|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00429

ABI, Department of Biochemistry, Laboratory of Molecular Neurogenetics,
Ludwig-Maximilians-Universitaet, Schillerstr. 44, D-80336 Munich,
Germany
* Present address: Department of Neuroscience, Pasteur Institute, Paris,
France
Author for correspondence (e-mail:
ralf.baumeister{at}pbm.med.uni-muenchen.de)
Accepted 3 February 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Presenilin, Alzheimer's disease, Genetic suppression, Transcription regulation
| INTRODUCTION |
|---|
|
|
|---|
-secretase cleavage involved in generating
ß-amyloid fragments from APP (Steiner
et al., 2000
Mutations in either of the human presenilin genes, PSEN1 and
PSEN2, are dominant and cause early onset Alzheimer's disease. They
result in an increase in the ratio of the 42 amino acid variant to the 40
amino acid variant of ß-amyloid, but do not alter the total amount of
presenilin-dependent
-secretase cleavage (reviewed by
Selkoe, 2001
). The 42 amino
acid variant of ß-amyloid is highly insoluble and tends to aggregate,
nucleating the senile plaques found in brains of individuals with Alzheimer's
disease (reviewed by Sisodia and St
George-Hyslop, 2002
).
Presenilin activity is also required for the S3 cleavage of Notch receptors
after ligand binding (Struhl and Adachi,
1998
). Like the
-secretase cleavage of APP, this cleavage
occurs within the transmembrane domain and releases the Notch intracellular
domain (NICD). The release of the NICD is essential for Notch signaling,
because the liberated NICD fragment enters the nucleus where it interacts with
the transcription factor CSL (CBP, suppressor of hairless, lag-1)
(De Strooper et al., 1999
;
Song et al., 1999
) and
additional co-activators such as sel-8/lag-3 or mastermind
(Doyle et al., 2000
;
Freyer et al., 2002
;
Petcherski and Kimble,
2000
).
The C. elegans genome encodes three presenilin genes, sel-12,
hop-1 and spe-4 that are homologous to human PSEN1 and
PSEN2. spe-4 is the most divergent member of the presenilin family
and appears to have a specific role in spermatogenesis
(Arduengo et al., 1998
;
L'Hernault and Arduengo,
1992
). The two other presenilins are much more similar to the
human homologs and are absolutely essential for signaling through the two
C. elegans Notch-type receptors LIN-12 and GLP-1
(Levitan and Greenwald, 1995
;
Li and Greenwald, 1997
;
Westlund et al., 1999
). The
absence of both sel-12 and hop-1 genes leads to a completely
penetrant lethal phenotype that resembles either a complete loss of GLP-1 or a
complete loss of LIN-12 signaling [the exact phenotype depends on how the
double mutants are constructed as both sel-12 and hop-1 have
partial maternal effects (Westlund et al.,
1999
)]. On their own, mutations in hop-1 have no obvious
phenotype, while mutations in sel-12 lead to an egg-laying defect
(Egl) (Levitan and Greenwald,
1995
; Westlund et al.,
1999
). sel-12 and hop-1 seem to have largely
overlapping roles, as hop-1 can rescue the sel-12 Egl defect
when expressed from a sel-12 promoter
(Li and Greenwald, 1997
;
Westlund et al., 1999
). Not
only the sequence, but also the function of presenilins is evolutionarily
conserved, as both human presenilins PSEN1 and PSEN2 can also rescue the
sel-12 Egl defect when expressed under the control of appropriate
promoters (Baumeister et al.,
1997
; Levitan et al.,
1996
).
In order to understand more about the biological role of presenilins, we
have been studying the sel-12 gene in C. elegans. Mutations
in sel-12 were first identified for their ability to suppress a
lin-12 gain-of-function mutation
(Levitan and Greenwald, 1995
).
This suggests that sel-12 mutations reduce lin-12 signaling
and that the SEL-12 protein normally facilitates lin-12 signaling
(Levitan and Greenwald, 1995
).
However, mutations in sel-12 do not completely eliminate
lin-12 signaling, presumably owing to residual presenilin activity
supplied by hop-1 (Li and
Greenwald, 1997
; Westlund et
al., 1999
). Different levels of LIN-12 activity are required to
control at least five post-embryonic signaling events
(Eimer et al., 2002a
). In
sel-12 null mutants, only two of these are affected to a varying
degree (Eimer et al., 2002a
;
Cinar et al., 2001
). This
indicates that the presenilin activity supplied by hop-1 is
sufficient for most lin-12 signaling events and that some
lin-12 signaling events appear to be more sensitive to presenilin
dosage than others (Eimer et al.,
2002a
).
To elucidate the function of the sel-12 gene further, one can
study mutations that bypass the need for sel-12. Mutations in four
genes, sel-10, spr-1, spr-2 and spr-5, have already been
shown to suppress the sel-12 egg-laying defect. Mutations in
sel-10 were first found in a screen for genes that suppress a weak
lin-12 loss-of-function mutant
(Hubbard et al., 1997
).
sel-10 is similar to the yeast gene CDC4, and acts as an E3 ubiquitin
ligase that targets the intracellular domains of LIN-12 and GLP-1 proteins for
degradation (Gupta-Rossi et al.,
2001
; Hubbard et al.,
1997
). sel-10 mutations also weakly suppress mutations in
sel-12, but do completely bypass the need for sel-12. In a
screen similar to the one reported here, Wen et al. have identified four genes
that strongly suppress the Egl defect of sel-12 (suppressors of
presenilin) and have described the cloning and characterization of one of
them, spr-2 (Wen et al.,
2000
). Mutations in spr-2 almost completely bypass the
need for sel-12. The biochemical role of SPR-2 is presently unclear,
but it may affect chromatin structure and/or transcription
(Wen et al., 2000
).
In this paper, we report the results of several screens for strong
suppressors of sel-12 and the isolation of 25 independent mutations.
These mutations lie in several of the same complementation groups identified
by Wen et al. as well as in some additional genes, indicating that neither
screen has reached saturation. We also report the cloning and characterization
of two suppressor genes, spr-3 and spr-4, that code for
C2H2 zinc-finger proteins similar to the transcriptional
repressors REST/NRSF. spr-3 and spr-4 mutants bypass the
need for sel-12 by upregulating the transcription of the other
presenilin, hop-1. As two other presenilin suppressors that were also
identified in this screen, spr-1 and spr-5, encode proteins
of the CoREST/HDAC complex (Eimer et al.,
2002b
; Jarriault and
Greenwald, 2002
) that interacts with REST, we propose that the Spr
proteins assemble into one or more repressor complexes that normally repress
the hop-1 locus in the early larval stages. Mutations in components
of these complexes remove a repressor activity leading to a higher basal level
of hop-1 presenilin activity.
| MATERIALS AND METHODS |
|---|
|
|
|---|
All mutations were obtained from the Caenorhabditis Genetics Center, except
sel-12(ar131) sel-12(ar171), spr-3(ar209) and spr-4(ar208)
(kindly provided by Iva Greenwald), and hop-1(lg1501) [described by
Wittenburg et al. (Wittenburg et al.,
2000
)], sel-12(by125) and sel-12(lg1401)
[described in Eimer et al. (Eimer et al.,
2002a
)].
Isolation of mutants
Ethylmethanesulfonate (EMS) and ultra violet light/tetramethylpsoralen
(UV/TMP) mutagenesis were carried out according to published procedures
(Anderson, 1995
;
Sulston and Hodgkin, 1988
).
The mutator screen is presented in another paper
(Eimer et al., 2002b
). We
looked in one EMS (16,000 haploid genomes) and one UV/TMP screen (8000 haploid
genomes) for dominant suppressor mutations, but did not identify any. We
screened for recessive suppressor mutations in a similar manner to Wen et al.
(Wen et al., 2000
). Mutants
were retained when the spr; sel-12(ar171) double mutants displayed
essentially wild-type egg-laying behavior and the vast majority of their
progeny (>90%) did not become Egl. All mutations were outcrossed five times
before further phenotypic analysis. For each type of screen, the mutagens
used, the number of haploid genomes screened and the mutations identified are
as follows.
Mutator generated mutations: 9600; by101, by110.
Complementation tests
Complementation tests were done according to standard procedures
(Sulston and Hodgkin, 1988
).
Assignment of complementation groups was as follows.
Genetic mapping
Suppressor mutations were genetically mapped using standard techniques
(Sulston and Hodgkin, 1988
)
maintaining, where possible, the spr mutation in a homozygous
sel-12(ar171) background. The position of spr-4 was refined
further by single nucleotide polymorphism (SNP) mapping carried out
essentially as described (Jakubowski and
Kornfeld, 1999
).
Transgenic rescue of spr-3 and spr-4
We injected into the strain sel-12(ar171) spr-3(by108) to rescue
spr-3 and into the strain spr-4(by105); sel-12(ar171) to
rescue spr-4. We then looked for anti-suppressor activity of
injection mixes (i.e. restoration of a sel-12 phenotype). All test
clones and PCR products were injected at 20 ng/µl with 100 ng/µl pRF4
(rol-6) and 20 ng/µl pBY218 [ttx-3::GFP
(Hobert et al., 1997
)] as
co-injection markers.
Gene structures of spr-3 and spr-4
We sequenced two spr-3 cDNAs, yk64e9 and yk247c5, kindly provided
by Yuji Kohara. We found that the two cDNAs have a very similar structure, yet
yk247c5 has an additional intron in the largest exon of the gene. However, on
staged northern blots (see Fig.
2, Fig. 4A) and by
RT-PCR on each developmental stage, only a single transcript, similar in
length to yk64e9, could be detected (data not shown). In the process of
sequencing the cDNAs, we also discovered a sequencing error in the genomic
sequence from the cosmids F46H6 and C07A12 near the 5' end of
spr-3, which put the first ATG out of frame (data not shown). This
error was communicated to the C. elegans sequencing consortium and
the genomic sequence has been updated. To determine the 5' end of the
spr-3 transcript we performed PCR on a random primed cDNA library,
kindly provided by Bob Barstead, using SL1 and SL2 forward primers
(Spieth et al., 1993
) and gene
specific reverse primers (RB1080 CATACTTGACGGCATCATCGG; RB1079
CATCTGCTTCTCGCTCGAGAATCG). We found that spr-3 is trans-spliced to
SL1 but not to SL2. The SL1 specific product was sequenced and was found to
start just 5' to the 5'ends of the two sequenced cDNAs at a
predicted splice acceptor site.
|
|
|
The C. briggase spr-3 gene
We identified a possible spr-3 homolog in C. briggsae on
the contig c010301474. We purified total C. briggsae mixed stage RNA
with a Qiagen RNAeasy kit according to the manufacturer's instructions
(Qiagen, Hilden). To determine its gene structure, we performed RT-PCR with
various combinations of primers. We amplified a PCR product using the primers
RB1627 TACTTGCCACTTGTGTCCAAG and RB1629 TGGTGAACTTTTCACCAGCG from
reverse-transcribed first-strand cDNAs generated with the primer RB1629. This
PCR product was sequenced and found to contain the central and 3'
regions of the C. briggsae spr-3 gene.
Expression constructs
An spr-3::EGFP promoter fusion was made by cloning EGFP
at the spr-3 ATG behind 4 kb of spr-3 promoter sequence.
This construct also contained the spr-3 3'UTR. Translational
fusion constructs were made by inserting EGFP into a rescuing genomic
construct either at the ATG (N-terminal fusion) or before the TAA stop codon
(C-terminal fusion), but transgenic lines generated with these constructs did
not rescue spr-3 and did not have detectable GFP fluorescence. The
Baculovirus expression construct was made by inserting the spr-3 cDNA
into the transfer vector pBY1296 (Eimer et
al., 2002b
) fusing a GST-Myc-tag N-terminally to spr-3.
The resulting construct was co-transformed along with linearized BaculoGold
DNA (Becton-Dickinson/Pharmingen) into Sf9 cells to generate recombinant
viruses.
RNAi by feeding
We subcloned a 2.7 kb HindIII/XhoI fragment from the cDNA
yk356a2 (kindly provided by Y. Kohara) into L4440 (pPD129.36, kindly provided
by A. Fire) cut HindIII/XhoI to generate a C28G1.4 RNAi
feeding vector. A full-length hop-1 cDNA was amplified by PCR and
cloned as a SmaI/NotI fragment into L4440 creating pBY1575.
Genes were transiently inactivated by RNAi through feeding of the E.
coli strain HT115(DE3) expressing double stranded RNA of the gene of
interest (Timmons et al.,
2001
; Timmons and Fire,
1998
). The dsRNA expression was induced as described
(Kamath et al., 2001
) and the
worms were transferred as L4 larvae onto seeded plates containing 50 µg/ml
ampicillin and 1 mM IPTG. After 24 hours the parental worm was transferred to
a new plate also containing ampicillin and IPTG. The progeny on the second
RNAi plate were then scored for the relevant phenotypes. In the case of
sel-12(ar171) animals, the parental worms were kept on the first RNAi
plate until they died with a bag of worm phenotype and only the last progeny
were scored for the RNAi phenotype.
Northern blots
RNA was isolated from mixed stage plates or staged plates and prepared with
an RNAeasy kit according to the manufacturer's instructions (Qiagen, Hilden).
For most Northern blots, 5 µg of total RNA per lane was denatured at
65°C for 5 minutes and then loaded onto a 0.8% agarose RNA gel. The gel
was run overnight to separate fragments and blotted onto Hybond N+ membranes
according to Sambrook (Sambrook, 1989). For the L1 northern blots, 20 µg of
total RNA was used per lane. Probes were labeled with
32P
dCTP using a Megaprime labeling kit according to the manufacturer's
instructions (Amersham, Freiburg, Germany). Blots were hybridized and washed
according to the procedure of (Church and
Gilbert, 1984
) at 65°C. All northern blots were probed with an
ama-1 specific probe (Johnstone
and Barry, 1996
) as a loading control. For each blot we first made
a blot with 5 µg per lane of total RNA and probed it with ama-1.
We then used the results of this probing to adjust the amount of RNA loaded to
obtain equal amounts of mRNA per lane. For the quantification of relative
transcript levels, blots were placed on a storage phosphor screen (Molecular
Dynamics) for several days and were read with a Storm 860 scanner (Molecular
Dynamics). The intensity of bands was determined using ImageQuant version 4.2
(Molecular Dynamics) using the User Method of Volume Quantitation. Volumes
were adjusted for background intensity.
For staged northern blots, worms were synchronized at the L1 stage by
alkaline hypochlorite treatment (Sulston
and Hodgkin, 1988
). Then synchronized L1 larvae were spotted onto
9 cm plates seeded with OP50 and allowed to grow for 6 hours, 18 hours, 30
hours, 42 hours and 54 hours for L1, L2, L3, L4 and young adult stages,
respectively. Worms were inspected visually before harvesting to confirm that
the worms were at the correct stage.
| RESULTS |
|---|
|
|
|---|
Subsequently, Wen et al. identified four suppressors of presenilin (Spr
genes) in a similar screen and described the cloning and characterization of
one of them, spr-2 (Wen et al.,
2000
). Wen et al. mapped spr-1, spr-2, spr-3 and
spr-4 to chromosomes V, IV, X and I, respectively. By complementation
analysis with spr-3(ar209) and spr-4(ar208) (kindly provided
by I. Greenwald, New York), we determined that by108 and
by105 were alleles of spr-3 and spr-4, respectively.
Consequently, we defined a new gene, spr-5, with the reference allele
by101 (Eimer et al.,
2002b
). We examined the remaining five suppressor mutations found
in our screens to see if they could be spr-1 or spr-2
alleles. None of the remaining five alleles had a mutation in the coding
region of spr-2. However, by133 showed close linkage to
dpy-11 on chromosome V and mapped to a similar region as
spr-1 (see Table S1 at
http://dev.biologists.org/supplemental/).
spr-1 has recently been cloned
(Jarriault and Greenwald,
2002
) and we have found that by133 contains a mutation in
this gene (Eimer et al.,
2002b
). The remaining four suppressor mutations have not been
pursued in detail, but by complementation tests define three additional genes
(data not shown). The fact that we found no spr-2 alleles and that we
have found mutations in genes not identified by
(Wen et al., 2000
) indicates
that saturation was not reached in either screen. The rest of this paper will
report the cloning and characterization of two of the major complementation
groups, spr-3 and spr-4.
spr-3 and spr-4 potently and specifically suppress
sel-12
Roughly 75% of all sel-12(ar171) adult animals display a
protruding vulva (Pvl; Fig. 1),
a defect that is strongly correlated with, and presumably caused by, the
mis-specification of the
lineage
(Eimer et al., 2002a
). Almost
all sel-12 animals retain too many eggs in the uterus (an egg-laying
defective or Egl phenotype) and these eggs hatch and develop within the
mother, leading to a terminal `bag of worms' (Bag) phenotype
(Fig. 1). The Egl defect
severely limits the number of progeny generated
(Table 1). Mutations in
spr-3 completely suppress all aspects of the sel-12
egg-laying defect (Fig. 1).
sel-12(ar171) spr-3 double mutants also display a nearly wild-type
brood size (Table 1),
indicating that spr-3 mutations restore normal egg-laying behavior
and normal fertility. They also respond to neurotransmitters that stimulate
egg laying (data not shown). spr-4 mutations, however, lead to a less
completely penetrant suppression of the sel-12 phenotype and in all
alleles,
5% of spr-4; sel-12(ar171) animals still
become Egl (Fig. 1). This Egl
phenotype is similar to sel-12(ar171), except that no Pvl animals are
seen. This suggests that in these remaining Egl animals at least part of the
sel-12 phenotype was rescued. However, those spr-4;
sel-12(ar171) double mutant animals that do lay eggs display a nearly
wild-type brood size (Table 1).
Mutations in spr-3 and spr-4 also suppress all other
sel-12 alleles tested (ar131, by125, lg1401 for
spr-3, and ar131 for spr-4;
Table 1 and data not shown). On
their own, mutations in spr-3 and spr-4 have no obvious
phenotype, except perhaps a slightly reduced brood size
(Table 1; data not shown). For
spr-3, we examined a clear null mutation (by131 also known
as byDf1) in more detail. Surprisingly even this mutation, a 31 kb
deletion that deletes five genes including spr-3 and both its
upstream and downstream neighbor (Fig.
2B), has no obvious phenotype
(Table 1; data not shown),
indicating that none of the deleted genes is essential. Taken together these
results show that spr-3 and spr-4 are potent and specific
suppressors of sel-12 that are able to suppress all aspects of the
sel-12 phenotype.
|
|
spr-3 encodes a novel, basic protein (predicted pI=9.1) of 684 amino acids. The only recognizable domains in SPR-3 are seven putative C2H2 zinc-finger and several regions that may act as nuclear localization signals (Fig. 3A,B). The spr-3 alleles ar209, by108, by110 and by137 are all amino acid to stop codon mutations at various positions in the protein (Fig. 3B). The by135 mutation is a single base pair deletion, which shifts frame after amino acid 183 and truncates the protein at 210 amino acids. The by109 mutation is a C596Y transition in the second cysteine of the sixth zinc finger, indicating that this finger is essential for SPR-3 function. by131 is a deletion of 31,069 bases from position 3052 of F46H6 to position 6698 of C07A12 with a single A base pair insertion. This mutation deletes F46H6.2/dgk-2, F46H6.4, F46H6.1/rhi-1, C07A12.5/spr-3 and part of C07A12.7, and is clearly null for spr-3 function (Fig. 2B). As by131 deletes several genes, we have renamed it byDf1. By a combination of PCR, Southern blotting and sequencing, we determined that there are no alterations in the coding sequence of by136. However, by136 has a complex promoter rearrangement in C07A12.5 (data not shown). Using northern analysis, a single transcript is detectable in by108, by109, by110, by135 and by137 lanes at nearly wild-type levels although no transcript is detectable for byDf1 and by136 (Fig. 2C) indicating that by136 is also null for spr-3 function.
|
The spr-3 gene has evolved rapidly
We were unable to identify any clear homologs of SPR-3 in the sequence
databases. To understand better what regions of the protein could be important
for its function, we tried to identify homologs in C. briggsae, the
closest known relative of C. elegans
(Blaxter et al., 1998
). Using
RT-PCR, we have isolated a large fragment of this transcript and determined
that it has a similar exon/intron structure to spr-3 in C.
elegans (see Fig. 3A,B).
However, the C. briggsae gene is only 22% identical and 45% similar
to C. elegans spr-3 (see Fig.
3B), with most of the similarity confined to the zinc-finger
regions. The predicted 5' end of the C. briggsae spr-3 gene is
significantly diverged from the C. elegans spr-3. However, in the
predicted N-terminal region of C. briggsae SPR-3, there is a region
similar to zinc fingers 1 and 2 of C. elegans SPR-3
(Fig. 3B).
SPR-3 is similar to transcriptional repressors
The fact that SPR-3 is only weakly conserved in C. briggsae, with
similarity largely confined to the zinc-finger domains, suggests that the
regions between the zinc fingers are under little selective pressure and that
the zinc fingers and nuclear localization signals may be the only functional
domains of the protein. If this were the case, then we would expect that most
mutations that result in amino acid substitutions would have no phenotypic
consequences. Consistent with this, only one out of eight spr-3
alleles is a missense mutation, and this mutation affects a conserved cysteine
of one of the zinc fingers. SPR-3 contains three pairs of adjacent zinc
fingers and one lone zinc finger separated by non-conserved linkers.
Therefore, to analyze the zinc finger regions of the protein, we concatenated
the sequences of just the zinc fingers, along with the short linkers between
tandem fingers, and searched the databases for similarity. This sequence is
similar to many C2H2 zinc-finger proteins and is most
similar to members of the REST family of transcriptional repressors
(Fig. 3C). This suggests that
SPR-3 may also function as a transcriptional repressor.
SPR-4 belongs to a family of C2H2 proteins
related to transcriptional repressors
spr-4 was mapped between unc-55 and daf-8 on
LGI, close to, but to the right of, the single nucleotide polymorphism (SNP)
vl20a11.s1{at}186
on cosmid F18C12 (Fig. 5A,B).
Near this point is the gene C09H6.1, which has the greatest similarity in
C. elegans to C07A12.5 (Fig.
5B). By probing spr-4 alleles on a Southern blot with
yk18b7, a C09H6.1 cDNA, we could identify clear polymorphisms in two UV/TMP
generated spr-4 alleles, by130 and by132 (data not
shown). Injection of either of two cosmids that overlap C09H6, F34G10 and
C48B11, gave partial rescue of spr-4 (data not shown). Both of these
cosmids contain a 12 kb PvuII fragment that contains the entire
coding region of C09H6.1, 2 kb of 3' sequence, as well as 4.5 kb of
5' sequence extending almost to the next gene upstream
(Fig. 5B). We subcloned the
PvuII fragment from F34G10 into pBSIISK-cut with PvuII and
found that this rescues spr-4 as well as the original cosmids (data
not shown).
spr-4 codes for a large protein with 1309 amino acids
(Fig. 5C) containing 18
C2H2 zinc-finger domains. One of the zinc fingers,
labeled ZNF7, is below threshold by Pfam
(http://www.cgr.ki.se/Pfam/)
but this region is highly conserved in C. briggsae (data not shown),
indicating that it may represent a functional domain. A possible splice
variant has also been suggested based on the sequence of the yk1178d11 cDNA
(see Materials and Methods). SPR-4 is also predicted to be nuclearly localized
and contains several nuclear localization signals (NLS), including a bipartite
NLS. We have identified the mutations in three spr-4 alleles
(Fig. 5C). by130
contains a 64 bp deletion and 8 bp insertion at position 1165 of the message.
This deletion shifts frame at amino acid 389 and truncates the predicted
protein at position 404 (Fig.
5C). The by112 allele is a Q97stop mutation
(Fig. 5C). By Southern
analysis, by132 contains a
500 bp deletion near the 3' end
of the gene (data not shown).
SPR-4 has clear homologs in C. briggsae (data not shown), and in
the more distantly related nematodes Pristionchus pacificus
(AI989188) and Parastrongyloides tricosuri (BM513702) (J. McCarter,
personal communication). SPR-4 also has strong similarity
(e=3x1043) to C28G1.4 in C. elegans (NM
077098.1). Twenty-one of the first 34 amino acids are identical between SPR-4
and C28G1.4. This region is followed in both proteins by a highly acidic
stretch suggesting that this region forms a functional domain
(Fig. 5C). The central region
of C28G1.4 does not resemble any other protein but C28G1.4 is 34% identical to
SPR-4 in the N-terminal section from ZNF13 to the end of the protein and
contains all zinc fingers in this region except ZNF15, suggesting that SPR-4
and C28G1.4 may have a related function
(Fig. 5C). However, RNA
interference by feeding (Kamath et al.,
2001
) of C28G1.4 has no obvious effects on the wild-type strain N2
nor does it influence the Egl defect of sel-12(ar171) and
sel-12(ar131) (data not shown). dsRNAi against C28G1.4 also fails to
produce any synthetic effect in either a spr-4(by105); sel-12(ar171)
or a spr-4(by105) background (data not shown). These results may
suggest that an RNAi effect was not induced by the bacterial feeding approach;
however, RNAi by injection of purified double stranded RNA from yk356a2, a
C28G1.4 cDNA, also induced no phenotype
(Maeda et al., 2001
).
Interestingly, there is no C28G1.4 homolog present in the draft C.
briggsae assembly, suggesting that C28G1.4 may have recently diverged
from an ancestral spr-4 like gene or that this gene is under very low
selective pressure or can be lost without phenotypic effects.
SPR-4 also has similarity to a large number of zinc-finger proteins from other metazoans. SPR-4 is most similar to members of the REST family of transcriptional repressors (Fig. 5D) but it also has weaker similarity to other known transcriptional repressors, such as members of the CTCF/CCCTC-binding factor, suggesting that SPR-4, like SPR-3, may also function as a transcriptional repressor.
hop-1 transcription is regulated by spr-3 and
spr-4
As both SPR-3 and SPR-4 encode C2H2 zinc-finger
proteins that are probably nuclearly localized and might act as transcription
factors, we looked for possible targets regulated by spr-3 and
spr-4. Therefore, we probed northern blots prepared with mixed stage,
or staged, RNA from spr-3 and spr-4 mutants with several
genes involved in lin-12 or glp-1 signaling. No significant
differences in transcript levels were seen between any of the strains when we
probed with lin-12, glp-1, lag-1, apx-1 or sup-17 (data not
shown). Although we did not probe exhaustively, this suggested that
spr-3 and spr-4 might not have obvious effects on the
transcription of genes involved in the lin-12 and glp-1
pathways.
We then investigated whether spr-3 and spr-4 might bypass
the need for sel-12 by up-regulating one of the other presenilin
genes, spe-4 or hop-1. Results from mixed stage blots
suggested that hop-1 and spe-4 may be differentially
expressed (data not shown). Therefore, we then probed staged Northern blots.
Transcript levels of the three C. elegans presenilin genes in the
various developmental stages have not been reported previously. We find,
consistent with its only known role in spermatogenesis, that spe-4 is
only expressed in the L4 larval stage when hermaphrodites produce sperm
(Fig. 6A,C). sel-12 is
expressed strongly and uniformly throughout development
(Figs 6B,C), consistent with
the strong and ubiquitous expression of a sel-12::EGFP promoter
fusion (Baumeister et al.,
1997
). Surprisingly, hop-1 has a very dynamic expression.
It is most strongly expressed in the adult stage, more weakly in the embryo
and is almost undetectable in the L1 stage
(Figs 6A,C). hop-1
expression slowly increases through the remaining larval stages.
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
All Spr genes may function through the same mechanism
We provide evidence that the mechanism by which mutants of spr-3
and spr-4 suppress sel-12 loss-of-function alleles involves
de-repression of hop-1 transcription in those stages in which
hop-1 expression alone does not suffice. Similarly, we have shown
recently that SPR-1 and SPR-5 proteins interact, and that spr-5
upregulates hop-1 expression at the same developmental stages as
mutations in spr-3 and spr-4
(Eimer et al., 2002b
). This
suggests that spr-1, spr-3, spr-4 and spr-5 all suppress
sel-12 by upregulating hop-1, replacing one presenilin with
another. Similarly, mutations in spr-2 genetically bypass the need
for sel-12, but do not bypass the need for both sel-12 and
hop-1 (Wen et al.,
2000
). Although hop-1 activity is required for the
suppression mechanism, Wen et al. did not find evidence for hop-1
transcriptional de-repression (Wen et al.,
2000
). However, the stage specific de-repression of hop-1
transcription we have seen would not be detectable on a mixed-stage northern
blot. Thus, we propose that spr-2 may also bypass the need for
sel-12 by the same mechanism as spr-3, spr-4 and
spr-5.
Upregulation of hop-1 transcription in the early larval
stages can explain the suppression of sel-12 by spr-3 and
spr-4
Mutations in spr-3 and spr-4 clearly de-repress the
transcription of hop-1 in the early larval stages. However, even in
the suppressor strains, the absolute hop-1 transcript levels in the
early larval stages are still much lower than in the adult stage. We believe
that the stage-specific increase in hop-1 expression is sufficient to
explain why spr-3 and spr-4 suppress sel-12. Even
in a strong, putative null sel-12 mutant, there is sufficient HOP-1
protein in the larval stages to enable most lin-12-dependent
developmental decisions to occur correctly. In sel-12 mutants, the
ventral uterine/anchor cell decision, lateral inhibition in the vulval
precursors and the sex myoblast/coelomocyte decision are not affected
(Levitan and Greenwald, 1995
),
indicating that there is sufficient presenilin activity, provided by HOP-1,
present in many cell types. In sel-12(ar131) even the
cell fate
is executed correctly in the vast majority of animals and in
sel-12(ar171) it is executed correctly in some animals, while in a
sel-12 hop-1 double mutants, 100% of animals have a defective vulval
uterine connection (Cinar et al.,
2001
; Eimer et al.,
2002a
). This indicates that in sel-12 mutants the
expression of hop-1 is almost sufficient for wild-type
cell
induction. Therefore, it is likely that small increases in hop-1
expression could be sufficient to compensate completely for the loss of
sel-12 in all developmental decisions.
There are also reasons to believe that small amounts of presenilin message
may be sufficient to provide adequate levels of presenilin activity.
Presenilins are normally found as part of a high molecular weight complex
(Capell et al., 1998
;
Li et al., 2000
;
Thinakaran et al., 1998
;
Yu et al., 1998
). This complex
is assembled in the ER and Golgi, and proteins that are not incorporated into
this complex are not targeted to the cell membrane and are rapidly degraded
(Ratovitski et al., 1997
).
Presenilins may be required in small amounts because the amount of other
components of the complex are limiting for assembly
(Edbauer et al., 2002
).
Consequently, it has been found that, in cell culture, presenilins cannot be
overproduced (Thinakaran et al.,
1996
). Furthermore, as the presenilin complex is thought to have
enzymatic activity, the levels of the complex necessary for its biochemical
function may normally be in vast excess of what is required. Thus, even if the
amount of the complex present at the cell membrane in spr; sel-12
double mutants should be slightly lower than the wild-type levels, the
wild-type phenotype of the double mutants indicates that it suffices to ensure
sufficient levels of lin-12 signaling.
Is the increased expression of hop-1 in the early larval stages
seen in spr-3 and spr-4 mutants sufficient to rescue the
later larval defects seen in sel-12 mutants? We have several reasons
to believe this is the case. First, the cell signaling events that lead to the
cell induction and the correct alignment of the sex muscles, occur prior
to the developmental changes (Cinar et al.,
2001
; Eimer et al.,
2002a
) and presenilin activity is presumably required at the time
of signaling. Second, our initial experiments suggested that the relative
expression of hop-1 is increased in the L1, L2 and L3 stages in both
spr-3 and spr-4 mutants. We chose to pursue this further at
the L1 stage because we thought the upregulation of hop-1 expression
might be most obvious at this stage. Furthermore, it has been demonstrated in
cell culture that, once assembled, the high molecular weight presenilin
complex is very stable over a long time period
(Edbauer et al., 2002
;
Ratovitski et al., 1997
).
Finally, we have indications that the presenilin complex is necessary in small
amounts and can persist for up to 24 hours in C. elegans because we
see rescue of sex myoblast/coelomocyte cell-fate decision in
hop-1;sel-12 double mutants with maternally provided hop-1
(Eimer et al., 2002a
). Thus,
presenilin protein produced in the embryo is sufficiently stable and produced
in sufficient amounts for a cell fate decision occurring in the L2 stage.
Do spr-3 and spr-4 perform a conserved
function?
Although SPR-3 and SPR-4 do not have clear mammalian homologs, they may be
performing a similar function to known transcriptional repressors. Both SPR-3
and SPR-4 resemble known transcriptional repressors, especially REST/NRSF (Re1
silencing transcription factor/neural-restrictive silencing factor) in
different vertebrates. The C2H2 zinc-finger factor REST
mediates repression of neuronal genes in non-neuronal cells, by recruiting the
co-repressor complexes Sin3 and CoREST
(Humphrey et al., 2001
). Both
of these co-repressor complexes contain multiple proteins, including histone
deacetylases, and presumably repress transcription in part by removing
activating acetyl groups from histones H3 and H4 at the target locus. It is
possible that SPR-3 and SPR-4 may also function by recruiting conserved
co-repressor complexes to the hop-1 locus. Three other Spr genes,
spr-1, spr-2 and spr-5, encode proteins similar to
components of known co-repressors (Eimer
et al., 2002b
; Jarriault and
Greenwald, 2002
; Wen et al.,
2000
). SPR-2 is a member of the Nucleosome Assembly Protein (NAP)
family and is most similar to the human oncogene SET
(Wen et al., 2000
). Human SET
was purified as part of the INHAT (inhibitor of acetyltransferases)
co-repressor complex, which helps to repress transcription by binding to
histones and masking them from being acetyltransferase substrates for p300/CBP
and PCAF (Seo et al., 2001
).
Recently, it has been shown that upregulation of SET also inhibits
demethylation of methylated DNA and may integrate the epigenetic states of DNA
and associated histones (Cervoni et al.,
2002
). In another paper, we have reported the identification and
characterization of SPR-5 that encodes a polyamine oxidase-like protein most
similar to a known component of the CoREST co-repressor complex
(Eimer et al., 2002b
). The
core CoREST complex contains only six proteins
(Hakimi et al., 2002
).
spr-1 encodes a homolog of the MYB domain-containing protein CoREST
(Eimer et al., 2002b
;
Jarriault and Greenwald,
2002
), an additional component of the CoREST co-repressor complex.
We have shown that SPR-1 and SPR-5 interact biochemically in vitro and in vivo
(Eimer et al., 2002b
). This
suggests that a similar complex is present in C. elegans and
functions to repress hop-1 transcription. Interestingly, CoREST has
been found to associate with at least two large, basic
C2H2 zinc-finger proteins, ZNF217 and REST
(You et al., 2001
), and may be
a general co-repressor complex that is recruited to different loci in
different cell types by binding to a different C2H2
zinc-finger proteins. Recent work also suggests that CoREST may interact with
components of the SWI-SNF complex
(Battaglioli et al., 2002
) and
may be involved in silencing of chromosomal regions
(Lunyak et al., 2002
).
The proteins encoded by the Spr genes may form one or more
transcriptional repressor complexes
Thus, SPR-3 and SPR-4 may recruit one or more conserved co-repressor
complexes, including one similar to the CoREST co-repressor complex, to target
loci. We propose the following model for how the Spr genes are functioning.
The fact that loss of function mutations in either spr-3 or
spr-4 suppress sel-12 and de-repress hop-1
transcription, suggest that both SPR-3 and SPR-4 are normally recruited to the
hop-1 locus. There they associate with co-repressor proteins similar
to members of the INHAT and CoREST co-repressor complexes. It is unclear if
the two zinc-finger proteins co-operatively bind the co-repressor proteins, or
if each zinc-finger protein associates with a different complex. The assembled
complex (or complexes), probably acts as a basal repressor of hop-1
transcription that is overridden in later developmental stages.
The mammalian INHAT and CoREST complexes were purified and studied by biochemical approaches. However, as yet little is known about their biological function. The data now available on Spr gene function suggest that INHAT and CoREST complexes can be studied both genetically and biochemically in C. elegans. We suggest that through C. elegans genetics we may identify additional genes that interact with these complexes and we may help to elucidate their biological function.
| ACKNOWLEDGMENTS |
|---|
e
for advice on RNA isolation and northern analysis; Jonathan Hodgkin and Iva
Greenwald for strains; Yuji Kohara for cDNA clones; Bob Barstead for a cDNA
library; and Alan Coulson for cosmid clones. Some strains used in this work
were provided by the Caenorhabditis Genetics Center, which is funded
by the National Center for Research Resources of the NIH. This work was
supported by an EMBO fellowship to B.L. and by grants from the DFG, EC
(DIADEM) and BMBF (NGFN) to R.B. | Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Anderson, P. (1995). Mutagenesis. InCaenorhabditis elegans: Modern Biological Analysis of an Organism (Methods in Cell Biology) (ed. H. F. Epstein and D. C. Shakes), pp. 31-58. San Diego: Academic Press.
Arduengo, P. M., Appleberry, O. K., Chuang, P. and L'Hernault, S. W. (1998). The presenilin protein family member SPE-4 localizes to an ER/Golgi derived organelle and is required for proper cytoplasmic partitioning during Caenorhabditis elegans spermatogenesis. J. Cell Sci. 111,3645 -3654.
Battaglioli, E., Andres, M. E., Rose, D. W., Chenoweth, J. G.,
Rosenfeld, M. G., Anderson, M. E. and Mandel, G. (2002). REST
repression of neuronal genes requires components of the hSWI.SNF complex.
J. Biol. Chem. 277,41038
-41045.
Baumeister, R., Leimer, U., Zweckbronner, I., Jakubek, C., Grunberg, J. and Haass, C. (1997). Human presenilin-1, but not familial Alzheimer's disease (FAD) mutants, facilitate Caenorhabditis elegans Notch signalling independently of proteolytic processing. Genes Funct. 1,149 -159.[Medline]
Blaxter, M. L., de Ley, P., Garey, J. R., Liu, L. X., Scheldeman, P., Vierstraete, A., Vanfleteren, J. R., Mackey, L. Y., Dorris, M., Frisse, L. M. et al. (1998). A molecular evolutionary framework for the phylum Nematoda. Nature 392, 71-75.[CrossRef][Medline]
Capell, A., Grunberg, J., Pesold, B., Diehlmann, A., Citron, M.,
Nixon, R., Beyreuther, K., Selkoe, D. J. and Haass, C.
(1998). The proteolytic fragments of the Alzheimer's
disease-associated presenilin-1 form heterodimers and occur as a 100-150-kDa
molecular mass complex. J. Biol. Chem.
273,3205
-3211.
Cervoni, N., Detich, N., Seo, S.-b., Chakravarti, D. and Szyf,
M. (2002). The oncoprotein Set/TAF-1ß, an inhibitor of
histone acetyltransferase, inhibits active demethylation of DNA, integrating
DNA methylation and transcriptional silencing. J. Biol.
Chem. 277,25026
-25031.
Church, G. M. and Gilbert, W. (1984). Genomic
sequencing. Proc. Natl. Acad. Sci. USA
81,1991
-1995.
Cinar, H. N., Sweet, K. L., Hosemann, K. E., Earley, K. and Newman, A. P. (2001). The SEL-12 presenilin mediates induction of the Caenorhabditis elegans uterine pi Cell Fate. Dev. Biol. 237,173 -182.[CrossRef][Medline]
De Strooper, B., Saftig, P., Craessaerts, K., Vanderstichele, H., Guhde, G., Annaert, W., von Figura, K. and van Leuven, F. (1998). Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein. Nature 391,387 -390.[CrossRef][Medline]
De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J. S., Schroeter, E. H., Schrijvers, V., Wolfe, M. S., Ray, W. J. et al. (1999). A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain. Nature 398,518 -522.[CrossRef][Medline]
Doyle, T. G., Wen, C. and Greenwald, I. (2000).
SEL-8, a nuclear protein required for LIN-12 and GLP-1 signaling in
Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA
97,7877
-7881.
Edbauer, D., Winkler, E., Haass, C. and Steiner, H.
(2002). Presenilin and nicastrin regulate each other and
determine amyloid betapeptide production via complex formation.
Proc. Natl. Acad. Sci. USA
99,8666
-8671.
Eimer, S., Donhauser, R. and Baumeister, R. (2002a). The Caenorhabditis elegans presenilin sel-12 is required for mesodermal patterning and muscle function. Dev. Biol. 251,178 -192.[CrossRef][Medline]
Eimer, S., Lakowski, B., Donhauser, R. and Baumeister, R. (2002b). Loss of spr-5 bypasses the requirement for the C. elegans presenilin sel-12 by derepressing hop-1.EMBO J. 21,5787 -5796.[CrossRef][Medline]
Fortini, M. E. (2001). Notch and presenilin: a proteolytic mechanism emerges. Curr. Opin. Cell Biol. 13,627 -634.[CrossRef][Medline]
Francis, R., McGrath, G., Zhang, J., Ruddy, D. A., Sym, M., Apfeld, J., Nicoll, M., Maxwell, M., Hai, B., Ellis, M. C. et al. (2002). aph-1 and pen-2 are required for Notch pathway signaling, gamma-secretase cleavage of ßAPP, and presenilin protein accumulation. Dev Cell 3, 85-97.[CrossRef][Medline]
Freyer, C., Lamar, E., Turbachova, I., Kintner, C. and Jones,
K. (2002). Mastermind mediates chromatin-specific
transcription and turnover of the Notch enhancer complex. Genes
Dev. 16,1397
-1411.
Gupta-Rossi, N., le Bail, O., Gonen, H., Brou, C., Logeat, F.,
Six, E., Ciechanover, A. and Israel, A. (2001). Functional
interaction between SEL-10, an F-box protein, and the nuclear form of
activated Notch1 receptor. J. Biol. Chem.
276,34371
-34378.
Hakimi, M.-A., Bochar, D. A., Chenoweth, J., Lane, W. S., Mandel, G