model of prostate
carcinogenesis. Proc. Natl. Acad. Sci. USA
99,2884
-2889.
Kondo, T., Zakany, J., Innis, J. W. and Duboule, D. (1997). Of fingers, toes and penises. Nature 390,29 .[CrossRef][Medline]
Krumlauf, R. (1994). Hox genes in vertebrate development. Cell 78,191 -201.[CrossRef][Medline]
Lagorce-Pages, C., Paraf, F., Dubois, S., Belghiti, J. and Flejou, J. F. (1998). Expression of CD44 in premalignant and malignant Barrett's oesophagus. Histopathology 32, 7-14.[CrossRef][Medline]
Lamm, M. E., Mazaneca, M. B., Nedrud, J. G. and Kaetzel, C. S. (1995). New functions for mucosal IgA. Adv. Exp. Med. Biol. 371A,647 -650.
Maccioni, M., Riera, C. M. and Rivero, V. E. (2001). Identification of rat prostatic steroid binding protein (PSBP) as an immunosuppressive factor. J. Reprod. Immunol. 50,133 -149.[CrossRef][Medline]
Mansour, S. L., Goddard, J. M. and Capecchi, M. R.
(1993). Mice homozygous for a targeted disruption of the
proto-oncogene int-2 have developmental defects in the tail and inner ear.
Development 117,13
-28.
Mills, J. S., Needham, M. and Parker, M. G. (1987a). A secretory protease inhibitor requires androgens for its expression in male sex accessory tissues but is expressed constitutively in pancreas. EMBO J. 6,3711 -3717.[Medline]
Mills, J. S., Needham, M. and Parker, M. G.
(1987b). Androgen regulated expression of a spermine binding
protein gene in mouse ventral prostate. Nucleic Acids
Res. 15,7709
-7724.
Mills, J. S., Needham, M., Thompson, T. C. and Parker, M. G. (1987c). Androgen-regulated expression of secretory protein synthesis in mouse ventral prostate. Mol. Cell Endocrinol. 53,111 -118.[CrossRef][Medline]
Mirosevich, J., Bentel, J. M., Zeps, N., Redmond, S. L., D'Antuono, M. F. and Dawkins, H. J. (1999). Androgen receptor expression of proliferating basal and luminal cells in adult murine ventral prostate. J. Endocrinol. 162,341 -350.[Abstract]
Mirosevich, J., Bentel, J. M. and Dawkins, J. S. (2001). Regulation of caltrin mRNA expression by androgens in the murine prostate. J. Androl. 22,449 -457.[Abstract]
Mostov, K. E. (1994). Transepithelial transport of immunoglobulins. Annu. Rev. Immunol. 12, 63-84.[CrossRef][Medline]
Paradis, V., Eschwege, P., Loric, S., Dumas, F., Ba, N., Benoit, G., Jardin, A. and Bedossa, P. (1998). De novo expression of CD44 in prostate carcinoma is correlated with systemic dissemination of prostate cancer. J. Clin. Pathol. 51,798 -802.[Abstract]
Patterson, L. T., Pembaur, M. and Potter, S. S.
(2001). Hoxa11 and Hoxd11 regulate branching morphogenesis of the
ureteric bud in the developing kidney. Development
128,2153
-2161.
Podlasek, C. A., Duboule, D. and Bushman, W. (1997). Male accessory sex organ morphogenesis is altered by loss of function of Hoxd-13. Dev. Dyn. 208,454 -465.[CrossRef][Medline]
Podlasek, C. A., Clemens, J. Q. and Bushman, W. (1999). Hoxa-13 gene mutation results in abnormal seminal vesicle and prostate development. J. Urol. 161,1655 -1661.[CrossRef][Medline]
Prinsac, G. S., Birch, L., Habermann, H., Chang, W. Y., Tebeau, C., Putz, O. and Bieberich, C. (2001). Influence of neonatal estrogens on rat prostate development. Reprod. Fertil. Dev. 13,241 -252.[CrossRef][Medline]
Richardson, J. M., Kaushic, C. and Wira, C. R. (1995). Polymeric immunoglobin (Ig) receptor production and IgA transcytosis in polarized primary cultures of mature rat uterine epithelial cells. Biol. Reprod. 53,488 -498.[Abstract]
Schwenk, F., Baron, U. and Rajewsky, K. (1995).
A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene
segments including deletion in germ cells. Nucleic Acids
Res. 23,5080
-5081.
Sciavolino, P. J., Abrams, E. W., Yang, L., Austenberg, L. P., Shen, M. M. and Abate-Shen, C. (1997). Tissue-specific expression of murine Nkx3.1 in the male urogenital system. Dev. Dyn. 209,127 -138.[CrossRef][Medline]
Sreenath, T., Orosz, A., Fujita, K. and Bieberich, C. J. (1999). Androgen-independent expression of hoxb-13 in the mouse prostate. Prostate 41,203 -207.[CrossRef][Medline]
Sugar, J., Vereczkey, I., Toth, J., Peter, I. and Banhidy, F. (1997). New aspects in the pathology of the preneoplastic lesions of the larynx. Acta Otolaryngol. Suppl. 527, 52-56.
Sugimura, Y., Cunha, G. R. and Donjacour, A. A. (1986). Morphogenesis of ductal networks in the mouse prostate. Biol. Reprod. 34,961 -971.[Abstract]
Takeda, H., Suematsu, N. and Mizuno, T. (1990). Transcription of prostatic steroid binding protein (PSBP) gene is induced by epithelial-mesenchymal interaction. Development 110,273 -281.[Abstract]
Thorey, I. S., Meneses, J. J., Neznanov, N., Kulesh, D. A., Pedersen, R. A. and Oshima, R. G. (1993). Embryonic expression of human keratin 18 and K18-beta-galactosidase fusion genes in transgenic mice. Dev. Biol. 160,519 -534.[CrossRef][Medline]
Warot, X., Fromental-Ramain, C., Fraulob, V., Chambon, P. and Dolle, P. (1997). Gene dosage-dependent effects of the Hoxa-13 and Hoxd-13 mutations on morphogenesis of the terminal parts of the digestive and urogenital tracts. Development 124,4781 -4791.[Abstract]
Wellik, D. M., Hawkes, P. J. and Capecchi, M. R.
(2002). Hox11 paralogous genes are essential for
metanephric kidney induction. Genes Dev.
16,1423
-1432.
Wimmel, A., Kogan, E., Ramaswamy, A. and Schuermann, M. (2001). Variant expression of CD44 in preneoplastic lesions of the lung. Cancer 92,1231 -1236.[CrossRef][Medline]
Zeltser, L., Desplan, C. and Heintz, N. (1996). Hoxb-13: a new Hox gene in a distant region of the HOXB cluster maintains colinearity. Development 122,2475 -2484.[Abstract]
This article has been cited by other articles:
![]() |
Y. Zhang, J. Zhang, Y. Lin, Y. Lan, C. Lin, J. W. Xuan, M. M. Shen, W. L. McKeehan, N. M. Greenberg, and F. Wang Role of epithelial cell fibroblast growth factor receptor substrate 2{alpha} in prostate development, regeneration and tumorigenesis Development, February 15, 2008; 135(4): 775 - 784. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Miao, Z. Wang, H. Provencher, B. Muir, S. Dahiya, E. Carney, C.-O. Leong, D. C. Sgroi, and S. Orsulic HOXB13 promotes ovarian cancer progression PNAS, October 23, 2007; 104(43): 17093 - 17098. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Pu, L. Huang, L. Birch, and G. S. Prins Androgen Regulation of Prostate Morphoregulatory Gene Expression: Fgf10-Dependent and -Independent Pathways Endocrinology, April 1, 2007; 148(4): 1697 - 1706. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Huang, Y. Pu, D. Hepps, D. Danielpour, and G. S. Prins Posterior Hox Gene Expression and Differential Androgen Regulation in the Developing and Adult Rat Prostate Lobes Endocrinology, March 1, 2007; 148(3): 1235 - 1245. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-F. Lee, J.-S. Xu, Y.-L. Lee, and W. S. B. Yeung Demilune Cell and Parotid Protein from Murine Oviductal Epithelium Stimulates Preimplantation Embryo Development Endocrinology, January 1, 2006; 147(1): 79 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. M. Berquin, Y. Min, R. Wu, H. Wu, and Y. Q. Chen Expression Signature of the Mouse Prostate J. Biol. Chem., October 28, 2005; 280(43): 36442 - 36451. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Mack, L. Li, N. Sato, V. C. Hascall, and E. V. Maytin Hoxb13 Up-regulates Transglutaminase Activity and Drives Terminal Differentiation in an Epidermal Organotypic Model J. Biol. Chem., August 19, 2005; 280(33): 29904 - 29911. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jung, R.-S. Kim, H.-J. Zhang, S.-J. Lee, and M.-H. Jeng HOXB13 Induces Growth Suppression of Prostate Cancer Cells as a Repressor of Hormone-Activated Androgen Receptor Signaling Cancer Res., December 15, 2004; 64(24): 9185 - 9192. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jung, R.-S. Kim, S.-J. Lee, C. Wang, and M.-H. Jeng HOXB13 Homeodomain Protein Suppresses the Growth of Prostate Cancer Cells by the Negative Regulation of T-Cell Factor 4 Cancer Res., May 1, 2004; 64(9): 3046 - 3051. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Huang, Y. Pu, S. Alam, L. Birch, and G. S. Prins Estrogenic Regulation of Signaling Pathways and Homeobox Genes During Rat Prostate Development J Androl, May 1, 2004; 25(3): 330 - 337. [Full Text] [PDF] |
||||
![]() |
S. B. Shappell, G. V. Thomas, R. L. Roberts, R. Herbert, M. M. Ittmann, M. A. Rubin, P. A. Humphrey, J. P. Sundberg, N. Rozengurt, R. Barrios, et al. Prostate Pathology of Genetically Engineered Mice: Definitions and Classification. The Consensus Report from the Bar Harbor Meeting of the Mouse Models of Human Cancer Consortium Prostate Pathology Committee Cancer Res., March 15, 2004; 64(6): 2270 - 2305. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||