|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00427
1 Institute of Life Science, National Defense Medical Center, Taipei,
Taiwan
2 Institute of Molecular Biology, Academia Sinica, Nankang, Taipei, Taiwan
* Author for correspondence (e-mail: mbchung{at}sinica.edu.tw)
Accepted 30 January 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Steroidogenesis, P450scc, Ultra-structure, side-chain cleavage enzyme, CYP11A1, SF1, Ad4BP, Adrenal gland, Head kidney, Kidney, Morphogenetic movement, SF1
| INTRODUCTION |
|---|
|
|
|---|
The origin of the adrenal gland is still controversial. It is thought to
share the same origin as the kidney and gonads, derived from coelomic
epithelium of the urogenital ridge and/or the underlying mesenchyme
(Keegan and Hammer, 2002
;
Morohashi, 1997
). WT1
(Wilms' tumor suppressor 1) is first expressed in the intermediate mesoderm
lateral to the coelomic cavity and is crucial for urogenital ridge development
(Armstrong et al., 1993
).
Mutations of WT1 cause WAGR, Denys-Drash, and Frasier syndromes that
are associated with disorders of the kidney and gonad
(Baird et al., 1992
;
Barbaux et al., 1997
;
Pelletier et al., 1991
). The
function of Wt1 in urogenital ridge development has been further
evaluated in knockout mice that lack adrenal glands, kidneys and gonads
(Kreidberg et al., 1993
). Yet
the function of Wt1 in the adrenal gland is still not clear, since
Wt1 is not expressed in the developing adrenal gland
(Armstrong et al., 1993
).
Adrenal size is greatly reduced in Wt1 knockout mice that are
partially rescued by the human WT1 gene
(Moore et al., 1999
). It
indicates that Wt1 may play a role during early adrenal gland
development, although the precise mechanism has not been clarified.
SF1, also termed Ad4BP or NR5A1, is an Ftz-F1 member of the nuclear
receptor superfamily (Morohashi and Omura,
1996
; Parker et al.,
2002
). It is not only essential for the activation of several
steroidogenic enzymes including scc
(Guo et al., 1994
;
Rice et al., 1991
), but is
also the earliest gene that can be detected in the adrenal-gonadal primordium.
An SF1 heterozygous mutation causes adrenal insufficiency and XY sex
reversal (Achermann et al.,
1999
). In SF1 (Nr5a1) knockout mice, the adrenal
and gonadal primordia arise initially, but regress later through apoptosis
(Ikeda et al., 1995
;
Luo et al., 1995
). Moreover,
SF1 can cause embryonic stem cells to differentiate into the steroidogenic
cell type (Crawford et al.,
1997
). These observations indicate that SF1 functions at multiple
levels to control differentiation of the endocrine lineage. However, the
mechanism of SF1 action for endocrine lineage determination has not been fully
elucidated.
One of the reasons for the lack of understanding of adrenal gland
organogenesis is the difficulty in studying mammalian embryogenesis. To
circumvent this problem, in our study we used zebrafish, a teleost, since
zebrafish embryos are amenable to molecular manipulation and genetic
dissection (Briggs, 2002
;
Penberthy et al., 2002
). The
adrenal cortex homologue in teleost is called the interrenal gland, because
together with chromaffin cells (counterpart of adrenal medulla), it is
embedded inside the anterior part of the kidney
(Chester Jones and Mosley,
1980
). Although interrenal glands in some species of teleosts have
been identified by histological methods
(Grassi Milano et al., 1997
;
Rocha et al., 2001
), very few
molecular studies have been carried out with regard to their differentiation
and gene expression.
In this report, we have identified the interrenal gland in zebrafish using molecular probes and morphological studies. We characterized the morphogenetic movements of pronephric and interrenal primordia during early embryogenesis. We used the antisense morpholino knockdown strategy to show that wt1 is important for the development of both pronephric and interrenal primordia. The differentiation of the interrenal primordia is also controlled by ff1b, probably through direct activation of the scc gene. In addition, the morphogenetic movement of the interrenal gland is abnormal in flh and oep mutant embryos, which are defective in midline signaling. This is the first detailed report of early interrenal differentiation and morphogenesis; it provides a mechanistic view of these processes controlled by the wt1 and ff1b genes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of SCC antibodies
The fragment of zebrafish scc cDNA from 299 bp to 1020 bp,
encoding amino acids 100-340, was subcloned into pET-29 vector. The SCC
recombinant protein was purified as described previously
(Hu and Chung, 1990
). About
200 µg of the gel-purified recombinant protein were injected into rabbit
subcutaneously. The same amount of booster was given 21 days later. Antiserum
collected 9 days after the second booster was used throughout the study.
Whole-mount in situ hybridization and immunofluoresence
Whole-mount in situ hybridization was performed using digoxigeninor
fluorescein-labeled antisense RNA probes and alkaline phosphatase-conjugated
secondary antibodies, as described previously
(Chiang et al., 2001
). The
following templates were linearized and transcribed to make antisense RNA
probes: scc (XhoI/T7), 3ß-HSD
(XbaI/T7), ff1b (NotI/SP6), wt1
(BamHI/T7). Double in situ hybridization was carried out as described
previously (Jowett, 2001
). For
immunohistochemistry, hybridized embryos were incubated with primary antibody
(polyclonal rabbit anti-zebrafish SCC antibody, 1:5000) for 1 hour at room
temperature. After washing, they were incubated with secondary antibody (horse
anti-rabbit IgG FITC antibody, 1: 5000, Chemicon, Temecula, CA, USA) for 1
hour, washed well, and mounted. The intermediate mesoderm containing
primordial interrenal and pronephros was dissected from embryos using needles
before photographs were taken under an Olympus BX50 microscope. For analysis
of the double in situ hybridization, digoxigenin-labeled wt1 signals
were captured using transmitted light, and fluorescein-labeled ff1b
signals, stained by Fast Red, were captured with an Argon 543-nm laser
connected to a Zeiss Axiovert 100M microscope equipped with LSM510 (Carl Zeiss
Inc, Germany). The images were merged using the Release 2.5 software.
Morpholino injection
Morpholino oligonucleotides (Gene Tools, Corvallis, OR, USA) were dissolved
in water at a concentration of 10 µg/µl. The stock solution was diluted
to working concentrations of 0.5-3 µg/µl in Danieau solution (58 mM
NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM
Ca(NO3)2, 5 mM Hepes, pH 7.6) and injected into the yolk
of 1-4 cell embryos. The morpholino sequences are as follows: ff1b:
AATCCTCATCTGCTCTGAAGTCCAT, wt1: TGAGGTCACGAACATCAGAACCCAT.
ff1a: CTGACTCGACTTTAGGCAGCATGAC. cyp17 sense:
CAGTTGAATATAGCTGACAATGGT.
Electron microscopy
Zebrafish embryos were processed for electron microscopy as described
previously (Drummond et al.,
1998
). Embryos were fixed in 1% glutaraldehyde at 4°C
overnight, washed, then fixed in 2% osmium tetroxide (OsO4) at RT
for 2 hours. They were then dehydrated with serial concentrations of acetone,
infiltrated serially with solutions of embedding reagent and polymerized at
70°C. Sections of 0.2 µm were cut and examined using a Zeiss EM109
electron microscope. All the reagents were purchased from Electron Microscopy
Science (Washington, PA, USA).
Transfection
Transfection was performed in H1299 cells cultured in 60-mm plates in RPMI
1640 medium plus 10% FBS and 10% antibiotics. The lacZ reporter gene
under the control of the wild-type human SCC promoter or human
SCC promoter with a mutation in the proximal SF1 binding site
(SCC/2.3lacZ; mtPSCC2.3/lacZ) were
constructed previously (Hu et al.,
1999
; Hu et al.,
2001
). The ff1b cDNA was cloned into pcDNA3 vector under
the control of the CMV-IE promoter. The transfected DNA included 5 µg
expression vector and 2 µg reporters (1 µg lacZ reporter and 1
µg luciferase reporter pGL2 as internal control). Cells were lysed and
assayed as previously described (Hu et
al., 1999
). ß-Galactosidase activity was normalized against
the internal control luciferase. The activity of SCC/lacZ
reporter alone was set as 100. Data represent mean±s.e.m. of four
independent experiments.
| RESULTS |
|---|
|
|
|---|
|
The identification of zebrafish interrenal primordium
To understand the structure and development of the zebrafish interrenal
gland, we identified the interrenal primordium by detecting expression of
interrenal marker genes, such as scc and
3ß-HSD. Our in situ hybridization showed that
scc and 3ß-HSD are expressed in a region
ventral to the third somite in 36 hpf (hours post fertilization) embryos
(Fig. 2A,B). Another gene,
ff1b, which is a member of the Ftz-F1 nuclear receptor family
(Chai and Chan, 2000
), is also
expressed in the same region (Fig.
2C). Since the interrenal is located within the head kidney, we
examined the location of the primordial kidney (pronephros) in fish embryos by
hybridization with a pronephric marker, wt1
(Serluca and Fishman, 2001
).
Fig. 2D shows that wt1
is present in a wider region, ventral to both the second and third
somites.
|
Histological analysis of the interrenal gland
We examined histological sections of interrenal cells to further understand
their morphological details. The interrenal primordium is located in a region
caudal to the glomerulus (data not shown) and ventral to the notochord
(Fig. 3A). At 3 days post
fertilization (dpf), interrenal cells that express ff1b are already
enclosed by a capsule like structure, indicating that it is a distinct organ,
although it does not show epithelial characteristics, such as columnar cell
shape and organized cell arrangement (Fig.
3B,C). Electron micrographs show the presence of many mitochondria
inside the interrenal primordial cells
(Fig. 3D). Higher magnification
shows that these mitochondria contain tubulo-vesicular cristae
(Fig. 3E), which are typical
for cells engaged in active steroidogenesis
(Farkash et al., 1986
). It
indicates that these cells have already acquired steroidogenic potential. At 3
dpf, and at 5 dpf (data not shown), we did not find any epithelial
characteristics in the interrenal primordium, nor was it associated with blood
vessels. This indicates that although the interrenal primordium appears at
20-22 hpf (Fig. 4F,K),
interrenal gland organogenesis is so slow that it is incomplete at 5 dpf.
|
|
Analysis of migration of interrenal primordial cells in mutants
defective in midline signaling
The notochord and floor plate are midline structures important for
patterning associated cells, such as axial and paraxial mesoderm, and
neuroectoderm (Brand et al.,
1996
; Halpern et al.,
1997
). The interrenal primordium is located close to the
notochord. To determine whether its development could also be affected by
midline signaling, we followed the morphogenetic development of interrenal
primordia in mutants lacking midline structures, by labeling them with
scc. At 36 hpf, the normal interrenal primordium has fused into a
group of cells near the midline (Fig.
5A). In the flh mutant embryo, which lacks a notochord
(Halpern et al., 1995
), the
interrenal primordia are formed but never fuse together; they remain at their
original bilateral locations (Fig.
5D). Similarly, in oep (one-eyed pinhead)
mutants, which lack the floor plate and endoderm
(Schier et al., 1997
), the
interrenal primordia cannot fuse; moreover, they move to ectopic bilateral
locations (Fig. 5E).
|
In all these mutants, scc transcription is not affected. This indicates that the signals that are important for the morphogenetic movement of interrenal cells are not essential for its differentiation.
Restricted wt1 expression in the intermediate mesoderm is
important for early pronephric and interrenal development
The expression of wt1 is restricted to the second and third
somites once the pronephros begin to differentiate
(Fig. 4)
(Drummond et al., 1998
). We
examined the role of wt1 in the developing interrenal gland by
knocking down wt1 with an antisense morpholino (mo). We also used two
unrelated morpholino oligos as controls: antisense ff1a and sense
cyp17 (Tables 1 and
2). Although these embryos were
not visibly different from the wild-type embryos at 24 hpf, many of them
developed edema at 5 dpf, and some of them died (Tables
1 and
2). We examined pronephric and
interrenal primordia, identifiable by wt1 and ff1b
expression, respectively. At 24 hpf, compared to the wild-type embryos
(Fig. 6A) and ff1a
morphants (Fig. 6B and
Fig. 7B), wt1
morphants have less restricted pronephric primordia; and the size of the
interrenal primordia is significantly reduced
(Fig. 6C). At 36 hpf, the
pronephric primordia of wild-type embryos
(Fig. 6D) and ff1a
morphants (Fig. 6E) are already
partly fused and at 2 dpf glomeruli are formed
(Fig. 6G,H). Yet in
wt1 morphants, the morphogenetic movement of pronephric primordia is
inhibited and their sizes are reduced (Fig.
6F,I). The interrenal primordium is also reduced in size. In
addition, ff1b expression in the interrenal primordia also appears to
be reduced.
|
|
|
|
The reduction in cell differentiation and gene expression appears to be specific only for the interrenal primordia, as the ff1b morpholino has an opposite effect on the hypothalamus; the ff1b staining in the hypothalamus of the ff1b morphants is stronger and covers a larger area than that of the wild type (Fig. 7E,F). In addition, wt1 expression in pronephric primordia is not affected in ff1b morphants (data not shown).
ff1b can directly activate SCC transcription
Fig. 7 shows that
ff1b is important for interrenal differentiation and scc
expression. We questioned whether ff1b can activate scc transcription
directly, as the mammalian counterpart of ff1b, SF1, activates SCC
gene expression by recognizing functional SF1-binding sites on its promoter
(Hu et al., 2001
). In order to
examine the transcriptional activity of zebrafish ff1b, we co-transfected
ff1b and the lacZ reporter gene driven by 2.3 kb of the
human SCC promoter with or without a mutation at its SF1-binding site
into H1299 cells (Fig. 8). When
transiently co-transfected with the wild-type SCC promoter,
ff1b induced the promoter activity to more than eightfold that of the
control. Mutation of the proximal SF1-binding site resulted in a threefold
reduction of the transcriptional activity
(Fig. 8). Hence, ff1b can
directly drive human SCC transcription through its SF1-binding
sequence.
|
| DISCUSSION |
|---|
|
|
|---|
Comparison of interrenal gland and adrenal cortex
The interrenal gland is the major site of steroid synthesis in most
teleosts (Grassi Milano et al.,
1997
), as is the adrenal cortex in mammals
(Keegan and Hammer, 2002
).
Interrenal and adrenocortical cells both express steroidogenic genes, such as
scc and 3ß-HSD
(Keegan and Hammer, 2002
). We
showed that the zebrafish interrenal gland is embedded in the head kidney,
forming multiple epithelial layers interposed with two different types of
chromaffin cells in association with blood vessels. The structure of the
mammalian adrenal gland is quite different. It is a distinct organ with two
distinct layers, cortex and medulla, situated near the kidney
(Keegan and Hammer, 2002
). The
adrenal cortex contains three distinct functional layers, outer zona
glomerulosa, center zona fasciculata and inner zona reticularis, each with a
distinct cell morphology. Large quantities of blood vessels pass through the
zona fasciculata and zona reticularis. The cytoplasm of both interrenal and
adrenocortical cells contains a number of mitochondria, which are
characteristic of steroidogenic cells. Adrenocortical cells also accumulate
oil droplets as a result of their steroidogenic activities, yet this property
does not seem to be typical. We never found oil droplets in the interrenal
cells of zebrafish, nor were they detected in the interrenal cells of a
neotropical fish, Brycon gephalus
(Rocha et al., 2001
); however,
they were observed in the fathead minnow, Pimephales promelas
(Yoakim and Grizzle,
1980
).
Ff1b is a functional homologue of SF1 in mammals
Interrenal differentiation and scc gene expression are controlled
by the transcriptional activator Ff1b, which has similar functions to
mammalian SF1. Ff1b and SF1 are both transcriptional activators that directly
activate scc gene expression (Hu
et al., 2001
). ff1b is expressed in the interrenal,
gonads and hypothalamus (Fig. 7
and our unpublished results); mammalian SF1 is also expressed in
similar regions, plus the pituitary. When knocking down ff1b function
with the use of an antisense morpholino oligo, the interrenal primordium was
not maintained and disappeared around 3 dpf. This is similar to the situation
in SF1 knockout mice (Lala et
al., 1995
; Luo et al.,
1995
), which do not have adrenal glands. Ff1b and SF1 are both
members of the Ftz-F1 nuclear receptor in the NR5A family
(Nuclear Receptors Nomenclature Committee,
1999
). We and others and have cloned four Ftz-F1 genes in
zebrafish, termed ff1a, ff1b, ff1c and ff1d
(Lin et al., 2000
;
Chai and Chan, 2000
) (W. K.
Chan, personal communication and M. W. Kuo, W. C. Lee, W. K. Chan, J.
Postlethwait and B.-C.C., unpublished). Our phylogenetic analysis and the
current functional studies indicate that Ff1b is probably the zebrafish
orthologue of mammalian SF1 (NR5 A1). Although ff1b was previously
classified as nr5a4 (Chai and
Chan, 2000
), it is probably more appropriate to call it
nr5a1 based on the functional studies described in this paper.
In ff1b morphants, ff1b expression is decreased relative
to the wild-type and this could be due to a decreased interrenal population or
decreased ff1b expression in the interrenal primordium. However, the
expression of ff1b in the hypothalamic region is increased
(Fig. 7F). It appears that
ff1b can control its own gene expression. Depending on the site of
ff1b expression, the control can be positive, as in the interrenal,
or negative, as in the hypothalamus. Similarly, mammalian SF1 can
also be positively regulated in the adrenal gland through an autoregulatory
loop (Nomura et al.,
1996
).
The organogenesis of the interrenal gland and adrenal cortex
The zebrafish interrenal gland and mammalian adrenal cortex are two
functionally similar entities that are structurally different
(Mesiano and Jaffe, 1997
).
There are also differences in their ontogeny. The mouse adrenal gland is
derived from the urogenital ridge, which is characterized by the expression of
SF1. Two different populations of SF1-expressing cells later
differentiate into adrenal and gonadal primordia, but do not contribute to the
kidney (Morohashi, 1997
).
Zebrafish ff1b-expressing cells appear in a region ventral to the
third somites (similar to the location in mice), these cells will form the
interrenal gland at later developmental stages. ff1b-expressing cells
were not found in the gonads at early stages, although we did detect
ff1b expression in a region close to the bilateral gonads at 4 dpf
(data not shown).
The organogenesis of zebrafish interrenal and mammalian adrenal glands are
both quite slow. Mouse SF1 is expressed in the urogenital ridge at
E9; steroidogenic genes like scc begin to be expressed in the adrenal
primordium at embryonic day 11 (E11). Then neural crest cells migrate into the
adrenal gland at E12-14. The medulla becomes separated from the cortex at
birth, and the organogenesis is complete only at sexual maturity
(Keegan and Hammer, 2002
). The
zebrafish interrenal primordium first appears at 20-22 hpf
(Fig. 4F,K) and begins to
express scc, producing steroids around 24 hpf
(Fig. 7A). The interrenal
primordium is surrounded by a capsule-like structure at 3 dpf
(Fig. 3), but does not have any
epithelial characteristics, or surround a blood vessel, even at 5 dpf. These
observations indicate that both adrenocortical and interrenal cells have the
ability to produce steroid hormones, although the organogenetic process is not
completed.
Function of wt1 in the parallel development of the
interrenal and pronephros
The zebrafish interrenal is located within the head kidney; its development
also parallels embryonic kidney (pronephros) development. Zebrafish pronephric
primordial cells are first characterized by the expression of wt1; a
subset of these wt1-expressing cells appears to be the interrenal
primordium (Fig. 4F,K). The
interrenal primordial cells are separated from, but located close to, the
pronephric primordium cells at 24 hpf (Fig.
4G,L). Both cell types then undergo central migration followed by
fusion. The interrenal cells fuse at 30 hpf
(Fig. 4H,M), and branch out
into two separate groups at 3 dpf (Fig.
4J,O). The pronephric cells fuse into glomeruli at 40-44 hpf
(Drummond et al., 1998
) and
stay close to the interrenal throughout all the developmental processes.
The transcription factor WT1 controls the development of both the
interrenals and pronephros, but through different mechanisms. In our knockdown
experiments, reduced WT1 levels resulted in decreased ff1b expression
and smaller interrenal primordia. WT1 appears to be a determining factor for
the differentiation of interrenal and ff1b gene expression. This
situation is analogous to that in mammals, in which Wt1 has been
shown to activate the SF1 gene directly and to regulate adrenal
development (Nachtigal et al.,
1998
; Wilhelm and Englert,
2002
).
Reduced wt1 expression, however, results in its expanded expression domains in the anterior at 24 hpf (Fig. 6A,B). This is followed by the inability of the pronephric cells to migrate toward the midline and to fuse into glomeruli at later developmental stages. WT1 appears to affect the morphogenesis of the pronephros at multiple steps. However, the detailed molecular mechanisms controlling restricted distribution of wt1-expressing intermediate mesoderm still remain unknown. The organogenesis of the pronephros and interrenal glands needs further investigation.
Mammalian WT1 is expressed in the kidney, gonad and urogenital
ridge, but not in the developing adrenal gland
(Armstrong et al., 1993
). The
Wt1 knockout mice lack kidneys, gonads and adrenal glands
(Kreidberg et al., 1993
). The
metanephric blastema of Wt1 null mice is unable to condense and
proliferate upon proper induction. A function of Wt1 in adrenal
development has also been shown by reduced adrenal size in partially rescued
Wt1 null mice (Moore et al.,
1999
). These results indicate that mouse and zebrafish
wt1 share similar functions at similar steps of kidney and adrenal
(interrenal) developments.
The morphogenetic movements of pronephros and interrenal may be
controlled by different signals from the axial midline
The morphogenetic movement of interrenal cells is affected in flh
and oep mutants, but not in the cyc mutant or in mutants
defective in the shh signaling pathway. This indicates that selective signals,
defective in flh and oep mutants, are important for
interrenal development. The mechanisms of midline signaling that affect
interrenal migration still need further investigation.
Contrary to that of interrenal cells, morphogenetic movement of pronephric
cells is affected in flh, syu and yot mutant embryos
(Majumdar and Drummond, 2000
).
It appears that interenal and pronephric cells receive different signals as
migratory cues. The pronephric cells are influenced by the shh pathway, but
interrenal cells are not, although the migrations of both cell types are
affected by flh. These observations indicate that although both the
pronephros and interrenals are derived from intermediate mesoderm and are
located close to each other, their morphogeneses are regulated
differently.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Achermann, J. C., Ito, M., Hindmarsh, P. C. and Jameson, J. L. (1999). A mutation in the gene encoding steroidogenic factor-1 causes XY sex reversal and adrenal failure in humans. Nat. Genet. 22,125 -126.[CrossRef][Medline]
Armstrong, J. F., Pritchard-Jones, K., Bickmore, W. A., Hastie, N. D. and Bard, J. B. (1993). The expression of the Wilms' tumour gene, WT1, in the developing mammalian embryo. Mech. Dev. 40,85 -97.[CrossRef][Medline]
Baird, P. N., Groves, N., Haber, D. A., Housman, D. E. and Cowell, J. K. (1992). Identification of mutations in the WT1 gene in tumours from patients with the WAGR syndrome. Oncogene 7,2141 -2149.[Medline]
Barbaux, S., Niaudet, P., Gubler, M. C., Grunfeld, J. P., Jaubert, F., Kuttenn, F., Fekete, C. N., Souleyreau-Therville, N., Thibaud, E., Fellous, M. et al. (1997). Donor splice-site mutations in WT1 are responsible for Frasier syndrome. Nat. Genet. 17,467 -470.[CrossRef][Medline]
Brand, M., Heisenberg, C. P., Warga, R. M., Pelegri, F., Karlstrom, R. O., Beuchle, D., Picker, A., Jiang, Y. J., Furutani-Seiki, M., van Eeden, F. J. et al. (1996). Mutations affecting development of the midline and general body shape during zebrafish embryogenesis. Development 123,129 -142.[Abstract]
Briggs, J. P. (2002). The zebrafish: a new
model organism for integrative physiology. Am. J. Physiol. Regul.
Integr. Comp. Physiol. 282,R3
-R9.
Caron, K. M., Soo, S. C., Wetsel, W. C., Stocco, D. M., Clark,
B. J. and Parker, K. L. (1997). Targeted disruption of
the mouse gene encoding steroidogenic acute regulatory protein provides
insights into congenital lipoid adrenal hyperplasia. Proc. Natl.
Acad. Sci. USA 94,11540
-11545.
Chai, C. and Chan, W. K. (2000). Developmental expression of a novel Ftz-F1 homologue, ff1b (NR5A4), in the zebrafish Danio rerio. Mech. Dev. 91,421 -426.[CrossRef][Medline]
Chester Jones, I. and Mosley, W. (1980). The interrenal gland in Pisces. In General, Comparative and Clinical Endorcinologyof the Adrenal Cortex, vol. 3 (ed. I. C. Jones. and I. W. Henderson), pp. 395-523. London, New York: Academic Press.
Chiang, E.-F., Pai, C.-I., Wyatt, M., Yan, Y.-L., Postlethwait, J. and Chung, B.-c. (2001). Two sox9 genes on duplicated zebrafish chromosomes: expression of similar transcription activators in distinct sites. Dev. Biol. 231,149 -163.[CrossRef][Medline]
Chung, B.-c. (1996). Reactions carried out by P450c21 and P450c17. In Advances in Molecular and Cell Biology, vol. 14 (ed. C. R. Jefcoate), pp.203 -223. Greenwich, Connecticut: JAI Press Inc.
Crawford, P. A., Sadovsky, Y. and Milbrandt, J. (1997). Nuclear receptor steroidogenic factor 1 directs embryonic stem cells toward the steroidogenic lineage. Mol. Cell Biol. 17,3997 -4006.[Abstract]
Dallman, M. F., Darlington, D. N., Suemaru, S., Cascio, C. S. and Levin, N. (1989). Corticosteroids in homeostasis. Acta Physiol. Scand. Suppl. 583, 27-34.
Drummond, I. A., Majumdar, A., Hentschel, H., Elger, M., Solnica-Krezel, L., Schier, A. F., Neuhauss, S. C., Stemple, D. L., Zwartkruis, F., Rangini, Z. et al. (1998). Early development of the zebrafish pronephros and analysis of mutations affecting pronephric function. Development 125,4655 -4667.
Farkash, Y., Timberg, R. and Orly, J. (1986). Preparation of antiserum to rat cytochrome P-450 cholesterol side chain cleavage, and its use for ultrastructural localization of the immunoreactive enzyme by protein A-gold technique. Endocrinology 118,1353 -1365.
Grassi Milano, E., Basari, F. and Chimenti, C. (1997). Adrenocortical and adrenomedullary homologs in eight species of adult and developing teleosts: morphology, histology, and immunohistochemistry. Gen. Comp. Endocrinol. 108,483 -496.
Guo, I.-C., Tsai, H.-M. and Chung, B.-c. (1994). Actions of two different cAMP-responsive sequences and an adrenal enhancer of human CYP11A1 (P450scc) gene in adrenal Y1 and placental JEG-3 cells. J. Biol. Chem. 269,6362 -6369.
Halpern, M. E., Hatta, K., Amacher, S. L., Talbot, W. S., Yan, Y. L., Thisse, B., Thisse, C., Postlethwait, J. H. and Kimmel, C. B. (1997). Genetic interactions in zebrafish midline development. Dev. Biol. 187,154 -170.
Halpern, M. E., Thisse, C., Ho, R. K., Thisse, B., Riggleman, B., Trevarrow, B., Weinberg, E. S., Postlethwait, J. H. and Kimmel, C. B. (1995). Cell-autonomous shift from axial to paraxial mesodermal development in zebrafish floating head mutants. Development 121,4257 -4264.
Hsu, H.-J., Hsiao, P., Kuo, M.-W. and Chung, B.-c. (2002). Expression of zebrafish cyp11a1 as a maternal transcript and in yolk syncytial layer. Gene Exp. Patterns 2, 219-222.
Hu, M.-C., Chou, S.-J., Huang, Y.-Y., Hsu, N.-C., Li, H. and Chung, B.-c. (1999). Tissue-specific, hormonal, and developmental regulation of SCC-LacZ expression in transgenic mice leads to adrenocortical zone characterization. Endocrinology 140,5609 -5618.
Hu, M.-C. and Chung, B.-c. (1990). Expression of human 21-hydroxylase (P450c21) in bacterial and mammalian cells: a system to characterize normal and mutant enzymes. Mol. Endocrinol. 4,893 -898.
Hu, M.-C., Hsu, N.-C., El Hadj, N. B., Pai, C.-I., Chu, H.-P., Wang, C.-K. L. and Chung, B.-c. (2002). Steroid deficiency syndromes in mice with targeted disruption of Cyp11a1. Mol. Endocrinol. 16,1943 -1950.
Hu, M.-C., Hsu, N.-C., Pai, C.-I., Wang, C.-K. L. and Chung, B.-c. (2001). Functions of the upstream and proximal steroidogenic factor 1 (SF-1)-binding sites in the CYP11A1 promoter in basal transcription and hormonal response. Mol. Endocrinol. 15,812 -818.
Ikeda, Y., Luo, X., Abbud, R., Nilson, J. H. and Parker, K. L. (1995). The nuclear receptor steroidogenic factor 1 is essential for the formation of the ventromedial hypothalamic nucleus. Mol. Endocrinol. 9,478 -486.
Ishii, T., Hasegawa, T., Pai, C. I., Yvgi-Ohana, N., Timberg, R., Zhao, L., Majdic, G., Chung, B. C., Orly, J. and Parker, K. L. (2002). The roles of circulating high-density lipoproteins and trophic hormones in the phenotype of knockout mice lacking the steroidogenic acute regulatory protein. Mol. Endocrinol. 16,2297 -2309.
Jones, I. C. and Bellamy, D. (1964). Hormonal mechanisms in the homeostatic regulation of the vertebrate body with special reference to the adrenal cortex. Symp. Soc. Exp. Biol. 18,195 -236.
Jowett, T. (2001). Double in situ hybridization techniques in zebrafish. Methods 23,345 -358.
Keegan, C. E. and Hammer, G. D. (2002). Recent insights into organogenesis of the adrenal cortex. Trends Endocrinol. Metab. 13,200 -208.
Kreidberg, J. A., Sariola, H., Loring, J. M., Maeda, M., Pelletier, J., Housman, D. and Jaenisch, R. (1993). WT-1 is required for early kidney development. Cell 74,679 -691.
Lai, W. W.-K., Hsiao, P.-H., Guiguen, Y. and Chung, B.-c. (1998). Cloning of zebrafish cDNA for 3beta-hydroxysteroid dehydrogenase and P450scc. Endocr. Res. 24,927 -931.
Lala, D. S., Ikeda, Y., Luo, X., Baity, L. A., Meade, J. C. and Parker, K. L. (1995). A cell-specific nuclear receptor regulates the steroid hydroxylases. Steroids 60, 10-14.
Lin, W., Wang, H. W., Sum, C., Liu, D., Hew, C. L. and Chung, B.-c. (2000). Zebrafish ftz-f1 gene has two promoters, is alternatively spliced, and is expressed in digestive organs. Biochem. J. 348,439 -446.
Luo, X., Ikeda, Y., Lala, D. S., Baity, L. A., Meade, J. C. and Parker, K. L. (1995). A cell-specific nuclear receptor plays essential roles in adrenal and gonadal development. Endocr. Res. 21,517 -524.
Majumdar, A. and Drummond, I. A. (2000). The zebrafish floating head mutant demonstrates podocytes play an important role in directing glomerular differentiation. Dev. Biol. 222,147 -157.
Mesiano, S. and Jaffe, R. B. (1997). Developmental and functional biology of the primate fetal adrenal cortex. Endocr. Rev. 18,378 -403.
Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D. and Schedl, A. (1999). YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development 126,1845 -1857.
Morohashi, K. (1997). The ontogenesis of the steroidogenic tissues. Genes Cells 2, 95-106.
Morohashi, K. I. and Omura, T. (1996). Ad4BP/SF-1, a transcription factor essential for the transcription of steroidogenic cytochrome P450 genes and for the establishment of the reproductive function. FASEB J. 10,1569 -1577.
Nachtigal, M. W., Hirokawa, Y., Enyeart VanHouten, D. L., Flanagan, J. N., Hammer, G. D. and Ingraham, H. A. (1998). Wilms' tumor 1 and Dax-1 modulate the orphan nuclear receptor SF-1 in sex-specific gene expression. Cell 93,445 -454.
Nomura, M., Nawata, H. and Morohashi, K. (1996). Autoregulatory loop in the regulation of the mammalian ftz-f1 gene. J. Biol. Chem. 271,8243 -8249.
Nuclear-Receptors-Nomenclature-Committee. (1999). A unified nomenclature system for the nuclear receptor subfamily. Cell 97,1 -20.
Parker, K. L., Rice, D. A., Lala, D. S., Ikeda, Y., Luo, X., Wong, M., Bakke, M., Zhao, L., Frigeri, C., Hanley, N. A. et al. (2002). Steroidogenic factor 1: an essential mediator of endocrine development. Recent Prog. Horm. Res. 57, 19-36.
Pelletier, J., Bruening, W., Kashtan, C. E., Mauer, S. M., Manivel, J. C., Striegel, J. E., Houghton, D. C., Junien, C., Habib, R., Fouser, L. et al. (1991). Germline mutations in the Wilms' tumor suppressor gene are associated with abnormal urogenital development in Denys-Drash syndrome. Cell 67,437 -447.
Penberthy, W. T., Shafizadeh, E. and Lin, S. (2002). The zebrafish as a model for human disease. Front. Biosci. 7,1439 -1453.
Rheaume, E., Sanchez, R., Mebarki, F., Gagnon, E., Carel, J. C., Chaussain, J. L., Morel, Y., Labrie, F. and Simard, J. (1995). Identification and characterization of the G15D mutation found in a male patient with 3 beta-hydroxysteroid dehydrogenase (3 beta-HSD) deficiency: alteration of the putative NAD-binding domain of type II 3 beta-HSD. Biochemistry 34,2893 -2900.
Rice, D. A., Mouw, A. R., Bogerd, A. M. and Parker, K. L. (1991). A shared promoter element regulates the expression of three steroidogenic enzymes. Mol. Endocrinol. 5,1552 -1561.
Rocha, R. M., Leme-Dos Santos, H. S., Vicentini, C. A. and da Cruz, C. (2001). Structural and ultrastructural characteristics of interrenal gland and chromaffin cell of matrinxa, Brycon cephalus Gunther 1869 (Teleostei-Characidae). Anat. Histol. Embryol. 30,351 -355.
Schier, A. F., Neuhauss, S. C., Helde, K. A., Talbot, W. S. and Driever, W. (1997). The one-eyed pinhead gene functions in mesoderm and endoderm formation in zebrafish and interacts with no tail. Development 124,327 -342.
Serluca, F. C. and Fishman, M. C. (2001). Pre-pattern in the pronephric kidney field of zebrafish. Development 128,2233 -2241.
White, P. C., Curnow, K. M. and Pascoe, L. (1994). Disorders of steroid 11 beta-hydroxylase isozymes. Endocr. Rev. 15,421 -438.
White, P. C. and Speiser, P. W. (2000). Congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Endocr. Rev. 21,245 -291.
Wilhelm, D. and Englert, C. (2002). The Wilms tumor suppressor WT1 regulates early gonad development by activation of Sf1. Genes Dev. 16,1839 -1851.
Yoakim, E. G. and Grizzle, J. M. (1980). Histologic, histochemical and ultrastructural studies on the interrenal and chromaffin cells of fathead minnow, Pimephales promelas (Rafinesque). J. Fish. Biol. 17,477 -494.
This article has been cited by other articles:
![]() |
M. I. Ferrante, L. Romio, S. Castro, J. E. Collins, D. A. Goulding, D. L. Stemple, A. S. Woolf, and S. W. Wilson Convergent extension movements and ciliary function are mediated by ofd1, a zebrafish orthologue of the human oral-facial-digital type 1 syndrome gene Hum. Mol. Genet., January 15, 2009; 18(2): 289 - 303. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xie, W.-Q. Wang, T.-X. Liu, M. Deng, and G. Ning Spatio-temporal expression of chromogranin A during zebrafish embryogenesis J. Endocrinol., September 1, 2008; 198(3): 451 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhao, Z. Yang, J. K. Phelan, D. A. Wheeler, S. Lin, and E. R. B. McCabe Zebrafish dax1 Is Required for Development of the Interrenal Organ, the Adrenal Cortex Equivalent Mol. Endocrinol., November 1, 2006; 20(11): 2630 - 2640. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-Y. Chen, W.-C. Lee, N.-C. Hsu, F. Huang, and B.-c. Chung SUMO Modification of Repression Domains Modulates Function of Nuclear Receptor 5A1 (Steroidogenic Factor-1) J. Biol. Chem., September 10, 2004; 279(37): 38730 - 38735. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Liang, C. A. Jones, B. W. Bisgrove, L. Song, S. T. Glenn, H. J. Yost, and K. W. Gross Genomic characterization and expression analysis of the first nonmammalian renin genes from zebrafish and pufferfish Physiol Genomics, February 13, 2004; 16(3): 314 - 322. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||