|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00434
1 Division of Developmental Biology, Cincinnati Children's Research Foundation,
3333 Burnet Avenue, Cincinnati, Ohio 45229-3039, USA
2 Department of Biology, University of York, York YO10 5YW, UK
3 Department of Life Sciences, The University of Tokyo, 3-8-1 Komaba, Meguro-ku,
Tokyo 153-8902, Japan
* Author for correspondence (e-mail: heabq9{at}chmcc.org)
Accepted 6 February 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Xnr3, Nodal, Convergent extension, FRL1, FGF receptor, Xenopus laevis
| INTRODUCTION |
|---|
|
|
|---|
Convergent extension behaviour occurs in both ectodermal and mesodermal
cells at the same time as the neural folds and somites form. In mouse,
zebrafish and Xenopus the T box transcription factor
Brachyury is required for posterior mesoderm and axis formation
(Conlon et al., 1996
;
Halpern et al., 1993
;
Herrmann et al., 1990
;
Schulte-Merker et al., 1994
).
Xbra has been shown to activate the expression of Xwnt11 in the
Xenopus embryo (Tada and Smith,
2000
) and Wnt11 in turn regulates convergent extension movements
in both zebrafish and frogs (Heisenberg et
al., 2000
; Tada and Smith,
2000
). Fish mutants in Wnt11 and of the Wnt modulator
glypican 4, have convergent extension defects without having
cell-fate alterations (Heisenberg et al.,
2000
; Topczewski et al.,
2001
). Further components of the pathway(s) have been identified
in Xenopus by dominant negative and loss of function approaches, and
include Xfz7 (Medina et al.,
2000
), strabismus (Park and
Moon, 2002
), Daam1 (Habas et
al., 2001
), dapper (Cheyette et
al., 2002
) and dishevelled
(Sokol, 1996
;
Wallingford and Harland, 2001
;
Wallingford et al., 2000
).
Other components include N-terminal c-jun kinase
(Yamanaka et al., 2002
) and
the GTPase RhoA (Habas et al.,
2001
; Wunnenberg-Stapleton et
al., 1999
). More recent studies on the JAK/STAT pathway in fish
indicate that, rather than one convergent extension pathway, there may be two
pathways acting in parallel, STAT3 acting on axial mesodermal cells and Wnt11
in more lateral cells (Yamashita et al.,
2002
).
Here we show that Xnr3, a member of the nodal sub-class of TGFß
proteins, controls dorsal convergent extension by activating the maternal FGF
receptor FGFR1 and regulating Xbra expression in the organizer region
at the gastrula stage. Xnr3 was first identified in an expression screen for
gene products that rescue dorsal development in ventralized Xenopus
embryos (Smith et al., 1995
).
It differs from the other five nodal-related genes characterized in
Xenopus in several respects. Xnr3 is the only nodal that is
a direct target of the maternal Wnt/ß catenin pathway
(McKendry et al., 1997
). While
other Xnrs are potent axis inducers (Jones et al., 1995;
Joseph and Melton, 1997
;
Takahashi et al., 2000
),
ectopic expression of Xnr3 leads to the formation of finger-like protrusions
(Smith et al., 1995
).
Structurally, Xnr3 differs from the other Xnrs in lacking the last of the
seven conserved cysteines involved in intrachain disulphide bonds, and having
a serine instead of glycine located between the second and third cysteines
(Ezal et al., 2000
). No direct
tests have so far been carried out on Xnr3 function, but the fact that it was
shown to block the mesoderm-inducing activity of BMP4, suggested that it may
act by antagonizing BMP signaling (Hansen
et al., 1997
). A second possible function was suggested by the
finger-like protrusions seen in over-expression experiments and by studies
using Keller explants of the organizer region, which suggested that Xnr3 may
be required for convergent extension movements
(Kuhl et al., 2001
). The
activity of Xnr3 is strongly synergized by co-expression of Xwnt11
mRNA, which is also expressed in the organizer
(Kuhl et al., 2001
).
Xnr3 is expressed immediately at the mid-blastula transition (MBT) in the
dorsal equatorial zone of the blastula and expression becomes highly
restricted to the organizer region (Glinka
et al., 1996
; Smith et al.,
1995
). This region is responsible for regulating both cell fate
and cell movements during gastrulation and neurulation. We have studied the
role of Xnr3 using a loss-of-function approach by depleting Xnr3 activity
using a morpholino oligo. Xnr3 embryos failed to undergo
post-gastrulation dorsal convergent extension movements resulting in embryos
with curved axes and split neural folds. The organizer region of
Xnr3 embryos showed a failure of convergent extension
movements that was rescued by non-complementary Xnr3 mRNA. The dorsal
mesodermal segment of Xbra expression was missing in
Xnr3 embryos at the mid-gastrula stage, and was also missing
along the dorsal midline at the neurula stage.
Ectopic over-expression of Xnr3 mRNA in isolated animal caps caused a reciprocal effect; the expression of Xbra, eFGF, NCAM and MyoD and convergent extension movements. We show that the FGF receptor FGFR1 is required for Xnr3-induced elongation movements and expression of Xbra and NCAM, since these effects were inhibited by the antisense depletion of maternal FGFR1 mRNA in animal caps and whole embryos. Furthermore, Xnr3 ectopic expression in animal caps activates MAP kinase, as evidenced by the appearance of phosphorylated ERK protein, showing that Xnr3 activates the FGF signaling pathway. Finally we demonstrate the synergistic interactions of Xnr3 with the FGFR binding EGF-CFC protein, FRL1 and with the cleavage mutant form of Xnr2, cmXnr2. These findings demonstrate the essential role that Xnr3 plays in gastrulation and neurulation, outline the pathway whereby Xnr3 acts and suggest a novel role for nodal family members; that of regulating cell movements through the FGF receptor.
| MATERIALS AND METHODS |
|---|
|
|
|---|
For depletion of FGFR1 mRNA, full-grown oocytes were manually
defolliculated and cultured in oocyte culture medium (OCM), as described by
Xanthos et al. (Xanthos et al.,
2002
). Oocytes were injected at the vegetal pole with oligos using
a Medical Systems picoinjector, in OCM and cultured for a total of 48 hours at
18°C before fertilization. In preparation for fertilization, oocytes were
stimulated to mature by the addition of 2 µM progesterone to the OCM and
cultured for 12 hours. Oocytes were then colored with vital dyes and
fertilized using the host-transfer technique described previously
(Xanthos et al., 2002
). Three
hours after being placed in the frog's body cavity, the eggs were stripped and
fertilized along with host eggs using a sperm suspension.
For animal cap assays and Keller explants, embryos were dissected specifically at the late blastula stage using tungsten needles, and maintained in culture on agar in OCM at 18°C. Basic FGF (RD systems; 40 pg/ml) and human activin A (RD systems; 2 pg/ml) were added to the culture medium to treat animal caps during the culture period.
The effects of the morpholino oligo on Keller explants were classified as
follows. Class 1: no constriction and no elongation. Class 2: constriction but
no significant elongation. Class 3: constriction and elongation. This
classification was previously described
(Tada and Smith, 2000
).
Oligos and mRNAs
A 25mer morpholino oligo (Gene Tools LLC, Philomath, OR) with the following
sequence was designed against the Xnr3 5'UTR: 5'
GTCTGAACAAGAAGCATCTCCTCAGTTGG 3', and the sequence of control oligo with
4 bases altered was: 5' TCaCTcGGTAGATTTGTGGaGAgTC 3'.
The MO against eFGF has been described previously and was: 5' ATGGAACAGTCATCCCGATCAAC 3'.
The sequence of the antisense oligo complementary to FGFR1 receptor was
5' G*G*A*CGGTTCGGTTTG*G*A*G 3'
where * indicates a phosphorothioate bond; it was HPLC purified before use (Genosys/Sigma). Oligos were resuspended in sterile, filtered water and injected at 3 or 4 ng into the equatorial region of oocytes. Oocytes were cultured immediately at 18°C.
Capped mRNAs were synthesized using the mMassage mMachine kit (Ambion, Austin, TX), then resuspended in sterile water. Xnr3 ORF was constructed by the overlapping PCR method using the following primers: forward 5' TCGAGGATCCCCAGAGATGGCATTTCTG 3'; reverse 5' TCGAATCGATTCGATTACATGTCCTTGAATCCACATTC 3'.
PCR product was amplified using the Advantage TM-HF PCR kit (BD Biosciences
Clontech, Circle Palo Alto, CA), digested with BamHI and
ClaI, and cloned into CS2+ vector. The template for ampification was
pdor3 (Smith et al., 1995
).
Xdd1 was constructed as described previously (D4)
(Rothbacher et al., 2000
).
Analysis of gene expression using real-time RT-PCR
Total RNA isolation, cDNA synthesis and real time RT-PCR analysis using a
LightCycler System (Roche Molecular Biochemicals, Basel, Switzland) were
performed as described previously (Xanthos
et al., 2002
). The PCR primer pairs and cycling conditions are
listed in Table 1. Ornithine
decarboxylase (ODC) was used as loading control, and relative expression
amounts were normalized to ODC. Each run had a reverse transcriptase minus
sample and a water blank as negative controls.
|
Immunoblotting
Oocytes or animal caps were lysed in phosphoprotein buffer (80 mM
ß-glycerophosphate pH 7.0, 20 mM EGTA, 15 mM MgCl2, 1 mM DTT,
1 mM PMSF, 1:50 protease inhibitor cocktail; Sigma) and cleared by
centrifugation at 15,000 g. The equivalents of 0.5 oocyte or 5
animal caps were loaded on 10% SDS-PAGE Ready Gels (BioRad) and transferred to
nitrocellulose. Membranes were blocked in 5% non-fat dry milk (Carnation) in
PBS, 0.1% Tween 20 and incubated in primary antibody diluted in the same
buffer. Detection was performed using the Super Signal West Pico system
(Pierce). Exposure times were approximately 1 minute. Antibodies and dilutions
used were anti-diphosphorylated ERK-1 and ERK-2 (1:4000, clone MAPK-YT, Sigma)
and anti-
-tubulin (1:10,000, clone DM1A, Sigma).
| RESULTS |
|---|
|
|
|---|
|
|
|
|
Since Xnr3 is restricted in its expression to a small segment of the gastrula, we reasoned that the analysis of total expression levels in the whole embryo might not reveal changes in gene expression resulting from Xnr3 depletion in this small area. To address this, we studied the expression pattern of chordin and gsc by whole-mount in situ hybridization of gastrulae and neurulae stages (Fig. 2C). chordin expression in Xnr3 and wild-type embryos was identical at the mid-gastrula stage, but was in a very different pattern by the early neurula stage (Fig. 2C). In Xnr3 embryos, chordin continued to be expressed around the dorsal rim of the blastopore, and to outline only a short notochord in the midline, while in wild-type sibling embryos the expression was found throughout the elongated notochord. Similarly, goosecoid expression remained adjacent to the blastopore at the early neurula stage, whereas in control embryos it marked the opposite, anterior pole of the embryo (Fig. 2C). These findings are consistent with the view that Xnr3 is required for convergent extension movements in the midline of the embryo.
Xnr3 is required for the expression of Xbra mRNA
specifically in the dorsal mid-line region of the mid-gastrula
The expression pattern of Xbra in Xnr3 embryos
at the late gastrula and neurula stages showed interesting changes compared to
wild-type embryos (Fig. 3A). At
the mid-gastrula stage, Xbra mRNA was expressed in an equatorial ring
around the blastopore of control embryos, but in Xnr3
embryos the dorsal segment of the ring showed reduced or absent expression of
Xbra at the mid-gastrula stage (arrow in
Fig. 3A). This was a highly
reproducible finding (in 14 of 17 cases examined). At the neurula stage,
Xbra was absent from the notochord of Xnr3 embryos
compared to controls (Fig. 3A
central panel bottom row).
|
The expression of a mRNA coding for a mutated form of the dishevelled
protein that lacks the PDZ domain (Xdsh-D4; also called Xdd1) has been shown
to cause a similar convergent extension phenotype to that of
Xnr3 embryos
(Wallingford and Harland,
2001
; Wallingford et al.,
2000
). We next asked whether expression of Xbra in
embryos over-expressing this dominant negative dishevelled mRNA was
disrupted in a similar fashion to that in Xnr3 embryos.
Fig. 3A shows that the dorsal
expression of Xbra occurred normally in these embryos at the gastrula
stage, but was lost in the midline at the neurula stage in these embryos.
Sibling Xdd1 over-expressing embryos went on to develop the
convergent extension defect described previously by others
(Wallingford and Harland,
2001
). This suggests that dishevelled is downstream of
Xbra in the dorsal convergent extension pathway. To confirm that
dishevelled lies downstream of Xnr3, we tested the ability of animal
caps over-expressing Xnr3 mRNA to elongate in the presence of Xdd1.
Fig. 3B shows that Xdd1
completely inhibits the ability of Xnr3-injected caps to elongate.
Furthermore, Xnr3 overexpressing animal caps, although blocked from elongating
by the presence of Xdd1, continue to express Xbra, MyoD and
NCAM (Fig. 3B),
indicating that dishevelled is downstream of Xbra in the convergent extension
pathway.
Next we carried out three tests of the specificity of the Xnr3 morpholino effect on dorsal Xbra expression. Firstly, we reasoned that, since Xnr3 is not expressed laterally or ventrally around the blastopore, injection of Xnr3 morpholino into the ventral side of embryos at the 4-cell stage should not affect the ventral and lateral expression of Xbra. Fig. 3C shows that, apart from causing a slight developmental delay, Xnr3 morpholino had little effect on the ventral and lateral expression of Xbra (3 of 15 cases showed reduced expression). Next, to show that the effect of dorsal Xnr3 morpholino injection was specific for the dorsal Xbra field, we confirmed that the expression pattern of chordin was normal in Xnr3 embryos (data not shown). Finally we showed that a control morpholino oligo, designed against the same region of Xnr3 but with a four base mismatch, also had no effect on the Xbra expression pattern when injected dorsally or ventrally at the 4-cell stage (data not shown).
These data show that Xnr3 is required to induce the dorsal segment of expression of Xbra mRNA at the gastrula stage, and for the maintenance of its expression in the midline at the neurula stage.
Over-expression of Xnr3 mRNA in animal caps causes a dose-dependent
stimulation of Xbra mRNA expression
Xnr3 mRNA has been reported to induce the expression of neural
markers without stimulating mesodermal gene expression in animal caps
(Hansen et al., 1997
;
Smith et al., 1995
). However,
in these experiments, Xnr3 mRNA was not tested over a large dose
range. Therefore we injected doses of 125 pg-1 ng of Xnr3 mRNA into
the animal region of wild-type embryos at the 2-cell stage and dissected
animal caps at the late blastula stage. Caps were frozen at sibling
mid-gastrula and tailbud stages and sibling caps were examined for elongation
movements at the tailbud stage. Increasing doses caused increasing convergent
extension movements in animal caps (Fig.
4A), and induced Xbra expression
(Fig. 4B). eFGF and
eomesodermin mRNA synthesis was also stimulated by Xnr3 expression,
and in caps incubated until the tailbud stage, NCAM and MyoD
expression was increased (Fig.
4B). In comparison, other mesodermal markers including
goosecoid, chordin and cerberus were not activated in animal
caps over-expressing these doses of Xnr3 mRNA (data not shown). This
is consistent with the view that Xnr3 regulates the expression of
specific mesodermal and neural genes.
|
In three experiments, co-expression of 500 pg XFD mRNA with 500 pg Xnr3 mRNA in animal caps prevented the convergent extension movements caused by the expression of 500 pg of Xnr3 mRNA alone (Fig. 5A,B) and prevented Xbra and eFGF expression at the early gastrula stage (Fig. 5C). Co-injection of XFD with Xnr3 mRNA also significantly reduced the expression of MyoD, but did not affect the expression of the neural marker NCAM (Fig. 5C). Injection of XFD alone caused no effect on either convergent extension or Xbra and NCAM expression (data not shown).
|
However, XFD inhibits the elongation of animal caps treated with activin,
as well as those treated with FGF (Fig.
5D), and therefore may be interfering with TGFß responses
through the activin receptor as well as responses through FGFR
(LaBonne and Whitman, 1994
).
To test whether FGF receptors, rather than activin receptors were required for
Xnr3 induced elongation and gene expression, we specifically depleted maternal
FGFR1 since this is the predominant FGF receptor at the early gastrula stage
(Amaya and Kirschner, 1991). We first demonstrated that an antisense,
phosphorothioate-modified, oligo complementary to FGFR1 depleted maternal
FGFR1 mRNA and protein in oocytes and early embryos, and that zygotic
FGFR1 was not expressed until the end of the gastrula stage (data not
shown). As a test of specificity, we showed that animal caps dissected from
FGFR1 late blastulae were unable to elongate in the presence
of basic FGF, and this defect was specifically rescued by the injection of 75
pg of synthetic FGFR1 mRNA at the 2-cell stage
(Fig. 6A).
|
In these experiments, sibling FGFR1 embryos to the animal caps developed with curved body axes and open neural folds (Fig. 6D), a phenotype that is similar to that of Xnr3 embryos (Fig. 1B). A notable difference, however, was that the heads of FGFR1 embryos were more normal than those of Xnr3 MO-injected embryos.
To find out whether FGFR1 is upstream or downstream of Xbra expression at the early gastrula stage, we examined the expression of Xbra in wild-type, FGFR1 embryos and FGFR1 embryos that were injected with FGFR1 mRNA. Fig. 6E shows that FGFR1 depletion prevents the expression of Xbra and this was rescued by the re-introduction of FGFR1 mRNA. In contrast, dorsal mesodermal markers such as chordin were little affected by FGFR1 depletion (Fig. 6E). This indicates that FGFR is upstream of Xbra at the early gastrula stage and that Xnr3 acts via the maternal FGFR1 receptor.
These data suggest that Xnr3 activates the MAP kinase signaling pathway. To confirm this we injected Xnr3 mRNA into animal poles of 2-cell-stage embryos, dissected animal caps at the late blastula stage and analysed the caps at the early gastrula stage for MAP kinase activity. Western blots were probed with an anti-phospho-ERK antibody. Fig. 6F shows the presence of phosophorylated ERK in animal caps expressing Xnr3 mRNA, but not in uninjected caps. As controls, non-matured and progesterone stimulated oocytes were included, as well as Xnr1 mRNA and eFGF mRNA animal caps. The doses of mRNA used were those that give robust convergent extension movements (500 pg Xnr3 and Xnr1, 5 pg eFGF). In comparison to Xnr3-induced activation of ERK, eFGF also produced a strong activation, and Xnr1 a weak activation.
Xnr3 activity does not require eFGF but synergizes with the FGFR
ligand FRL1
Xnr3 might activate FGFR1 in several ways.
Fig. 4B shows that Xnr3 causes
the transcription of the growth factor eFGF, which could act as an
intermediary between Xnr3 and the FGFR1. We tested this hypothesis by using a
morpholino oligo that we have shown previously depletes eFGF in a specific
fashion (Fisher et al., 2002
).
Fig. 7A shows that animal caps
depleted of eFGF were able to elongate in the presence of Xnr3 mRNA,
and to express Xbra at the gastrula stage. In fact they showed more
extensive elongation. Sibling eFGF-depleted embryos developed the expected
phenotype and showed reduction of MyoD expression as previously observed (data
not shown). This suggests that eFGF may not be a required intermediary in
Xnr3-induced convergent extension movements.
|
We tested whether FRL1 acted synergistically with Xnr3 in over-expression experiments. Fig. 7B shows that Xnr3 and FRL1 mRNA synergized in animal cap assays to cause excessive elongation. In embryo injection experiments, 500 pg of FRL1 or 50 pg of Xnr3 mRNA injected into 2 ventral cells at the 8-cell stage did not cause finger-like protrusions in whole embryos. Injection of 50 pg Xnr3 mRNA together with 500 pg FRL1 mRNA caused extensive protrusion formation. This data is consistent with the hypothesis that Xnr3 and FRL1 interact to activate the FGF receptor.
An Xnr2 cleavage mutant synergizes with Xnr3 to induce convergent
extension movements, Xbra and MyoD
An explanation for the different behaviour of Xnr3 from the other Xnrs may
be that the stability and/or activity of Xnr3 protein may depend upon the
prodomain, while activation of dorsal mesodermal genes by other Xnrs occurs by
the canonical mature protein ALK4/ActRII interaction. Support for this comes
from studies with a cleavage mutant form of Xnr2. Uncleaved cmXnr2 was shown
to be secreted and active in causing `attenuated mesodermal gene expression',
specifically the expression of Xbra in Xenopus early embryos
(Eimon and Harland, 2002
). We
tested whether cmXnr2 acted synergistically with Xnr3. We injected
Xnr3 mRNA into animal caps at the 4-cell stage, and then injected
cmXnr2 mRNA below the equator into vegetal cells at the 8-cell stage
(Fig. 7C). In this way, cmXnr2
could only interact with Xnr3 if it was secreted.
Fig. 7C shows that animal caps
taken from embryos exposed to secreted cmXnr2 as well as injected with
Xnr3 mRNA, elongated significantly more than caps injected with Xnr3
alone. This difference correlated well with a threefold increase in the
expression of Xbra in Xnr3+cmXnr2 caps compared with
Xnr3-overexpressing caps. There was little change in the basal level of dorsal
mesodermal genes in the Xnr3 +cmXnr2 caps, as expected from single injections
of cmXnr2 (into vegetal cells) or Xnr3. Secreted cmXnr2 did not cause neural
induction, and repressed Xnr3's ability to induce NCAM expression
(Fig. 7C).
This evidence is consistent with the hypothesis that cmXnr2 and Xnr3 act in a similar fashion, requiring the prodomain to activate the convergent extension pathway.
| DISCUSSION |
|---|
|
|
|---|
Xnr3 and convergent extension movement
Xnr3 clearly fulfills the description of a molecule that regulates
convergent extension movement. Over-expression in animal caps causes the
tissue to respond by narrowing along one axis and lengthening in a
perpendicular axis. It does this over the same time scale as neural convergent
extension occurs in whole embryos. Depletion of Xnr3 in embryos results in
dorsal axis curvature and open neural folds, and organizer explants fail to
elongate in culture. Convergent extension phenotypes have typically been
associated with defects in non-canonical Wnt signaling pathway components
(Sokol, 1996
;
Medina et al., 2000
;
Habas et al., 2001
;
Cheyette et al., 2002
). The
experiments presented here add the novel observation that Xnr3 is an essential
activator of this pathway. We show that Xnr3 lies upstream of the Wnt
signaling component, dishevelled, since Xdd1 expression in animal
caps blocks convergent extension movement caused by Xnr3 ectopic expression.
We confirm here that dishevelled is downstream of Xbra expression,
since Xbra is expressed normally in Xdd1 mRNA-injected
embryos. We also found that Xnr3-induced convergent extension movements in
animal caps were inhibited by a morpholino oligo against ß catenin,
suggesting that canonical Wnt pathway components may also be involved in
convergent extension movements (data not shown). One difference we see between
Xdd1 over-expression and Xnr3 loss-of-function phenotypes is in head
formation. Xnr3 embryos have reduced head structures, unlike
Xdd1-expressing embryos. This may be explained by additional effects either of
Xnr3 depletion or of Xdd1 expression, over and above their roles in convergent
extension. For example, Xdd1 may inhibit canonical Wnt signaling, which is
required for posteriorizing the nervous system, resulting in enlarged heads at
the expense of posterior tissue (Xanthos
et al., 2002
). Xnr3 may normally suppress BMP signaling by
heterodimerizing with BMP (Hansen et al.,
1997
); therefore its loss may lead to unapposed ventral signalling
causing a reduction in head formation.
Xnr3 and FGFR1
The direct evidence that Xnr3 induces convergent extension activity by
activating the tyrosine kinase FGF receptor FGFR1 is that FGFR1-depleted
animal caps over-expressing Xnr3 mRNA are unable to elongate, and
that Xnr3 over-expression in animal caps activates the MAP kinase
signaling pathway. The expression of Xbra throughout the embryo is
greatly delayed by the depletion of maternal FGFR1 mRNA and this is
partially rescued by reintroducing FGFR1 mRNA. In these depletion
analyses we found that zygotic FGFR1 was not expressed until the
neurula stage, which may explain why the depletion of only the maternal
FGFR1 component has such a dramatic effect on development (data not
shown). Although the dominant negative construct XFD also blocked Xnr3 induced
convergent extension movement, it has been shown and was confirmed here to
also block activin responsiveness.
The ability of animal caps to express Xbra but not dorsal markers such as gsc and chordin is often described as a `weak' mesodermal response. This work suggests an alternative scenario, that Xbra, in the organizer is not induced by `canonical' Xnr signaling but by signaling of the Xnr3 type through the FGF receptor. Two pieces of evidence support this idea. Firstly chordin and goosecoid continue to be expressed in FGFR1-depleted embryos, while Xbra is not, and secondly, animal caps depleted of FGFR1 maintain the ability to respond to activin, by elongating and expressing MyoD, while their ability to respond to Xnr3 is interrupted. This study raises the question of whether other Xnrs share the capacity of Xnr3 to activate FGFR.
However, the work presented here does not rule out a role for signaling
through activin receptors upstream or downstream of Xnr3 in convergent
extension movement. We do not yet have a satisfactory method to test this by
loss of function. Indeed we have shown previously that the correct level of
Xnr3 expression is dependent on the VegT/nodal signaling pathway as well as
being initiated by ß catenin/XTcf3
(Xanthos et al., 2002
). We do
not yet have a satisfactory method to test the role of activin receptors
specifically by loss of function in Xenopus.
Xnr3 has also been suggested to act predominantly as a BMP inhibitor, by
heterodimerizing with BMPs (Hansen et al.,
1997
). Although we have not tested this directly, it seems
unlikely that this explanation can account for Xnr3 function in convergent
extension, since other BMP inhibitors such as noggin and cmBMP7 do not cause
elongation when over-expressed in animal caps, nor do they cause Xbra
expression (data not shown). We find that inhibition of FGFR1 or XFD function
does not block the ability of Xnr3 to activate NCAM expression even
though it blocks convergent extension movements. This suggests that neural
induction and convergent extension are regulated separately by Xnr3.
How does Xnr3 activate the FGF receptor? The activity of an intermediary
such as eFGF seems unlikely since depletion of eFGF with a morpholino oligo
had no effect on Xbra expression or explant elongation. Another
interesting possibility is that Xnr3 activation of FGFR depends upon an
EGF-CFC protein that was first isolated as an FGFR binding protein, FRL1.
Over-expression of FRL1 mRNA causes elongation and NCAM and
MyoD expression in animal caps, as well as the formation of
finger-like protrusions in whole embryos
(Kinoshita et al., 1995
). We
show that Xnr3 and FRL1 synergize strongly in animal cap assays. Direct tests
of FRL1 function and of its possible interactions with nodal proteins are
required to determine its role.
A role for the prodomain of Xnrs in activating the convergent
extension pathway
TGFß precursors, consisting of a signal peptide, a large propeptide
and a shorter mature region, are covalently linked as homodimers in the N- and
C-terminal domains (Gentry et al.,
1988
). For some family members, the prodomain remains associated
after cleavage, and may be responsible for increasing the stability of the
mature peptide (Wakefield et al.,
1990
; Constam and Robertson,
1999
). A cleavage mutant form of Xnr2, cmXnr2 is secreted into the
culture medium of Xenopus oocytes, and has reduced mesoderm-inducing
properties compared to its mature form. It activated Xbra expression
in cells distant from the mRNA injection site
(Eimon and Harland, 2002
). We
show that cmXnr2 injected into sites distant from the animal cap
synergizes with Xnr3 secreted by the cells of the animal cap, in activating
Xbra expression and convergent extension activity. A cleavage mutant
form of Xnr3, cmXnr3 was shown to have the same biological activity as Xnr3
itself, suggesting that cleavage is not required for Xnr3 function
(Ezal et al., 2000
). These
observations raise the possibility that FGFR activation requires the
stabilization and/or activity of the prodomain of nodal proteins.
Orthologs of Xnr3 are not present in other vertebrate species. However, the
degree to which a nodal proprotein is cleaved into its mature, activin
receptor-stimulating form may be regulated in time and space by proprotein
convertases (Constam and Robertson,
1999
). Nodals may further be limited in their ability to activate
specific receptors by the availability of co-ligands or co-receptors such as
FRL1 and cripto (Yan et al.,
2002
). We show here that FGFR1 is the signal transducer for
convergent extension movements downstream of Xnr3. It will be important to
determine to what extent other nodal proteins share this property with
Xnr3.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Amaya, E., Musci, T. J. and Kirschner, M. W. (1991). Expression of a dominant negative mutant of the FGF receptor disrupts mesoderm formation in Xenopus embryos. Cell 66,257 -270.[CrossRef][Medline]
Casey, E. S., O'Reilly, M. A., Conlon, F. L. and Smith, J. C. (1998). The T-box transcription factor Brachyury regulates expression of eFGF through binding to a non-palindromic response element. Development 125,3887 -3894.[Abstract]
Cheyette, B. N., Waxman, J. S., Miller, J. R., Takemaru, K., Sheldahl, L. C., Khlebtsova, N., Fox, E. P., Earnest, T. and Moon, R. T. (2002). Dapper, a Dishevelled-associated antagonist of beta-catenin and JNK signaling, is required for notochord formation. Dev. Cell 2,449 -461.[CrossRef][Medline]
Christen, B. and Slack, J. M. (1999). Spatial response to fibroblast growth factor signalling in Xenopus embryos. Development 126,119 -125.[Abstract]
Conlon, F. L., Sedgwick, S. G., Weston, K. M. and Smith, J. C. (1996). Inhibition of Xbra transcription activation causes defects in mesodermal patterning and reveals autoregulation of Xbra in dorsal mesoderm. Development 122,2427 -2435.[Abstract]
Constam, D. and Robertson, E. (1999).
Regulation of bone morphogenetic protein activity by pro domains and proprotei
connvertases. J. Cell Biol.
144,139
-149.
Ding, J., Yang,L., Yan, Y., Chen, A., Desai, N., Wynshaw-Boris, A. and Shen, M. (1998). Cripto is required for correct orientation of the anterior-posterior axis in the mouse embryo. Nature 395,702 -707.[CrossRef][Medline]
Eimon, P. M. and Harland, R. (2002). Effects of
heterodimerization and proteolytic processing on Derriere and Nodal activity:
implications for mesoderm induction. Development
129,3089
-3103.
Ezal, C. H., Marion, C. D. and Smith, W. C.
(2000). Primary structure requirements for Xenopus nodal-related
3 and a comparison with regions required by Xenopus nodal-related 2.
J. Biol. Chem. 275,14124
-14131.
Fisher, M., Isaacs, H. and Pownall, M. (2002). eFGF is required for activation of XmyoD expression in the myogenic lineage of Xenopus laevis. Development 129,1307 -1315.
Gentry, L. E., Lioubin, M. N., Purchio, A. F. and Marquardt,
H. (1988). Molecular events in the processing of recombinant
type 1 pre-pro-transforming growth factor matur polypeptide. Mol.
Cell. Biol. 8,4162
-4168.
Glinka, A., Delius, H., Blumenstock, C. and Niehrs, C. (1996). Combinatorial signalling by Xwnt-11 and Xnr3 in the organizer epithelium. Mech. Dev. 60,221 -231.[CrossRef][Medline]
Gritsman, K., Zhang, J., Cheng, S., Heccckscher, E., Talbot, W. and Schier, A. (1999). The EGF-CFC protein one eyed pinhead is essential for nodal signaling. Cell 97,121 -132.[CrossRef][Medline]
Habas, R., Kato, Y. and He, X. (2001). Wnt/Frizzled activation of Rho regulates vertebrate gastrulation and requires a novel Formin homology protein Daam1. Cell 107,843 -854.[CrossRef][Medline]
Halpern, M. E., Ho, R. K., Walker, C. and Kimmel, C. B. (1993). Induction of muscle pioneers and floor plate is distinguished by the zebrafish no tail mutation. Cell 75, 99-111.[CrossRef][Medline]
Hansen, C. S., Marion, C. D., Steele, K., George, S. and Smith, W. C. (1997). Direct neural induction and selective inhibition of mesoderm and epidermis inducers by Xnr3. Development 124,483 -492.[Abstract]
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36,685 -695.[Medline]
Heasman, J., Crawford, A., Goldstone, K., Garner-Hamrick, P., Gumbiner, B., McCrea, P., Kintner, C., Noro, C. Y. and Wylie, C. (1994). Over-expression of cadherins and underexpression of beta-catenin inhibit dorsal mesoderm induction in early Xenopus embryos. Cell 79,791 -803.[CrossRef][Medline]
Heasman, J., Kofron, M. and Wylie, C. (2000). Beta-catenin signaling activity dissected in the early Xenopus embryo: a novel antisense approach. Dev. Biol. 222,124 -134.[CrossRef][Medline]
Heisenberg, C. P., Tada, M., Rauch, G. J., Saude, L., Concha, M. L., Geisler, R., Stemple, D. L., Smith, J. C. and Wilson, S. W. (2000). Silberblick/Wnt11 mediates convergent extension movements during zebrafish gastrulation. Nature 405, 76-81.[CrossRef][Medline]
Herrmann, B. G., Labeit, S., Poustka, A., King, T. R. and Lehrach, H. (1990). Cloning of the T gene required in mesoderm formation in the mouse. Nature 343,617 -622.[CrossRef][Medline]
Houston, D. W., Kofron, M., Resnik, E., Langland, R., Destree, O., Wylie, C. and Jones, C. M., Kuehn, M. R., Hogan, B. L., Smith, J. C. and Wright, C. V. (1995). Nodal-related signals induce axial mesoderm and dorsalize mesoderm during gastrulation. Development 121,3651 -3662.[Abstract]
Joseph, E. M. and Melton, D. A. (1997). Xnr4: a Xenopus nodal-related gene expressed in the Spemann organizer. Dev. Biol. 184,367 -372.[CrossRef][Medline]
Keller, R., Danilchik, M., Gimlich, R. and Shih, J. (1985). The function of convergent extension during gastrulation of Xenopus laevis. J. Embryol. Exp. Morphol. 89 Suppl.185 -209.
Kinoshita, N., Minshull, J. and Kirschner, M. W. (1995). The identification of two novel ligands of the FGF receptor by a yeast screening method and their activity in Xenopus development. Cell 83,621 -630.[CrossRef][Medline]
Kofron, M., Demel, T., Xanthos, J., Lohr, J., Sun, B., Sive, H., Osada, S., Wright, C., Wylie, C. and Heasman, J. (1999). Mesoderm induction in Xenopus is a zygotic event regulated by maternal VegT via TGFß growth factors. Development 126,5759 -5770.[Abstract]
Kuhl, M., Geis, K., Sheldahl, L. C., Pukrop, T., Moon, R. T. and Wedlich, D. (2001). Antagonistic regulation of convergent extension movements in Xenopus by Wnt/beta-catenin and Wnt/Ca2+ signaling. Mech. Dev. 106, 61-76.[CrossRef][Medline]
LaBonne, C. and Whitman, M. (1994). Mesoderm induction byactivin requires FGF-mediated intracellular signals. Development 120,463 -472.[Abstract]
Lamb, T. M. and Harland, R. M. (1995). Fibroblast growth factor is a direct neural inducer, which combined with noggin generates anterior/posterior neural pattern. Development 121,3627 -3636.[Abstract]
Latinkic, B. V., Umbhauer, M., Neal, K. A., Lerchner, W., Smith,
J. C. and Cunliffe, V. (1997). The Xenopus Brachyury
promoter is activated by FGF and low concentrations of activin and suppressed
by high concentrations of activin and by paired-type homeodomain proteins.
Genes Dev. 11,3265
-3276.
McKendry, R., Hsu, S. C., Harland, R. M. and Grosschedl, R. (1997). LEF-1/TCF proteins mediate wnt-inducible transcription from the Xenopus nodal-related 3 promoter. Dev. Biol. 192,420 -431.[CrossRef][Medline]
Medina, A., Reintsch, W. and Steinbeisser, H. (2000). Xenopus frizzled 7 can act in canonical and non-canonical Wnt signaling pathways: implications on early patterning and morphogenesis. Mech. Dev. 92,227 -237.[CrossRef][Medline]
Park, M. and Moon, R. T. (2002). The planar cell-polarity gene stbm regulates cell behaviour and cell fate in vertebrate embryos. Nat. Cell Biol. 4, 20-25.[CrossRef][Medline]
Rothbacher, U., Laurent, M. N., Deardorff, M., Klein, P., Cho, K. and Fraser, S. (2000) Dishevelled phosphorylation, subcellular localization and multimerization regulate its role in early embryogenesis. EMBO J. 19, 10-22.[CrossRef][Medline]
Rupp, R. A. and Weintraub, H. (1991) Ubiquitous MyoD transcription at the mid-blastula transition precedes induciton-dependent MyoD expression in presumptive mesoder of Xenopus laevis. Cell 65,927 -937.[CrossRef][Medline]
Schohl, A. and Fagotto, F. (2002).
Beta-catenin, MAPK and Smad signaling during early Xenopus development.
Development 129,37
-52.
Schulte-Merker, S., van Eeden, F. J., Halpern, M. E., Kimmel, C. B. and Nusslein-Volhard, C. (1994). no tail (ntl) is the zebrafish homologue of the mouse T (Brachyury) gene. Development 120,1009 -1015.[Abstract]
Shen, M. M. and Schier, A. F. (2000). The EGF-CFC gene family in vertebrate development. Trends Genet. 16,303 -309.[CrossRef][Medline]
Smith, W. C., McKendry, R., Ribisi, S., Jr and Harland, R. M. (1995). A nodal-related gene defines a physical and functional domain within the Spemann organizer. Cell 82, 37-46.[CrossRef][Medline]
Sokol, S. Y. (1996). Analysis of Dishevelled signalling pathways during Xenopus development. Curr. Biol. 6,1456 -1467.[CrossRef][Medline]
Sun, B. I., Bush, S. M., Collins-Racie, L. A., LaVallie, E. R., DiBlasio- Smith, E. A., Wolfman, N. M., McCoy, J. M. and Sive, H. L. (1999). derriere: a TGF-beta family member required for posterior development in Xenopus. Development 126,1467 -1482.[Abstract]
Tada, M. and Smith, J. C. (2000). Xwnt11 is a target of Xenopus Brachyury: regulation of gastrulation movements via Dishevelled, but not through the canonical Wnt pathway. Development 127,2227 -2238.[Abstract]
Takahashi, S., Yokota, C., Takano, K., Tanegashima, K., Onuma, Y., Goto, J. and Asashima, M. (2000). Two novel nodal-related genes initiate early inductive events in Xenopus Nieuwkoop center. Development 127,5319 -5329.[Abstract]
Topczewski, J., Sepich, D. S., Myers, D. C., Walker, C., Amores, A., Lele, Z., Hammerschmidt, M., Postlethwait, J. and Solnica-Krezel, L. (2001). The zebrafish glypican knypek controls cell polarity during gastrulation movements of convergent extension. Dev. Cell 1,251 -264.[CrossRef][Medline]
Wakefield, L. M., Smith, D. M., Flanders, K. C. and Sporn, M. B. (1990). Latent transforming growth factor beta from human platelets. A high molecular weight complex containing precursor sequences. J. Biol. Chem. 263,7646 -7654.
Wallingford, J. B. and Harland, R. M. (2001).
Xenopus Dishevelled signaling regulates both neural and mesodermal convergent
extension: parallel forces elongating the body axis.
Development 128,2581
-2592.
Wallingford, J. B., Rowning, B. A., Vogeli, K. M., Rothbacher, U., Fraser, S. E. and Harland, R. M. (2000). Dishevelled controls cell polarity during Xenopus gastrulation. Nature 405,81 -85.[CrossRef][Medline]
Wallingford, J. B., Fraser, S. E. and Harland, R. M. (2002). Convergent extension: the molecular control of polarized cell movement during embryonic development. Dev. Cell. 2, 695-706.[CrossRef][Medline]
Whitman, M. (2001). Nodal signaling in early vertebrate embryos; themes and variations. Dev. Cell 5, 605-617
Wunnenberg-Stapleton, K., Blitz, I. L., Hashimoto, C. and Cho, K. W. (1999). Involvement of the small GTPases XRhoA and XRnd1 in cell adhesion and head formation in early Xenopus development. Development 126,5339 -5351.[Abstract]
Xanthos, J. B., Kofron, M., Tao, Q., Schaible, K., Wylie, C.
and Heasman, J. (2002). The roles of three signaling
pathways in the formation and function of the Spemann Organizer.
Development 129,4027
-4043.
Yamanaka, H., Moriguchi, T., Masuyama, N., Kusakabe, M., Hanafusa, H., Takada, R., Takada, S. and Nishida, E. (2002). JNK functions in the non-canonical Wnt pathway to regulate convergent extension movements in vertebrates. EMBO Rep. 3,69 -75.[CrossRef][Medline]
Yamashita, S., Miyagi, C., Carmany-Rampey, A., Shimizu, T., Fujii, R., Schier, A. F. and Hirano, T. (2002). Stat3 Controls Cell Movements during Zebrafish Gastrulation. Dev. Cell 2,363 -375.[CrossRef][Medline]
Yan, Y., Liu, J., Luo, Y., Chaosu, E., Haltiwanger, R.,
Abate-Shen, C. and Shen, M. (2002). Dual roles of
cripto as a ligand and co-recptor in the nodal signaling pathway.
Mol. Cell. Biol. 22,4439
-4449.
Zhang, J., Talbot, W. and Schier, A. (1998). Positional cloning identifies zebrafish one-eyed pinhead as a permissive EGF-related ligand required during gastrulation. Cell 92,241 -251.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
H. Zhao, K. Tanegashima, H. Ro, and I. B. Dawid Lrig3 regulates neural crest formation in Xenopus by modulating Fgf and Wnt signaling pathways Development, April 1, 2008; 135(7): 1283 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Tahinci, C. A. Thorne, J. L. Franklin, A. Salic, K. M. Christian, L. A. Lee, R. J. Coffey, and E. Lee Lrp6 is required for convergent extension during Xenopus gastrulation Development, November 15, 2007; 134(22): 4095 - 4106. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bryja, D. Gradl, A. Schambony, E. Arenas, and G. Schulte beta-Arrestin is a necessary component of Wnt/beta-catenin signaling in vitro and in vivo PNAS, April 17, 2007; 104(16): 6690 - 6695. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Heasman Patterning the early Xenopus embryo. Development, April 1, 2006; 133(7): 1205 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chu, J. Ding, K. Jeays-Ward, S. M. Price, M. Placzek, and M. M. Shen Non-cell-autonomous role for Cripto in axial midline formation during vertebrate embryogenesis Development, December 15, 2005; 132(24): 5539 - 5551. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Tao, B. Lloyd, S. Lang, D. Houston, A. Zorn, and C. Wylie A novel G protein-coupled receptor, related to GPR4, is required for assembly of the cortical actin skeleton in early Xenopus embryos Development, June 15, 2005; 132(12): 2825 - 2836. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Bottcher and C. Niehrs Fibroblast Growth Factor Signaling during Early Vertebrate Development Endocr. Rev., February 1, 2005; 26(1): 63 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Birsoy, L. Berg, P. H. Williams, J. C. Smith, C. C. Wylie, J. L. Christian, and J. Heasman XPACE4 is a localized pro-protein convertase required for mesoderm induction and the cleavage of specific TGF{beta} proteins in Xenopus development Development, February 1, 2005; 132(3): 591 - 602. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kofron, H. Puck, H. Standley, C. Wylie, R. Old, M. Whitman, and J. Heasman New roles for FoxH1 in patterning the early embryo Development, October 15, 2004; 131(20): 5065 - 5078. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Aamar and D. Frank Xenopus Meis3 protein forms a hindbrain-inducing center by activating FGF/MAP kinase and PCP pathways Development, January 1, 2004; 131(1): 153 - 163. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||