|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00452
Department of Anatomy and Developmental Biology, University College London, Gower Street, London WC1E 6BT, UK
* Author for correspondence (e-mail: s.wilson{at}ucl.ac.uk)
Accepted 21 February 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Neurogenesis, bHLH transcription factor, floating head, Prepattern, Epiphysis, Zebrafish
| INTRODUCTION |
|---|
|
|
|---|
With respect to the genetic pathways underlying neurogenesis, the activity
of members of a subclass of basic helix loop helix (bHLH) transcription
factors is instrumental in most, and perhaps all, vertebrate neuronal lineages
(for a review, see Bertrand et al.,
2002
). These transcription factors are vertebrate homologues of
invertebrate proneural proteins, which in flies are both necessary and
sufficient for the commitment of ectodermal cells to a neural progenitor fate
(for reviews, see Campos-Ortega,
1993
; Modolell,
1997
). In vertebrates, neural bHLH transcription factor activity
is required at several discrete stages during the formation of neurones, and
both loss- and gain-of-function data support the notion that bHLH proteins can
function both in networks and in cascades in various neuronal lineages
(Ma et al., 1996
;
Kanekar et al., 1997
;
Fode et al., 1998
;
Ma et al., 1998
;
Perron et al., 1999
;
Cau et al., 2002
).
Although both the mechanisms by which neural cells acquire positional
identity and the genetic programmes underlying neurogenesis are beginning to
be deciphered, it is less clear how these two events are connected. For
example, how do patterning molecules that are expressed in discrete CNS areas
influence the expression and activity of bHLH transcription factors that are
common to many distinct areas of the brain? Furthermore, how is it that within
the CNS compartments that are defined by regional cues, it is only a subset of
cells that initiate expression of proneural genes? One current hypothesis is
that proteins conferring positional identity regulate the expression of so
called `prepattern genes', which in turn spatially restrict expression of
proneural bHLH transcription factors. Prepattern genes would thus be a link
between genes specifying pattern and genes regulating neurogenesis (for
reviews, see Ghysen and Dambly-Chaudiere,
1989
; Skeath and Carol, 1994;
Simpson, 1996
). In at least
some cases in flies, prepattern genes exhibit additional activities during the
specification of neuronal phenotypes. For instance, it is the prepattern genes
of the Iroquois complex, and not proneural genes, that are responsible for the
acquisition of lateral versus medial identity by mechanosensory bristles of
the notum (Grillenzoni et al.,
1998
).
Several vertebrate homologues of Drosophila prepattern genes have
been implicated in the regulation of neurogenesis
(Ishibashi et al., 1995
;
Bellefroid, 1998; Gomez-Skarmeta et al.,
1998
; Saito et al.,
1998
; Cau et al.,
2000
). However, even in cases where such upstream regulators have
been identified, it is not clear how much of their activity is mediated by
downstream proneural gene targets. To explore the relationship between CNS
patterning and neurogenesis, we studied the function of a potential vertebrate
prepattern protein: the homeodomain-containing transcription factor Flh
(Talbot et al., 1995
;
Masai et al., 1997
). Within
the CNS, flh expression is localised to the epithalamic region of the
dorsal diencephalon. The major nucleus within this region is the epiphysis or
pineal organ, a simple photoreceptive structure that has roles both in the
detection of light (Foster and Roberts,
1982
) and in the regulation of circadian rhythms (for a review,
see Natesan et al., 2002
). The
spatial restriction of flh expression to the prospective epiphysis is
tightly regulated by both Wnt and Bmp signals. For example, in the
masterblind (mbl) mutant, enhanced Wnt activity in the
neural plate leads to expansion of flh expression into regions of the
anterior forebrain that should normally form telencephalon
(Masai et al., 1997
;
Heisenberg et al., 2001
).
Similarly, reduced levels of Bmp activity in the swirl (swr)
mutant lead to expansion of flh expression into more lateral
ectodermal cells (Barth et al.,
1999
). Together, these studies have led to a simple model by which
the anterior and posterior limits of flh expression are determined by
thresholds of Wnt activity, and the dorsal and ventral limits are determined
by thresholds of Bmp activity. With respect to function, genetic studies have
shown that Flh is required to mediate epiphysial neurogenesis and to maintain
expression of the bHLH transcription factor Ash1a (Asha Zebrafish
Information Network) (Masai et al.,
1997
). Flh thus has the hallmarks of a vertebrate prepattern
gene.
In order to elucidate the pathways regulating epiphysial neurogenesis, we have investigated the regulation of three bHLH transcription factors, Ash1a, Ngn1 (Neurog1 Zebrafish Information Network) and NeuroD (Neurod Zebrafish Information Network), which are expressed in the epiphysis. We show that Flh is required to maintain the expression of ash1a and to initiate expression of ngn1 and neuroD. Using morpholino antisense oligonucleotides (MOs) (Nasevicius and Ekker, 2001) to impair Ash1a and Ngn1 activity, we demonstrate that these two bHLH proteins are essential regulators of epiphysial neurogenesis. Ash1a and Ngn1 show some degree of redundancy and function downstream of Flh but upstream of neuroD. By comparing the epiphysial phenotypes of flh mutants and ash1a/ngn1 morphants, we show that although the reduction in ash1a and ngn1 expression can account for most of the neurogenesis defects in the flh-mutant epiphysis, Flh is unlikely to function solely as a regulator of ash1a and of ngn1. We also show that impairment of Ash1a or Ash1a and Ngn1 activity affects both epiphysial photoreceptors and projection neurones, suggesting that these genes are not involved in the fate choice between these two neuronal cell types. Our results confirm that Flh functions as a prepattern gene, linking patterning to neurogenesis, and reveal a crucial role for two bHLH proteins, acting downstream of Flh, in the control of epiphysial neurogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Morpholino antisense oligonucleotides (MOs)
MOs (Gene Tools) were designed against ash1a (GenBank Accession
Number U14587) (Allende and Weinberg,
1994
) and ngn1 (GenBank Accession Number AF017301)
(Blader et al., 1997
):
MOs were diluted in Danieau's media
(Nasevicius and Ekker, 2000
)
and were routinely injected at the one- to four-cell stages at concentrations
of 2 mg/ml (ash1a MO) and 2.5 mg/ml
(ash1a5'UTR MO, ngn1
MO). The injection volume varied between 2 and 4 nl depending on the MO
injected. Injection of two MOs were performed either sequentially or by using
a mixture of the two MOs at their normal usage concentrations. Co-injection of
ash1a MO and
ash1a5'UTR MO was performed
either with ash1a MO at 1 mg/ml and
ash1a5'UTR MO at 1.25 mg/ml,
or with ash1a MO at 2 mg/ml and
ash1a5'UTR MO at 2.5 mg/ml.
Similar results were obtained in these two sets of experiments.
To control the specificity of ash1a MO, we generated two different constructs: ash1a::gfp and mutash1a::gfp. The ash1a::gfp construct contained part of the ash1a gene (from base 115 to 393), which included the ash1a target sequence (see above), fused in frame with the gfp coding sequence. The mutash1a::gfp construct was identical to ash1a::gfp except for four single base mutations inside of the ash1a MO target sequence (CCGATATGCAGATCACCGCCAAGAT). Embryos injected with RNA from either construct showed a bright green fluorescence owing to the expression of GFP (41 out of 45 embryos for ash1a::gfp and 38 out of 40 for mutash1a::gfp). The vast majority of embryos injected with both ash1a::gfp RNA and ash1a MO showed no fluorescence (41 out of 44 embryos). By contrast, most of the embryos injected with both mutash1a::gfp RNA and ash1a MO were fluorescent (37 out of 41).
RNA in situ hybridisation and immunohistochemistry
In situ hybridisation and immunohistochemistry were performed using
standard procedures (Masai et al.,
1997
). Details of the probes are available upon request. The opsin
antibody was a gift from P. Hargrave.
| RESULTS |
|---|
|
|
|---|
ash1a is expressed in the diencephalic territory, that includes
the presumptive epiphysis, as early as 6s
(Masai et al., 1997
) and
intense localised epiphysial expression is observed from 8s onwards
(Fig. 1A,D,G,J). Epiphysial
expression of ngn1 is detected from 12s onwards, with low levels of
transcripts in a few cells in the posterior part of the epiphysis
(Fig. 1B,E,H,K). ngn1
is thus expressed later and in a more restricted posterior domain of the
epiphysis than ash1a. neuroD is first expressed in a few epiphysial
cells at around 18s (Fig.
1C,F,I), the same stage as the appearance of the first
post-mitotic neurones (Masai et al.,
1997
) (data not shown). This is consistent with the observation
that neuroD is usually expressed in newly born neurones
(Lee et al., 1995
;
Cau et 1997
;
Korzh et al., 1998
; Mueller
and Wulliman, 2002a; Mueller and Wulliman, 2002b).
|
|
Ash1a and Ngn1 are required for the production of neurones in the
epiphysis
As ash1a and ngn1 are expressed early during epiphysial
neurogenesis, we speculated that they could have an important role during the
formation of neural progenitors in this structure. In order to test this
hypothesis, we used MOs to abrogate the activity of Ash1a or Ngn1 proteins, or
both.
Injection of an MO encompassing the start site of ash1a-coding sequence (ash1a MO) drastically impaired the expression of islet1 (isl1) in the dorsal hypothalamus and adenohypophysis (in 84.6% embryos, n=91; Fig. 3G-H), which are both sites of strong ash1a expression (data not shown). Neuronal production in regions that do not express ash1a, for example in the cranial ganglia, appeared to be unaffected (Fig. 3G-H; see Materials and Methods for further controls). To determine whether ash1a is important for the production of epiphysial neurones, we compared the expression of isl1 in the epiphysis of normal embryos and ash1a morphants, and counted the number of isl1-positive cells in a few representative embryos. Injection of ash1a MO led to a modest but reproducible reduction in the number of neurones produced in the epiphysis (Fig. 3A,B; Table 1). A second non-overlapping MO designed against the 5'UTR of ash1a (ash1a5'UTR MO) gave a similar phenotype (Fig. 3A-C), albeit at a lower frequency (54.7%, n=53). Co-injection of the two morpholinos (ash1a MO and ash1a5'UTR MO) gave a similar phenotype in 70% of the cases (n=77; Table 1; Fig. 3A-C,E).
|
|
The relatively mild phenotype observed in the epiphysis of ash1a morphants, and the absence of a detectable phenotype in the epiphysis of ngn1 morphants and mutants, led us to analyse the possibility of genetic compensation occurring between ash1a and ngn1.
We first analysed possible cross-regulation between ash1a and
ngn1. At 20s, ngn1 was expressed in
15 neuroepithelial
epiphysial cells in both wild-type and ash1a MO-injected embryos
(Fig. 3I,J). Likewise, at 17s,
ash1a was expressed in
10 neuroepithelial epiphysial cells in
both wild-type and ngn1 MO-injected embryos
(Fig. 3K,L). Indeed, we did not
detect any obvious difference in the expression of ash1a in
ngn1 MO-injected embryos at all stages examined (data not shown).
In contrast to the mild epiphysial phenotype in ash1a morphants, and to the absence of a detectable epiphysial phenotype in ngn1 morphants, reducing the activity of both Ash1a and Ngn1 strongly impaired neuronal differentiation. Eighty percent of the double MO-injected embryos (n=30) showed both the `ash1a phenotype' (impairment in the production of isl1-positive cells in the hypothalamus and the adenohypophysis) and the `ngn1 phenotype' (loss of cranial ganglia and primary sensory neurones). These embryos also exhibited severely reduced or absent epiphysial isl1 expression at 25s (Fig. 3A,F; Table 1). However, some isl1-positive cells are still produced in the pancreas and ventral neural tube of double morphant embryos. The double morphant phenotype is thus specific to restricted domains of the nervous system. In addition, we observed a similar phenotype in ngn1/ embryos injected with ash1a MO (six out of eight ngn1/ embryos; Table 1; data not shown).
Altogether, these results suggest that ash1a and ngn1 are expressed largely, or completely, independently of each other in the epiphysis and, together, play important and partially redundant functions during the production of neurones in this structure.
ash1a and ngn1 function downstream of flh but upstream of neuroD
To determine if epiphysial cells are still present when Ash1a and Ngn1
activities are reduced, we analysed flh expression in ash1a,
ngn1 and ash1a/ngn1 morphants. In all morphants, both the number
and the organisation of flh-postitive cells were similar to
non-injected embryos (Fig.
4A-D; Table 1).
|
Together, these data suggest that Ash1a and Ngn1 function downstream of flh but upstream of neuroD, which suggests that these bHLH proteins are not required for the establishment of an epiphysial territory but rather for the production of neurones within this territory.
Ash1a and Ngn1 are redundantly required for the expression of Delta
and otx5 genes
Ash and Ngn genes function as proneural (or neural determination) genes in
a number of neuronal lineages (Cau et al.,
1997
; Fode et al.,
1998
; Ma et al.,
1998
; Casarosa et al.,
1999
). However, in the murine olfactory epithelium, Mash1
(the closest known murine ash1a homologue; Ascl1
Mouse Genome Informatics) functions as a neural determination gene upstream of
Ngn1, which functions as a differentiation gene
(Cau et al., 1997
;
Cau et al., 2002
). To
investigate how ash1a and ngn1 function during neural
determination/differentiation in the epiphysis, we analysed how they regulate
the expression of potential regulators of neurogenesis.
In both fly and vertebrates, neurogenesis involves the selection of neural
progenitors through activation of the Notch signalling pathway. Neural
determination genes initiate this process through the activation of expression
of Delta genes that encode ligands for Notch receptors
(Kunisch et al., 1994
;
Fode et al., 1998
;
Ma et al., 1998
;
Casarosa et al., 1999
;
Cornell and Eisen, 2002
). We
therefore analysed the expression of zebrafish deltaA, deltaB and
deltaD genes (Haddon et al.,
1998a
) in the epiphysis of normal and MO-injected embryos.
In wild type, very weak expression of deltaA and deltaD
was detected in
20 epiphysial cells at 13-14s, with a few cells expressing
the genes more strongly (Fig.
5A,G). deltaA and deltaD expression was absent
at early stages in ash1a MO-injected embryos
(Fig. 5C,I), but by 23-24s a
few deltaA-positive and deltaD-positive cells were
detectable (Fig. 5K,S). By
contrast, expression of deltaA and deltaD remained absent in
most of the ash1a-positive, ngn1 MO-injected embryos
(Fig. 5M,U). Similarly, the
early expression of deltaB in bilateral clusters of one to two cells
was severely reduced or absent in 13-14s ash1a morphants
(Fig. 5D,F). By 23-24s, reduced
deltaB expression was detected in ash1a morphants, but
expression remained absent in ash1a/ngn1 double morphants
(Fig. 5N,O,Q).
|
The homeodomain transcription factor Otx5 is required for the expression of
several circadian genes by epiphysial cells
(Gamse et al., 2002
). To
compare the functions of Ash1a and Ngn1 further, we analysed the expression of
otx5 in wild-type and MO-injected embryos. By 22-24s, epiphysial
otx5 expression was reduced in ash1a morphants but
unaffected in ngn1-morphants (Fig.
6A-C). otx5 expression was further reduced or absent in
embryos injected with both ash1a and ngn1 MOs
(Fig. 6D).
|
Flh regulates aspects of epiphysial development independent of Ash1a
and Ngn1
Our data suggest that the defects in neurogenesis in
flh/ embryos can be explained by the loss of
activity of Ash1a and Ngn1 in the mutants. To address whether Flh is likely to
regulate other aspects of epiphysial development through pathways independent
of Ash1a and Ngn1, we compared regulation of epiphysial gene expression in
flh mutants and ash1a/ngn1 double morphants.
At 13-14s, the expression of deltaA and deltaD was very
severely reduced in the flh-mutant epiphysis, whereas the expression
of deltaB was normal (Fig.
5A,B,D,E,G,H). In addition, expression of otx5 was not
detected in the flh-mutant epiphysis at 24s
(Fig. 6A,E), nor before this
stage (data not shown). By contrast, some expression of otx5 was
observed in the epiphysis of flh mutants at later stages
(Gamse et al., 2002
) (E.C. and
S.W.W., unpublished).
ash1a is expressed normally in the flh-mutant epiphysis
until the 14s stage, and continues to be expressed later, albeit at reduced
levels (Fig. 2A-D)
(Masai et al., 1997
). If the
only function of Flh was to maintain or activate the expression of
ash1a and ngn1, we would have expected some initially normal
expression of otx5, deltaA and deltaD in flh
mutants. As this is not the case, it suggests that Flh could play a role in
the regulation of Delta genes and otx5, in addition to its role in
the maintenance of ash1a expression and the activation of
ngn1.
There are further differences between flh mutants and ash1a/ngn1 double morphants. flh expression is mainly independent of ash1a and ngn1 (Fig. 4A-D) whereas, by contrast, although flh expression is initiated normally in the flh mutant, it is greatly reduced by 24s (Fig. 6K-N) and absent by 24 hours (data not shown), which suggests that Flh regulates flh expression independently of Ash1a and Ngn1 activity.
The T-box transcription factor TbxC is proposed to be a potential effector
of Flh during notochord development (Dheen
et al., 1999
). Flh also functions upstream of tbxC
(tbx2c Zebrafish Information Network) in the epiphysis. At 24
hpf, the flh-mutant epiphysis contains around five to eight
tbxC-positive cells whereas the wild-type epiphysis contains
40
tbxC-positive cells (Fig.
6F,J). In addition, no tbxC expression is observed in the
flh-mutant epiphysis at the 14s stage (data not shown). By contrast,
impairment of ash1a and ngn1 function does not obviously
affect the expression of tbxC
(Fig. 6F-I). Altogether, these
results suggest a role for Flh in the regulation of otx5, deltaA, deltaD,
flh and tbxC that is independent of Ash1a and Ngn1 activity.
Reducing the activity of ash1a and ngn1 affects both projection
neurones and photoreceptors
Two different neuronal types have been described in the zebrafish epiphysis
(Masai et al., 1997
).
Projection neurones are laterally located cells that appear to express the
homeodomain transcription factor encoding gene onecut
(Masai et al., 1997
;
Hong et al., 2002
) (E.C. and
S.W.W., unpublished). Photoreceptors are medially located cells that express
the photoreceptive molecule Opsin (Masai
et al., 1997
). In order to determine whether one or both cell
types were affected by reduction of ash1a and ngn1 activity,
we analysed the expression of opsin and onecut in
morphants.
At 24 hours, onecut transcripts were detected in around three to four cells on each side of the epiphysis. This expression was strongly reduced in ash1a MO-injected embryos (Fig. 7A,B). At 30 hours, the lateral clusters of onecut expression have reached a size of four to five cells in wild type, whereas in ash1a MO-injected embryos the clusters contained only one to two onecut-positive cells (Fig. 7C,D). Injection of ngn1 MO impaired the expression of onecut in cranial ganglia but not in the epiphysis at all stages examined (Fig. 7C,E; data not shown). Double MO-injected embryos showed no onecut staining at 30 hours (Fig. 7F).
|
Reducing Ash1a or both Ash1a and Ngn1 activity affected both photoreceptors and projection neurones, which suggests that ash1a and ngn1 are not involved in the decision to make one versus the other cell type.
ash1a- and ngn1-dependent neurones have different locations along the
AP axis of the epiphysis
The results described above demonstrate the existence of two distinct
populations of neurones: one that depends only on the function of
ash1a, and one that depends on the redundant functions of
ash1a and ngn1. As these populations do not simply
correspond to the two main neuronal types produced in the epiphysis, we looked
at their distribution along the AP and DV axes of the epiphysial vesicle.
At 24 hours of development, the wild-type epiphysis contained 25-30
neurones, as judged by isl1 expression. By contrast, in
ash1a MO-injected embryos, only 15-20 neurones were produced in the
epiphysis (Fig. 8A,B,E,F).
These neurones will be referred to as the ash1a-independent lineage.
Although less neurones were present, the density of expression of
isl1 was normal in ash1a MO-injected embryos, but the group
of neurones was shorter along the AP axis of the vesicle. Moreover, the
ash1a-independent neurones were always located posteriorly in the
epiphysis, which is the domain in which ngn1 is expressed
(Fig. 8F and
Fig. 1K). Similarly, by 24 hpf,
about five to eight neurones were produced in the absence of flh
function (referred to as flh-independent lineage;
Fig. 8C,G) (Masai et al., 1997
). To
determine whether the flh-independent neurones require
ash1a, we injected ash1a MO into the progeny of crosses
between carriers of the flh mutation. flh-mutant embryos
that have reduced ash1a activity showed no epiphysial neurones as
judged by isl1 expression (Fig.
8D). This suggests that the flh-independent lineage is
dependent upon ash1a.
|
| DISCUSSION |
|---|
|
|
|---|
Flh functions as a prepattern gene
Prepattern genes are defined by their ability to link positional identity
to neurogenesis. Their expression is regulated by signals that establish
positional identity and their targets include neural determination genes
(Ghysen and Dambly-Chaudiere,
1989
; Skeath and Caroll, 1994;
Simpson, 1996
). flh
fulfils these criteria in that its expression is regulated by signalling
pathways that mediate positional identity within the nervous system
(Masai et al., 1997
;
Barth et al., 1999
;
Heisenberg et al., 2001
), and
its regulatory targets include genes encoding proneural bHLH proteins. Flh is
an essential upstream regulator of the neural determination gene
ngn1, and has a more complex role in the regulation of
ash1a; it is required for maintenance but not early induction of
expression.
In Drosophila, different prepattern genes regulate distinct
domains of expression of neural determination genes within a given organ (for
reviews, see Skeath and Caroll, 1994;
Simpson, 1996
) and can show
genetic redundancy (see Gomez-Skarmeta et al., 1996;
Sato et al., 1999
). By
analogy, one hypothesis is that an as yet unknown prepattern gene functions
redundantly with flh to regulate early ash1a expression.
Alternatively, Flh could have a role distinct to a prepattern function in the
maintenance of ash1a expression. Biphasic regulation of neural
determination genes has been reported previously. For example, initiation of
expression of Drosophila achaete in early medial and lateral column
neuroblasts requires a 3' element, whereas a 5' element mediates
later expression (Skeath et al.,
1994
). It is not clear whether different proteins bind to these
3' and 5' elements; however, the HMG box transcription factor
SoxNeuro is only required for the late expression and not the initiation of
achaete expression (Buescher et
al., 2002
). Thus, the role of Flh may be to maintain
ash1a expression while other proteins independently activate initial
transcription of this gene.
Ash1a and Ngn1 regulate the production of neurones in the
epiphysis
Our results demonstrate that Ash1a and Ngn1 regulate genes that are likely
to be important for the development of neurones in the epiphysis. First, Ash1a
and Ngn1 regulate the expression of three genes (deltaA, deltaB and
deltaD) that encode Notch receptor ligands. The Notch signalling
pathway mediates the selection of neural progenitors through the process of
lateral inhibition, by which cells inhibit their neighbours from adopting a
neuronal fate (see Lewis,
1998
). A preliminary analysis of the epiphysis in the
mindbomb mutant (mibta52b), in which lateral
inhibition is impaired (Jiang et al.,
1996
; Schier et al.,
1996
; Haddon et al.,
1998b
; Itoh et al.,
2003
), suggests that epiphysial neurones are produced prematurely
and in excess (E.C. and S.W.W., unpublished). These results suggest that the
Notch signalling pathway controls neuronal production in the epiphysis.
We have also implicated Ash1a and Ngn1 in the regulation of a third bHLH
protein encoding gene, neuroD. Our results corroborate observations
showing that Ash and Ngn genes function upstream of neuroD in other
species (Ma et al., 1996
;
Blader et al., 1997
;
Cau et al., 1997
;
Cau et al., 2002
;
Fode et al., 1998
;
Ma et al., 1998
). As
neuroD has been implicated in neuronal differentiation in a variety
of neural lineages (Miyata et al.,
1999
; Liu et al.,
2000
; Schwab et al.,
2000
; Kim et al.,
2001
), its absence is likely to contribute to the neurogenesis
defects observed in ash1a- and ash1a/ngn1-morphant
embryos.
ash1a and ngn1 are also required to activate
otx5 and onecut, genes that may function in the
specification and/or differentiation of photoreceptors and projection
neurones. Indeed, Otx5 is required to activate genes that show circadian
expression in epiphysial cells (Gamse et
al., 2002
). Drosophila onecut functions as a
differentiation gene during the formation of retinal photoreceptors
(Nguyen et al., 2000
); because
zebrafish onecut appears to be expressed specifically by projection
neurones, it may play a comparable role in the formation of these epiphysial
neurones.
Overall, our study shows that Ash1a and Ngn1 function downstream of Flh, and upstream of genes that mediate production and differentiation of neurones. However, although Ash1a and Ngn1 are crucial effectors of epiphysial development, our data suggest that aspects of epiphysial development are independent of these genes.
Flh regulates aspects of epiphysial development independent of ash1a
and ngn1
Although the neuronal deficits in flh mutants and
ash1a/ngn1-double morphants are similar, several lines of
evidence dispute a simple model in which Flh function is restricted to the
regulation of ash1a and ngn1 transcription
(Fig. 9). First, we have
demonstrated that flh is required for the induction of tbxC
and the maintenance of its own transcription. This function does not appear to
be shared with ash1a and ngn1 because a reduction of both
ash1a and ngn1 function did not affect the expression of
tbxC, whereas it did lead to a severe impairment of isl1
expression in the epiphysis. This suggests that expression of tbxC is
independent of Ash1a and Ngn1. An alternative interpretation is that residual
activity of these transcription factors in morphants is sufficient to induce
tbxC. We cannot completely exclude this a hypothesis but we think
that it is unlikely given the seemingly high efficacy of the MOs, and given
that it would imply that the levels of Ash1a and Ngn1 required to induce
tbxC are considerably lower than the levels required to induce
isl1.
|
Despite the fact that initial expression of ash1a was normal in the flh-mutant epiphysis, the activation of neuroD, deltaA and deltaD and otx5 expression was impaired. Therefore, Flh might have roles during epiphysial neurogenesis, additional to, and distinct from, the regulation of ash1a and ngn1 transcription. However, as Flh was not sufficient to initially activate otx5, neuroD, deltaA and deltaD expression in Ash1a/Ngn1 double morphants, it is unlikely that Flh and these bHLH proteins function in parallel pathways to regulate neurogenesis. Instead, Flh may regulate the activity of Ngn1 and/or Ash1a by other means, for example, by regulating the expression of a cofactor or an inhibitor of bHLH protein activity, or by influencing post-translational modification of the bHLH transcription factors.
Ash1a and Ngn1 function in parallel rather than in a cascade in the
epiphysis
ash1a and ngn1 function redundantly in the epiphysis to
regulate targets that include the Delta genes, otx5 and
onecut. The most likely interpretation of our results is that Ash1a
and Ngn1 function in parallel redundant pathways rather than in a cascade
during the formation of epiphysial neurones. This situation is in contrast to
that encountered in the murine olfactory epithelium. Indeed, in most olfactory
progenitors, Mash1 functions as a neural determination gene, upstream
of Ngn1, in a genetic cascade. In these progenitors Ngn1
bears the characteristics of a differentiation gene and is not involved in
regulating the expression of Notch ligands
(Cau et al., 1997
;
Cau et al., 2002
). However, in
a minority of olfactory progenitors Mash1 and Ngn1 do
function redundantly as neural determination genes
(Cau et al., 2002
), which is
similar to the situation encountered in epiphysial progenitors.
Distinct populations of neurones with different requirements for
Ash1a and for Ngn1 coexist in the epiphysis
Our study has revealed some unexpected diversity within the zebrafish
epiphysis as some early, anteriorly positioned neurones depend only on Ash1a
activity, whereas, in posterior cells, Ngn1 activity is able to compensate for
the lack of Ash1a activity. Although bHLH transcription factors can function
in the specification of distinct neuronal subpopulations (for a review, see
Bertrand et al., 2002
), these
two different populations of cells (Ash1a dependent, and Ash1a and Ngn1
dependent) do not correspond to the two neuronal populations described in the
zebrafish epiphysis (photoreceptors and projection neurones). Furthermore,
unpublished observations also suggest that ash1a and ngn1
are not involved in specifying the expression of different opsins by
epiphysial photoreceptors. Therefore, as yet, there is no indication that
ash1a and ngn1 have any involvement in the specification of
neuronal phenotype in the epiphysis.
Loss of Flh or reduction of Ash1a and Ngn1 activity affects both
photoreceptors and projection neurones
Absence of Flh, as well as impairment of Ash1a and Ngn1 function, affects
production of both epiphysial photoreceptors and projection neurones. Several
possibilities could explain these observations. First, flh, ash1a and
ngn1 could be required to specify a progenitor common to both
photoreceptors and projection neurones. Second, the genetic programme
involving flh, ash1a and ngn1 could function independently
in two distinct populations of progenitors, one for projection neurones and
one for photoreceptors. A third possibility is that generation of one class of
neurones is dependent upon the presence of the other. Such recruitment
mechanisms are implicated in the development of the Drosophila eye
(for a review, see Frankfort and Mardon,
2002
), chordotonal organs
(Lage et al., 1997
;
Okabe and Okano, 1997
;
zur Lage and Jarman, 1999
) and
olfactory sensillae (Reddy et al.,
1997
), and may also occur in the vertebrate eye
(Masai et al., 2000
; Neumann
et al., 2001). Analysis of lineage relationships between the various
epiphysial cell types should help resolve the nature of the cellular
interactions and proliferation patterns that generate discrete epiphysial
neurone classes.
In the vertebrate retina, removal of the function of specific bHLH
transcription factors impairs the development of specific cell types (for
reviews, see Vetter and Brown,
2001
; Marquardt and Gruss,
2002
). For instance, in both zebrafish and mouse, absence of Ath5
(Atoh7 Zebrafish Information Network and Mouse Genome Informatics)
specifically affects ganglion cells (Brown
et al., 2001
; Kay et al.,
2001
; Wang et al.,
2001
), whereas neuroD and Math3
(Neurod4 Mouse Genome Informatics) are required for formation
of amacrine cells (Morrow et al., 1999;
Inoue et al., 2002
), and
Mash1 and Math3 promote bipolar cell development
(Tomita et al., 2000
). Thus,
different populations of retinal neurones cells can be distinguished by their
requirement for different bHLH proteins. By contrast, in the epiphysis, both
projection neurones and photoreceptors are affected by reduction in the
activity of Ash1a and Ngn1. Thus, the genetic mechanisms that govern
neurogenesis in the two photoreceptive structures of the zebrafish embryo
appear to be quite divergent.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Allende, M. L. and Weinberg, E. S. (1994). The expression pattern of two zebrafish achaete-scute homolog (ash) genes is altered in the embryonic brain of the cyclops mutant. Dev. Biol. 166,509 -530.[CrossRef][Medline]
Andermann, P., Ungos, J. and Raible, D. W. (2002). Neurogenin1 defines zebrafish cranial sensory ganglia precursors. Dev. Biol. 251, 45-58.[CrossRef][Medline]
Barth, K. A., Kishimoto, Y., Rohr, K. B., Seydler, C., Schulte-Merker, S. and Wilson, S. W. (1999). Bmp activity establishes a gradient of positional information throughout the entire neural plate. Development 126,4977 -4987.[Abstract]
Bellefroid, E. J., Kobbe, A., Gruss, P., Pieler, T., Gurdon, J. B. and Papalopulu, N. (1998). Xiro3 encodes a Xenopus homolog of the Drosophila Iroquois genes and functions in neural specification. EMBO J. 17,191 -203.[CrossRef][Medline]
Bertrand, N., Castro, D. S. and Guillemot, F. (2002). Proneural genes and the specification of neural cell types. Nat. Rev. Neurosci. 7, 517-530.
Blader, P., Fischer, N., Gradwohl, G., Guillemont, F. and Strahle, U. (1997). The activity of neurogenin1 is controlled by local cues in the zebrafish embryo. Development 124,4557 -4569.[Abstract]
Brown, N. L., Patel, S., Brzezinski, J. and Glaser, T.
(2001). Math5 is required for retinal ganglion cell and optic
nerve formation. Development
128,2497
-2508.
Buescher, M., Hing, F. S. and Chia, W. (2002). Formation of neuroblasts in the embryonic central nervous system of Drosophila melanogaster is controlled by SoxNeuro. Development 129,4193 -4203.[Medline]
Campos-Ortega, J. A. (1993). Mechanisms of early neurogenesis in Drosophila melanogaster. J. Neurobiol. 10,1305 -1327.
Casarosa, S., Fode, C. and Guillemot, F. (1999). Mash1 regulates neurogenesis in the ventral telencephalon. Development 126,525 -534.[Abstract]
Cau, E., Gradwohl, G., Fode, C. and Guillemot, F. (1997). Mash1 activates a cascade of bHLH regulators in olfactory neuron progenitors. Development 124,1611 -1621.[Abstract]
Cau, E., Gradwohl, G., Casarosa, S., Kageyama, R. and Guillemot, F. (2000). Hes genes regulate sequential stages of neurogenesis in the olfactory epithelium. Development 127,2323 -2332.[Abstract]
Cau, E., Casarosa, S. and Guillemot, F. (2002). Mash1 and Ngn1 control distinct steps of determination and differentiation in olfactory sensory neuron progenitors Development 129,1871 -1880.[Medline]
Cornell, R. A. and Eisen, J. S. (2002).
Delta/Notch signaling promotes formation of zebrafish neural crest by
repressing Neurogenin 1 function. Development
129,2639
-2348.
Dheen, T., Sleptsova-Friedrich, I., Xu, Y., Clark, M., Lehrach, H., Gong, Z. and Korzh, V. (1999). Zebrafish tbx-c functions during formation of midline structures. Development 126,2703 -2713.[Abstract]
Fode, C., Gradwohl, G., Morin, X., Dierich, A., LeMeur, M., Goridis, C. and Guillemot, F. (1998). The bHLH protein NEUROGENIN 2 is a determination factor for epibranchial placode-derived sensory neurons. Neuron 20,483 -494.[CrossRef][Medline]
Foster, R. G. and Roberts, A. (1982). The pineal eye in Xenopus laevis embryos and larvae: a photoreceptor with a direct excitatory effect on behaviour. J. Comp. Physiol. 145,413 -419.[CrossRef]
Frankfort, B. J. and Mardon, G. (2002). R8 development in the Drosophila eye: a paradigm for neural selection and differentiation. Development 129,1295 -1306.[Medline]
Gamse, J. T., Shen, Y. C., Thisse, C., Thisse, B., Raymond, P. A., Halpern, M. E. and Liang, J. O. (2002). Otx5 regulates genes that show circadian expression in the zebrafish pineal complex. Nat. Genet. 30,117 -121.[CrossRef][Medline]
Ghysen, A. and Dambly-Chaudiere, C. (1989). Genesis of the Drosophila peripheral nervous system. Trends Genet. 5,251 -255.[CrossRef][Medline]
Golling, G., Amsterdam, A., Sun, Z., Antonelli, M., Maldonado, E., Chen, W., Burgess, S., Haldi, M., Artzt, K., Farrington, S. et al. (2002). Insertional mutagenesis in zebrafish rapidly identifies genes essential for early vertebrate development. Nat. Genet. 31,35 -40.
Gomez-Skarmeta, J. L. and Modolell, J. (1996).
araucan and caupolican provide a link between compartment subdivisions and
patterning of sensory organs and veins in the Drosophila wing.
Genes Dev. 10,2935
-2945.
Gomez-Skarmeta, J. L., Glavic, A., de la Calle-Mustienes, E., Modolell, J. and Mayor, R. (1998). Xiro, a Xenopus homolog of the Drosophila Iroquois complex genes, controls development at the neural plate. EMBO J. 17,181 -190.[CrossRef][Medline]
Grillenzoni, N., van Helden, J., Dambly-Chaudiere, C. and Ghysen, A. (1998). The iroquois complex controls the somatotopy of Drosophila notum mechanosensory projections. Development 125,3563 -3569.[Abstract]
Haddon, C., Smithers, L., Schneider-Maunoury, S., Coche, T., Henrique, D. and Lewis, J. (1998a). Multiple delta genes and lateral inhibition in zebrafish primary neurogenesis. Development 125,359 -370.[Abstract]
Haddon, C., Jiang, Y. J., Smithers, L. and Lewis, J. (1998b). Delta-Notch signalling and the patterning of sensory cell differentiation in the zebrafish ear: evidence from the mind bomb mutant. Development 125,4637 -4644.[Abstract]
Heisenberg, C. P., Houart, C., Take-Uchi, M., Rauch, G. J.,
Young, N., Coutinho, P., Masai, I., Caneparo, L., Concha, M. L., Geisler, R.
et al. (2001). A mutation in the Gsk3-binding domain of
zebrafish Masterblind/Axin1 leads to a fate transformation of telencephalon
and eyes to diencephalon. Genes Dev.
15,1427
-1434.
Hong, S. K., Kim, C. H., Yoo, K. W., Kim, H. S., Kudoh, T., Dawid, I. B. and Huh, T. L. (2002). Isolation and expression of a novel neuron-specific onecut homeobox gene in zebrafish. Mech. Dev. 112,199 -202.[CrossRef][Medline]
Houart, C., Caneparo, L., Heisenberg, C., Barth, K., Take-Uchi, M. and Wilson, S. (2002). Establishment of the telencephalon during gastrulation by local antagonism of Wnt signaling. Neuron 35,255 -265.[CrossRef][Medline]
Inoue, T., Hojo, M., Bessho, Y., Tano, Y., Lee, J. E. and Kageyama, R. (2002). Math3 and NeuroD regulate amacrine cell fate specification in the retina. Development 129,831 -842.[Medline]
Ishibashi, M., Ang, S. L., Shiota, K., Nakanishi, S., Kageyama,
R. and Guillemot, F. (1995). Targeted disruption of mammalian
hairy and Enhancer of split homolog-1 (HES-1) leads to up-regulation of neural
helix-loop-helix factors, premature neurogenesis, and severe neural tube
defects. Genes Dev. 9,3136
-3148.
Itoh, M., Kim, C. H., Palardy, G., Oda, T., Jiang, Y. J., Maust, D., Yeo, S. Y., Lorick, K., Wright, G. J., Ariza-McNaughton, L. et al. (2003). Mind bomb is a ubiquitin ligase that is essential for efficient activation of Notch signaling by Delta. Dev. Cell 4,67 -82.[CrossRef][Medline]
Jessell, T. M. (2000). Neuronal specification in the spinal cord: inductive signals and transcriptional codes. Nat. Rev. Genet. 1,20 -29.[CrossRef][Medline]
Jiang, Y. J., Brand, M., Heisenberg, C. P., Beuchle, D., Furutani-Seiki, M., Kelsh, R. N., Warga, R. M., Granato, M., Haffter, P., Hammerschmidt, M. et al. (1996). Mutations affecting neurogenesis and brain morphology in the zebrafish, Danio rerio. Development 123,205 -126.[Abstract]
Kanekar, S., Perron, M., Dorsky, R., Harris, W. A., Jan, L. Y., Jan, Y. N. and Vetter, M. L. (1997). Xath5 participates in a network of bHLH genes in the developing Xenopus retina. Neuron 9,981 -994.
Kay, J. N., Finger-Baier, K. C., Roeser, T., Staub, W. and Baier, H. (2001). Retinal ganglion cell genesis requires lakritz, a Zebrafish atonal Homolog. Neuron 30,725 -736.[CrossRef][Medline]
Kim, W. Y., Fritzsch, B., Serls, A., Bakel, L. A., Huang, E. J., Reichardt, L. F., Barth, D. S. and Lee, J. E. (2001). NeuroD-null mice are deaf due to a severe loss of the inner ear sensory neurons during development. Development 128, 17-26.[CrossRef]
Korzh, V., Sleptsova, I., Liao, J., He, J. and Gong, Z. (1998). Expression of zebrafish bHLH genes ngn1 and nrd defines distinct stages of neural differentiation. Dev. Dyn. 13, 92-104.
Kudoh, T., Wilson, S. W. and Dawid, I. B. (2002). Distinct roles for Fgf, Wnt and retinoic acid in posteriorizing the neural ectoderm. Development 129,4335 -4346.[Medline]
Kunisch, M., Haenlin, M. and Campos-Ortega, J. A.
(1994). Lateral inhibition mediated by the Drosophila neurogenic
gene delta is enhanced by proneural proteins. Proc. Natl. Acad.
Sci. USA 91,10139
-10143.
Lage, P., Jan, Y. N. and Jarman, A. P. (1997). Requirement for EGF receptor signalling in neural recruitment during formation of Drosophila chordotonal sense organ clusters. Curr. Biol. 7,166 -175.[CrossRef][Medline]
Lee, J. E., Hollenberg, S. M., Snider, L., Turner, D. L.,
Lipnick, N. and Weintraub, H. (1995). Conversion of Xenopus
ectoderm into neurons by NeuroD, a basic helix-loop-helix protein.
Science 268,836
-844.
Lewis, J. (1998). Notch signalling and the control of cell fate choices in vertebrates. Semin. Cell Dev. Biol. 9,583 -589.[CrossRef][Medline]
Liu, M., Pleasure, S. J., Collins, A. E., Noebels, J. L., Naya,
F. J., Tsai, M. J. and Lowenstein, D. H. (2000). Loss of
BETA2/NeuroD leads to malformation of the dentate gyrus and epilepsy.
Proc. Natl. Acad. Sci. USA
97,865
-870.
Ma, Q., Kintner, C. and Anderson, D. J. (1996). Identification of neurogenin, a vertebrate neuronal determination gene. Cell 87,43 -52.[CrossRef][Medline]
Ma, Q., Chen, Z., del Barco Barrantes, I., de la Pompa, J. L. and Anderson, D. J. (1998). neurogenin1 is essential for the determination of neuronal precursors for proximal cranial sensory ganglia. Neuron 20,469 -482.[CrossRef][Medline]
Marquardt, T. and Gruss, P. (2002). Generating neuronal diversity in the retina: one for nearly all. Trends Neurosci. 25,32 -38.[CrossRef][Medline]
Masai, I., Heisenberg, C. P., Barth, K. A., Macdonald, R., Adamek, S. and Wilson, S. W. (1997). floating head and masterblind regulate neuronal patterning in the roof of the forebrain. Neuron 18,43 -57.[CrossRef][Medline]
Masai, I., Stemple, D. L., Okamoto, H. and Wilson, S. W. (2000). Midline signals regulate retinal neurogenesis in zebrafish. Neuron 27,251 -263.[CrossRef][Medline]
Miyata, T., Maeda, T. and Lee, J. E. (1999).
NeuroD is required for differentiation of the granule cells in the cerebellum
and hippocampus. Genes Dev.
13,1647
-1652.
Modolell, J. (1997). Patterning of the adult peripheral nervous system of Drosophila. Perspect. Dev. Neurobiol. 4,285 -296.[Medline]
Morrow, E. M., Furukawa, T., Lee, J. E. and Cepko, C. L. (1997). NeuroD regulates multiple functions in the developing neural retina in rodent. Development 126, 23-36.
Mueller, T. and Wullimann, M. (2002a). BrdU-, neuroD (nrd)- and Hu-studies reveal unusual non-ventricular neurogenesis in the postembryonic zebrafish forebrain. Mech. Dev. 117,123 -135.[CrossRef][Medline]
Mueller, T. and Wullimann, M. F. (2002b). Expression domains of neuroD (nrd) in the early postembryonic zebrafish brain. Brain Res. Bull. 57,377 -379.[CrossRef][Medline]
Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene `knockdown' in zebrafish. Nat. Genet. 26,216 -220.[CrossRef][Medline]
Natesan, A., Geetha, L. and Zatz, M. (2002). Rhythm and soul in the avian pineal. Cell Tissue Res. 309, 35-45.[CrossRef][Medline]
Neumann, C. J. (2001). Pattern formation in the zebrafish retina. Semin. Cell Dev. Biol. 12,485 -490.[CrossRef][Medline]
Nguyen, D. N., Rohrbaugh, M. and Lai, Z. (2000). The Drosophila homolog of Onecut homeodomain proteins is a neural-specific transcriptional activator with a potential role in regulating neural differentiation. Mech. Dev. 97, 57-72.[CrossRef][Medline]
Okabe, M. and Okano, H. (1997). Two-step induction of chordotonal organ precursors in Drosophila embryogenesis. Development 124,1045 -1053.[Abstract]
Perron, M., Opdecamp, K., Butler, K., Harris, W. A. and
Bellefroid, E. J. (1999). X-ngnr-1 and Xath3 promote ectopic
expression of sensory neuron markers in the neurula ectoderm and have distinct
inducing properties in the retina. Proc. Natl. Acad. Sci.
USA 96,14996
-15001.
Reddy, G. V., Gupta, B., Ray, K. and Rodrigues, V. (1997). Development of the Drosophila olfactory sense organs utilizes cell-cell interactions as well as lineage. Development 124,703 -712.[Abstract]
Rhinn, M. and Brand, M. (2001). The midbrain-hindbrain boundary organizer. Curr. Opin. Neurobiol. 11,34 -42.[CrossRef][Medline]
Saito, T., Sawamoto, K., Okano, H., Anderson, D. J. and Mikoshiba, K. (1998). Mammalian BarH homologue is a potential regulator of neural bHLH genes. Dev. Biol. 199,216 -225.[CrossRef][Medline]
Sato, M., Kojima, T., Michiue, T. and Saigo, K. (1999). Bar homeobox genes are latitudinal prepattern genes in the developing Drosophila notum whose expression is regulated by the concerted functions of decapentaplegic and wingless. Development 126,1457 -1466.[Abstract]
Schier, A. F., Neuhauss, S. C., Harvey, M., Malicki, J., Solnica-Krezel, L., Stainier, D. Y., Zwartkruis, F., Abdelilah, S., Stemple, D. L., Rangini, Z. et al. (1996). Mutations affecting the development of the embryonic zebrafish brain. Development 123,165 -178.[Abstract]
Schwab, M. H., Bartholomae, A., Heimrich, B., Feldmeyer, D.,
Druffel-Augustin, S., Goebbels, S., Naya, F. J., Zhao, S., Frotscher, M.,
Tsai, M. J. and Nave, K. A. (2000). Neuronal basic
helix-loop-helix proteins (NEX and BETA2/Neuro D) regulate terminal granule
cell differentiation in the hippocampus. J. Neurosci.
20,3714
-3724.
Simpson, P. (1996). A prepattern for sensory organs. Drosophila development. Curr. Biol. 6, 948-950.[CrossRef][Medline]
Skeath, J. B. and Carroll, S. B. (1994). The achaete-scute complex: generation of cellular pattern and fate within the Drosophila nervous system. FASEB J. 10,714 -721.
Skeath, J. B., Panganiban, G. F. and Carroll, S. B. (1994). The ventral nervous system defective gene controls proneural gene expression at two distinct steps during neuroblast formation in Drosophila. Development 120,1517 -1524.[Abstract]
Stern, C. D. (2001). Initial patterning of the central nervous system: how many organizers? Nat. Rev. Neurosci. 2,92 -98.[CrossRef][Medline]
Talbot, W. S., Trevarrow, B., Halpern, M. E., Melby, A. E., Farr, G., Postlethwait, J. H., Jowett, T., Kimmel, C. B. and Kimelman, D. (1995). A homeobox gene essential for zebrafish notochord development. Nature 378,150 -157.[CrossRef][Medline]
Tomita, K., Moriyoshi, K., Nakanishi, S., Guillemot, F. and Kageyama, R. (2000). Mammalian achaete-scute and atonal homologs regulate neuronal versus glial fate determination in the central nervous system. EMBO J. 19,5460 -5472.[CrossRef][Medline]
Vetter, M. L. and Brown, N. L. (2001). The role of basic helix-loop-helix genes in vertebrate retinogenesis. Semin. Cell Dev. Biol. 6,491 -498.
Wang, S. W., Kim, B. S., Ding, K., Wang, H., Sun, D., Johnson,
R. L., Klein, W. H. and Gan, L. (2001). Requirement for math5
in the development of retinal ganglion cells. Genes
Dev. 15,24
-29.
Wilson, S. W. and Rubenstein, J. L. (2000). Induction and dorsoventral patterning of the telencephalon. Neuron 28,641 -651.[CrossRef][Medline]
zur Lage, P. and Jarman, A. P. (1999). Antagonism of EGFR and notch signalling in the reiterative recruitment of Drosophila adult chordotonal sense organ precursors.. Development 126,3149 -3157.[Abstract]
This article has been cited by other articles:
![]() |
E. Cau, A. Quillien, and P. Blader Notch resolves mixed neural identities in the zebrafish epiphysis Development, July 15, 2008; 135(14): 2391 - 2401. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Snelson, K. Santhakumar, M. E. Halpern, and J. T. Gamse Tbx2b is required for the development of the parapineal organ Development, May 1, 2008; 135(9): 1693 - 1702. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. V. Fausett, J. D. Gumerson, and D. Goldman The Proneural Basic Helix-Loop-Helix Gene Ascl1a Is Required for Retina Regeneration J. Neurosci., January 30, 2008; 28(5): 1109 - 1117. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Jeong, Z. Einhorn, S. Mercurio, S. Lee, B. Lau, M. Mione, S. W. Wilson, and S. Guo Neurogenin1 is a determinant of zebrafish basal forebrain dopaminergic neurons and is regulated by the conserved zinc finger protein Tof/Fezl PNAS, March 28, 2006; 103(13): 5143 - 5148. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-M. Pogoda, S. von der Hardt, W. Herzog, C. Kramer, H. Schwarz, and M. Hammerschmidt The proneural gene ascl1a is required for endocrine differentiation and cell survival in the zebrafish adenohypophysis Development, March 15, 2006; 133(6): 1079 - 1089. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Appelbaum, A. Anzulovich, R. Baler, and Y. Gothilf Homeobox-Clock Protein Interaction in Zebrafish: A SHARED MECHANISM FOR PINEAL-SPECIFIC AND CIRCADIAN GENE EXPRESSION J. Biol. Chem., March 25, 2005; 280(12): 11544 - 11551. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Geling, C. Plessy, S. Rastegar, U. Strahle, and L. Bally-Cuif Her5 acts as a prepattern factor that blocks neurogenin1 and coe2 expression upstream of Notch to inhibit neurogenesis at the midbrain-hindbrain boundary Development, May 1, 2004; 131(9): 1993 - 2006. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||