Fig. 2. The positional cloning of spr-3. (A) By three-factor mapping, spr-3 was mapped to the interval between dpy-23(e840) and lon-2, outside of the duplication mnDp32 (see Table S1 at http://dev.biologists.org/supplemental/) Note that spr-3 was previously mapped between dpy-3 and unc-2, close to unc-2 (Wen et al., 2000). (B) Rescue of spr-3. spr-3 was rescued by the cosmid F46H6 but not the partially overlapping cosmid C07A12, both shown by thick bars. The cosmid C07A12 extends further to the right. ORFs on F46H6 are named and indicated by lines with arrows. Two spr-3 alleles generated by UV/TMP mutagenesis are large rearrangements. byDf1 deletes 31 kb of the cosmid F46H6, while by136 is a complex rearrangement that affects the promoter of C07A12.5. By injecting a series of restriction fragments, subclones and PCR products (see thick bars below F46H6) the minimal rescuing region was narrowed down to a 4.1 kb fragment (using RB950 CAGTATACAACTACGCTCTCC and RB951 ATCCAACACTCCTAAGTCCG), which contains only the C07A12.5 open reading frame. The number of lines that were rescued is indicated on the right for each construct. (C) Northern blot with RNA from N2, sel-12(ar171) and 7 spr-3 alleles in a sel-12(ar171) background probed with a spr-3 cDNA. No message is detectable in strains harboring either of the two large rearrangements, byDf1 or spr-3(by136).

Return to article