|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00500

GHHMI and Division of Biology, California Institute of Technology,
Pasadena, CA 91125, USA
* Present address: University of Illinois College of Law, Champaign, IL 61820,
USAG
Author for correspondence (e-mail:
pws{at}caltech.edu)
Accepted 17 March 2003
| SUMMARY |
|---|
|
|
|---|
Key words: C. elegans, lin-11, ldb-1, LIM homeodomain, Vulva, Differentiation
| INTRODUCTION |
|---|
|
|
|---|
|
The C. elegans genome encodes seven LIM homeodomain proteins
including LIN-11 (Ruvkun and Hobert,
1998
). LIN-11 has been shown to be necessary for the development
of a subset of vulval cells, uterine
lineage cells and some neurons
(Ferguson et al., 1987
;
Hobert et al., 1998
;
Newman et al., 1999
;
Sarafi-Reinach et al., 2001
;
Gupta and Sternberg, 2002
). In
this study, we show that the spatiotemporal expression of lin-11
confers distinct cell fates. Our experiments reveal at least two distinct
functions of lin-11 in vulval cells. lin-11 is first
required for setting up the correct pattern of vulval invagination. During
this phase, the precursors of vulC and vulD express high levels of
lin-11. Later on, lin-11 is expressed in all vulval progeny.
Using a conditional RNAi approach, we have examined lin-11 function
during vulval morphogenesis and demonstrate that lin-11 is required
in vulval progeny for wild-type patterning. Finally, we show that the
LIM-binding protein LDB-1 (Cassata et al.,
2000
) plays a role in vulval differentiation by directly
interacting with LIN-11.
| MATERIALS AND METHODS |
|---|
|
|
|---|
LGI: lin-11(n389) and lin-11(n566)
(Ferguson and Horvitz, 1985
),
and ayIs4[egl-17::GFP + dpy-20(+)]
(Burdine et al., 1998
)
LGII: syIs54[ceh-2::GFP + unc-119(+)]
LGIII: syIs80[lin-11::GFP + unc-119(+)]
(Gupta and Sternberg,
2002
)
LGIV: dpy-20(e1282) (Brenner,
1974
), syIs49[zmp-1::GFP + dpy-20(+)]
(Wang and Sternberg, 2000
)
LGV: nIs96[lin-11::GFP + lin-15(+)]
(Reddien et al., 2001
),
syIs53[lin-11::GFP + unc-119(+)]
(Gupta and Sternberg,
2002
)
LGX: syIs50[cdh-3::GFP + dpy-20(+)]
Other transgenic strains include syIs78[ajm-1::GFP +
unc-119(+)], syEx500[pPHS11.82(hs::lin-11) +
pTG96(sur-5::GFP)], syEx530- [pPHS11.82(hs::lin-11)
+ myo-2::GFP], syEx552[pPHS11.12(hs::lin-11) +
pPHS11.12i(hs::lin-11i) + myo-2::GFP + unc-119(+)],
syEx551[pLBP13.3c(ldb-1::GFP)] and
syEx565[unc-119(+) + pLBP13.3c(ldb-1::GFP)]. Stably
transmitting extrachromosomal array lines and integrants were generated by
standard techniques (Mello et al.,
1991
; Way et al.,
1991
).
Microscopy and laser ablations
Vulval cells and lineages were examined using Nomarski optics (see
Wood, 1988
). GFP
expression was examined using a Zeiss Axioplan microscope equipped with a GFP
filter HQ485LP (Chroma Technology), a power source (Optiquip 1500) and a 200 W
OSRAM Mercury bulb.
Laser ablations were performed as described by Avery and Horvitz
(Avery and Horvitz, 1987
).
Early- to mid-L3 stage worms were chosen for the study.
Heat-shock experiments
hs::lin-11 animals (syEx500 and syEx530) were
pulsed at different temperatures (between 30°C to 33.5°C) and duration
(15 minutes to 1 hour) during Pn.px and Pn.pxx stages. In general, stronger
pulses (1 hour at 31°C or 30 minutes at 33.5°C) caused growth arrest,
uncoordinated movement and larval lethality. These are probably the result of
interference with the function of other LIM homeobox genes
(Ruvkun and Hobert, 1998
).
Alternatively, high levels of lin-11 expression in neurons may
interfere with their normal development
(Hobert et al., 1998
;
Sarafi-Reinach et al., 2001
).
For the vulval phenotypes, we used a 20 minutes heat shock at 33°C.
lin-11 RNAi animals (hs-dslin-11i) were heat shocked during early Pn.pxxx stage for 1 hour at 33°C. After recovery at 20°C, vulval phenotypes were examined during mid-L4 stage.
Molecular biology
hs::lin-11 construct (pPHS11.82)
To construct pPHS11.82, a 1.5 kb NsiI-KpnI
lin-11 genomic fragment from the cosmid ZC247 was cloned into
pPD49.83 (Mello and Fire,
1995
). As the construction deleted 125 bp of the hsp16-41
promoter, it was restored as a NsiI fragment by PCR amplification of
the vector DNA using primers FBG3 (5'CGGCTCGTATGTT-GTGTGGAATTG3')
and BBG2 (5'CGCGATGCATGATGAGG-ATTTTCGAAGTTTTTTAG3'). The resulting
construct was digested with SphI and KpnI to obtain a 1.9 kb
DNA fragment. In a separate experiment, a 10.8 kb ZC247 NcoI fragment
was inserted in pPD49.83 to obtain pPHS11.108. pPHS11.108 was digested with
SphI and KpnI and subsequently ligated with the 1.9 kb
SphI-KpnI fragment to obtain pPHS11.82. The beginning and
end sequences (18 nucleotides) of the lin-11 genomic fragment are
5'-ATGCATTCTTCTTCTTCG-3' and
5'-CCATGGTTCCTATGAGGT-3'.
lin-11 RNAi constructs
To construct lin-11 RNAi plasmids, lin-11 cDNA (yk452f7;
kindly provided by Dr Yuji Kohara, National Institute of Genetics) was
separately cloned in sense (pPHS11.12) and antisense (pPHS11.12i) orientations
into pPD49.83 (see Gupta and Sternberg,
2002
).
ldb-1::GFP construct (pLBP13.3c)
The cosmid F58A3 was digested with SphI and PstI and a
13.3 kb fragment was subcloned into pPD95.73 (a gift of A. Fire, S. Xu, J.
Ahnn and G. Seydoux). The beginning and end sequences (18 nucleotides) of the
fragment are: 5'-GCATGC-TTTTTTTTAATT-3' and
5'-CTGCAGCTGTAGCTTTTT-3'.
ldb-1 RNAi construct (pYK66F4-1)
ldb-1 cDNA (yk66f4, kindly provided by Dr Yuji Kohara, National
Institute of Genetics) was digested with EcoRI and NotI and
a 720 bp fragment was subcloned in pBS-SK(+). In vitro RNA was synthesized
using the Ambion MEGAscript kit.
ldb-1 RNAi experiments
ldb-1 RNAi was performed by soaking
(Tabara et al., 1998
). An
equal amount of each RNA strand (20 µl) was mixed to generate dsRNA. For
control RNA, the pBS-SK(+) vector with no ldb-1 insert was used.
Worms were synchronized by 24 hours L1 starvation in M9 after bleach treatment
of the adult hermaphrodites. A small aliquot of the L1 stage worms was mixed
with dsRNA solution (5 to 20 µl) and 1-5 µl OP50 bacteria. Worms were
incubated for 30-36 hours, at which time they were washed twice with M9 and
transferred to regular plates seeded with OP50. L4 stage animals were examined
for the vulval phenotype and GFP expression.
Two-hybrid experiments
Two-hybrid experiments were performed as suggested by the manufacturer
(Clontech/BD Biosciences). pGBKT7 (GAL4 DNA binding) and pGADT7
(GAL4 activation) vectors were used to subclone lin-11 and
ldb-1 cDNA fragments, respectively. Positive control vectors were
pVA3 (murine p53 insert) and pTD1 (SV40 large T-antigen insert). To subclone
lin-11 LIM domains, a 682 bp product was PCR amplified using primers
lin-11-LIM-u1 (5'GGCATATGACCTCACTGGAAGAAGAGGAG3') and
lin-11-LIM-d1 (5'GGGTCGACTCGAGTCATCTGAATTGTCCTTC3') and
lin-11 cDNA as a template. The resulting product was digested with
NdeI and SalI and subcloned in pGBKT7. ldb-1 LID
region (553 bp) was PCR amplified using primers ldb-1-LID-u1
(5'GGCA-TATGGGAAGCAAAAAAGCTACAGCTG3') and ldb-1-LID-d1
(5'GGCTCGAGGTGGCATCCGACTATTCGGCATC3') and the template
ldb-1 cDNA. PCR product was digested with NdeI and
XhoI and subcloned in pGADT7. Transformed AH109 yeast cells were
grown on SD/Leu/Trp and SD/His/Leu/Trp
plates at 30°C.
| RESULTS |
|---|
|
|
|---|
We examined ajm-1::GFP vulval expression in mid-L4 stage animals.
Fig. 2A shows a typical
wild-type expression (ventral view) in the form of seven concentric rings that
arise from specific fusion between vulval cells
(Sharma-Kishore et al., 1999
).
These rings are visible at different focal planes since vulval cells have
invaginated significantly (see Fig.
2B for a schematic representation). Each of the vulval rings
represents one cell type (vulA-vulF; Fig.
2B). By contrast, ajm-1::GFP expression in
lin-11(n389) animals reveals dramatic defects in cell fusion events.
In all 12 animals examined, only two or three vulval rings could be seen;
moreover, the rings were visible in the same focal plane (Fig.
2C,D,F,G).
One of these rings was unusually large (big arrowheads in Fig.
2C,D)
and encircled one or two smaller odd-shaped rings (small arrows in Fig.
2C,D).
The big ring corresponds to the P5.p and P7.p progeny that have fused
together, while the smaller ones belong to the P6.p progeny. In 30% of these
animals some of the 2° lineage cells did not fuse with the large syncytium
and remained isolated (red star brackets in Fig.
2C,F).
Some of these cells (two to six) showed punctate ajm-1::GFP
expression, suggesting partial fusion with the surrounding hyp7 syncytium
(Fig. 2C). To confirm that the
large syncytium is 2° lineage specific, we ablated the P6.p progeny during
early L3 stage and found no change in the formation of large syncytium
(n=4; Fig.2E).
|
lin-11 mutant vulval cells fail to acquire correct
identities
To study the properties of developing vulval cells in lin-11
mutant animals further, we examined cell-type specific markers that are
expressed in overlapping subsets of vulval cells. These include
egl-17 (fibroblast growth factor receptor homolog), cdh-3
(cadherin family), zmp-1 (zinc metalloprotease) and ceh- 2
(homeobox family) (Pettitt et al.,
1996
; Burdine et al.,
1998
; Wang and Sternberg,
2000
; Inoue et al.,
2002
).
egl-17 expression in vulval cells has been shown to be a faithful
marker of wild-type development (Burdine et
al., 1998
; Ambros,
1999
; Wang and Sternberg,
1999
). The earliest expression of egl-17::GFP is detected
in P6.p. The expression continues in the P6.p lineage during Pn.px (VPC
progeny after first cell division, x denotes both anterior and posterior
cells) and Pn.pxx (VPC progeny after second cell division) stages. However,
after third cell division of VPCs (Pn.pxxx cells) egl-17::GFP
expression is no longer detected in the P6.p lineage but instead is expressed
in the vulC and vulD progeny of the 2° lineages
(Burdine et al., 1998
) (Fig.
3A,B).
We find that early expression of egl-17::GFP in P6.p lineage is not
altered in lin-11(n389) animals. However, during the Pn.pxxx stage,
the 2° lineage cells fail to express a detectable level of GFP
(Burdine et al., 1998
) (Fig.
3C,D;
Table 1). However, the P6.p
lineage cells continue to express low levels of GFP, suggesting a
defect in their differentiation (Fig.
3C,D).
Thus, vulC, vulD cells (2° lineage) and vulE, vulF cells (1° lineage)
have not acquired the correct identity.
|
|
The zmp-1 gene encodes a zinc metalloprotease and has been used as
a marker for the 1° lineage cells
(Wang and Sternberg, 2000
;
Inoue et al., 2002
).
zmp-1::GFP (syIs49) expression in the vulva begins during
the late-L4 stage, first detected in the vulD and vulE and later on in the
vulA as well (Fig.
3I,J;
Table 1) (Wang and Sternberg, 2000
;
Inoue et al., 2002
). We did
not find any zmp-1::GFP expression in lin-11(n389) vulval
cells (Fig.
3K,L;
Table 1). Thus, lin-11
is also necessary for the development of the vulA cell type.
We also examined the expression of a homeodomain family member,
ceh-2, which is expressed during L4 stage in the vulB1, vulB2 and
vulC cells (syIs54) (Inoue et
al., 2002
) (Table
1). In lin-11(n389) animals, vulval cells failed to
express ceh-2::GFP in any of the cell types
(Table 1).
The defects in vulval markers expression and cell fusion in lin-11
mutant animals reveal requirements of lin-11 in the specification of
both 1° and 2° lineage cells. It is possible that lin-11
functions non-autonomously to specify some of the cell fates. To address this
possibility, we carried out cell ablation experiments in wild-type and
lin-11(n389) animals. We ablated a subset of the vulval cells during
Pn.px and Pn.pxx stages, and examined expression of four GFP markers
(egl-17::GFP, zmp-1::GFP, cdh-3::GFP and ceh-2::GFP) in the
progeny of the remaining cells during L4 stage
(Table 1). Four different
ablation sets were analyzed [Set 1 (vulA, B1 and B2), Set 2 (vulC and D), Set
3 (vulA, B1, B2, C and D) and Set 4 (VulE and F)]. We found that in wild-type
control animals, all four GFP markers are expressed in cell-autonomous manner,
i.e. ablation of a subset of the vulval cells did not alter GFP
expression pattern in the progeny of the remaining cells (compare intact and
cell ablated animals in Table
1). A similar conclusion for the zmp-1::GFP was drawn
earlier by Wang and Sternberg (Wang and
Sternberg, 2000
). Having examined the autonomy of the GFP markers
in wild-type animals, we carried out similar sets of cell ablations in
lin-11(n389) animals. The results, summarized in
Table 1, demonstrate that
lin-11 functions in all vulval cells and specifies their fate in
cell-autonomous manner. We can not rule out the possibility of complex
interactions. The cell fusion defects are likely to be a secondary consequence
of defects in cell fate specification.
lin-11 is dynamically expressed during vulval
development
Our analyses have revealed broader requirements for lin-11 during
vulval development. The vulval expression of lin-11 using
lin-11::lacZ reporter assays was previously reported to be in the N
and T cells of the 2° lineages (precursors of vulC and vulD) (G. A. Freyd,
PhD thesis, Massachusetts Institute of Technology, 1991)
(Struhl et al., 1993
). This
pattern of expression did not provide a suitable explanation for our
observations on the lin-11 mutant phenotypes. To determine the
spatial and temporal pattern of lin-11 vulval expression precisely,
we generated several lin-11::GFP transgenic lines
(Gupta and Sternberg, 2002
).
Two of these, syIs80 and syIs53, were chosen for detailed
analysis. Another lin-11::GFP integrant, nIs96
(Reddien et al., 2001
), was
also analyzed. The developmental profile of the lin-11::GFP vulval
expression in all three lines is nearly identical, although their fluorescence
brightness can be ranked nIs96>syIs80>syIs53. The
syIs80 and syIs53 animals reveal dynamic changes in the
vulval GFP expression.
The earliest GFP expression in syIs80 vulval cells is
detected in one of the two daughters of the 2° lineage precursors (P5.pp
and P7.pa cells) (Fig.
4A,B,
Fig. 5A). In most cases, GFP
fluorescence was detectable only
1-2 hours before the VPC daughters were
beginning to divide. At this stage, expression in P6.p daughters is much
weaker and rarely observed (Fig.
5A). During the Pn.pxx stage, vulval cells begin to reveal
brighter GFP fluorescence in both the 1° and 2° lineages (Fig.
4C,D,
Fig. 5B). In the 2°
lineage, expression is typically seen in only the N and T cells
(Fig. 5B). By the Pn.pxxx
stage, lin-11::GFP expression is detected in all 2° lineage
progeny (Fig.
4E,F,
Fig. 5C). In general, vulA has
the lowest level of expression compared with others. syIs53 animals
reveal a similar pattern of expression, although the overall fluorescence is
considerably reduced (compare Fig.
5D with
5B, and Fig.
5E with
5C). The expression of
lin-11 in vulval cells is consistent with the cell fusion defects and
marker gene expression studies in lin-11 mutant animals. Together,
these results further support the hypothesis that lin-11 plays a role
in the development of all vulval cell types.
|
|
lineage cells, VC
neurons and a subset of the head and tail neurons in a manner similar to that
reported earlier (Hobert et al.,
1998
Early expression of lin-11 in vulval cells determines the pattern of
invagination
The vulval expression of lin-11 suggests an earliest requirement
in VPC daughters (Pn.px cells). In wild-type animals, the vulC and vulD cells
of the 2° lineage invaginate during L4 stage
(Fig. 1). A high level of
lin-11 expression in their precursors at Pn.px and Pn.pxx stages
suggests that in wild-type animals, LIN-11 activity could specify the ability
of cells to invaginate, consistent with the vulval invagination defect
observed in lin-11 mutant animals. To determine whether ectopic
expression of lin-11 can alter vulval cells fates and therefore
invagination pattern, we generated transgenic animals carrying full-length
lin-11 genomic DNA under the control of the heat-shock promoter,
hsp16-41. Such animals (hs::lin-11) were heat shocked at
different stages (Pn.px, Pn.pxx and Pn.pxxx) and analyzed for the vulval
morphology phenotype. Although the heat shock given at the Pn.pxxx stage did
not cause a noticeable defect in vulval morphology, heat shocks at the other
two stages caused ectopic invagination
(Fig. 6). Specifically, the
vulA, vulB1 and vulB2 cell types that normally remain adhered to the epidermis
in wild type had invaginated (Fig.
6A,C;
compare with wild-type in Fig.
7A). The defect was qualitatively similar after the heat shock at
Pn.px or Pn.pxx stage, although the penetrance was higher at the Pn.px stage.
In most cases, only a subset of the P5.p and P7.p lineage cells showed ectopic
invagination (90%, n=19; Fig.
6A), although in one animal all vulval cells were completely
invaginated (Fig. 6C). This
phenotype suggests that ectopic expression of lin-11 in the
precursors of vulA, vulB1 and vulB2 interferes with their normal development,
and possibly alters their cell fates. This hypothesis was further supported by
our observation that in some cases (two out of six) ectopically invaginated
cells showed expression of the egl-17::GFP, a marker for wild-type
vulC and vulD cell fates (see Fig.
6B for ectopic expression in P7.p lineage vulA; Fig.
3A,B
shows wild-type pattern). By contrast, no such defect was observed in control
heat shock experiment. We conclude that during Pn.px and Pn.pxx stages
lin-11 expression in the precursors of vulC and vulD promotes a
wild-type vulval invagination.
|
|
lin-11 expression during terminal differentiation specifies
vulval morphology
Our experiments so far have defined the function of lin-11 during
the Pn.px and Pn.pxx stages in establishing the correct pattern of vulval
invagination. lin-11 continues to be expressed at high levels in
Pn.pxxx cells and thus might be required for vulval differentiation. To test
this hypothesis, we used a conditional RNAi approach to inactivate
lin-11 gene function. We generated transgenic hs-dslin-11i
animals (carrying lin-11 cDNA in sense and antisense orientations
under control of the hsp16-41 heat-shock promoter) that can be heat
shocked at any desired developmental stage to induce the formation of
double-stranded RNA. As a control, we heat shocked hs-dslin-11i
animals during early L3 stage (Pn.p cells in
Fig. 1) and compared the vulval
morphology and egg-laying phenotypes with the lin-11 loss of function
alleles. Forty percent (n=8) of the heat-shocked animals showed an
egg-laying defective (Egl) phenotype and a weak vulval invagination defect
similar to the lin-11(n566) allele. One of them also exhibited the AC
migration defect, a phenotype that contributes to the Egl defect in
lin-11 mutant animals (Newman et
al., 1999
). In control heat-shocked animals (no
hs-dslin-11i), no such defect was observed (n=20). These
results confirm that the RNAi phenotypes of hs-dslin-11i animals are
due to the reduction in the wild-type lin-11 gene function. Next, we
examined the effect of the lin-11 RNAi on vulval morphology by heat
shocking hs-dslin-11i animals during early Pn.pxxx stage (early-L4).
In wild-type animals during the mid-L4 stage, vulval nuclei occupy
stereotypical positions, such that vulD nuclei of the P5.p and P7.p lineage
are located in the same plane of focus
(Fig. 7A). Likewise, vulE and
vulF nuclei are seen in one focal plane, different from that occupied by vulD
nuclei (Fig. 7B). By contrast,
the heat-shocked hs-dslin-11i animals showed significant defects in
the vulval morphology with misplaced vulval nuclei (30%, n=16; Fig.
7C,D).
Specifically, we found that vulC and vulD nuclei were located in wrong focal
planes (vulD is shown in Fig.
7C,D).
Two out of five defective animals also showed abnormal positioning of the
nuclei of 1° lineage cells (see Fig.
7D for vulF position, vulE nuclei are not seen in this plane).
Overall, vulval invagination was narrower along the anteroposterior axis
compared with the wild type. This abnormal morphology was correlated with a
protruding vulva phenotype at the adult stage
(Fig. 7E). However, such
animals were able to lay eggs normally.
We also examined egl-17::GFP expression in lin-11 RNAi
animals during the mid-L4 stage (
4 hours after the heat shock treatment).
Although the overall GFP pattern was qualitatively wild type (n=9;
see Fig.
3A,B
for the wild-type egl-17::GFP pattern), two worms did show moderate
reduction in the GFP fluorescence in vulC and vulD. These results reveal a
novel function of lin-11 in vulval morphogenesis, distinct from its
early role in specifying the invagination pattern.
The LIM binding protein LDB-1 plays a role in vulval patterning
The LIM homeodomain proteins contain a pair of LIM domains that interact
with co-factors and modulate protein activity
(Dawid et al., 1998
;
Bach, 2000
;
Hobert and Westphal, 2000
).
Among the co-factors are the LIM-binding proteins represented by
NLI/Ldb1/CLIM2, which display highly specific interactions with the LIM
domains. The C. elegans LIM-binding protein LDB-1 has been shown to
interact with two LIM homeodomain proteins CEH-14 and MEC-3
(Cassata et al., 2000
). As it
is the only known LIM-binding protein in C. elegans, it is likely
that LDB-1 regulates the activities of other LIM homeodomain proteins,
including LIN-11.
To investigate the role of ldb-1 during vulval development, we
examined its expression using a ldb-1::GFP construct.
ldb-1::GFP expression is first detected in embryos towards the end of
gastrulation (prior to the comma stage) and is seen in the vulval cells among
other expression (Cassata et al.,
2000
) (not shown). In vulval cells ldb-1::GFP expression
is observed in both the 1° as well as 2° lineage cells
(Fig. 8). Expression during the
Pn.px stage was rarely observed (<5%, n=28;
Fig. 8I). During Pn.pxx stage,
a weak and low penetrant GFP could be detected in 1° and 2°
lineage cells (16%, n=25; Fig.
8A,B,I).
However, by the Pn.pxxx stage strong and highly penetrant ldb-1::GFP
expression could be detected in all vulval progeny (Fig.
8C-F,I).
Expression was also observed during early adult stage
(Fig. 8G-I).
|
|
|
| DISCUSSION |
|---|
|
|
|---|
In wild-type C. elegans during the L4 stage, vulval cells initiate
the process of invagination (Fig.
1) and specific cell fusion to give rise to the adult structure.
The cell fusion events are ordered and occur only between the homologous cell
types, e.g. P5.p lineage vulA fuses only with the P7.p lineage vulA
(Sharma-Kishore et al., 1999
).
By contrast, lin-11 mutant vulval cells exhibit defects in cell
fusion events. Often all 2° lineage vulval cells fuse together, suggesting
that they have acquired a common fate. However, this fate is distinct from any
of the wild-type cell fates as none of the examined markers (egl-17::GFP,
zmp-1::GFP, cdh-3::GFP and ceh-2::GFP) is expressed in
lin-11 mutant vulval cells. Using cell ablation experiments, we have
shown that defects in cell fusion events and marker gene expression in
lin-11 mutant animals result from cell-autonomous requirements of
lin-11. The phenomenon of a cell fusion defect is similar to that
observed for ray fusion in C. elegans mutants affecting male tail
development (Baird et al.,
1991
; Chow and Emmons,
1994
).
Analysis of the ajm-1::GFP expression in 1° vulval cells in
lin-11 animals has revealed defects in the morphology of vulE and
vulF rings, consistent with the abnormal patterns of egl-17::GFP,
cdh-3::GFP and zmp-1::GFP expression (see
Fig. 3). Hence, the 1°
lineage cells are not likely to form a functional vulval opening. These
results are consistent with our previous findings on tissue-specific
regulation of lin-11, where we used vulval- and uterine-specific
regulatory elements of lin-11 to demonstrate that wild-type
egg-laying requires lin-11 function in both the vulva and the uterine
lineage cells (Gupta and Sternberg,
2002
).
The vulval cell fusion defects in lin-11 mutant animals could
arise because lin-11 directly regulates the process of cell fusion or
as a consequence of abnormal differentiation. Two sets of results support the
latter possibility. First, lin-11 expression in vulval cells is
detected beginning at the Pn.px stage (see
Fig. 4). Second, induction of
lin-11 RNAi (using hs-dslin-11i) during mid-L4 stage causes
no significant effect on the formation of vulval rings. Thus, during terminal
differentiation, lin-11 mutant vulval cells might fail to express
cell-type specific genes, leading to the defects in fate specification. The
abnormal cell fusion is the consequence of cells failing to acquire their
unique identities. Such a role of lin-11 in the vulva is similar to
that of C. elegans LIM homeobox gene, mec-3, in touch
receptor neurons. In mec-3 mutant animals, the presumptive touch
neurons are generated but fail to acquire the correct identity
(Way and Chalfie, 1988
).
Temporal expression of lin-11 promotes distinct vulval cell
fates
LIM homeobox genes have been shown to express in highly restricted spatial
and temporal manner (Bach,
2000
; Hobert and Westphal,
2000
). Wing development in Drosophila requires dynamic
expression of the LIM homeobox gene apterous. The level and domain of
apterous expression are highly regulated and help define the
dorsoventral boundary leading to wing growth and patterning
(Diaz-Benjumea and Cohen,
1993
; Milan and Cohen,
2000
).
The dynamic expression of lin-11 in vulval cells can be classified into two distinct patterns: an initial polarized expression (during Pn.px and Pn.pxx stages) where only a subset of the cells express lin-11, and a broad pattern of expression during terminal differentiation (Pn.pxxx cells) where all 2° lineage cells express lin-11. We hypothesized that these two different patterns of lin-11 expression may have different functions and tested the hypothesis experimentally. First, a hs::lin-11 system was used to express lin-11 ectopically in all vulval cells during Pn.px and Pn.pxx stages. This led to defects in vulval invagination caused by the failure of presumptive vulA, vulB1 and vulB2 to remain adhered to the epidermis (Fig. 6; wild-type pattern in Fig. 1). Second, using a RNAi approach, we inhibited lin-11 function during early Pn.pxxx stage when lin-11 is expressed in all 2° lineage cells. The lin-11 RNAi animals showed defects in vulval morphology and vulval nuclei failed to occupy stereotypic positions. This phenotype is likely to result from a differentiation defect in vulval progeny.
The two distinct requirements of lin-11 in vulval cells are likely
to be mediated by different target genes. The vulval invagination defect in
lin-11 animals suggests that one potential target of lin-11
could be the genes that regulate epithelial morphogenesis. Our reporter gene
expression studies have identified a cadherin family member, cdh-3,
that functions downstream of lin-11. In lin-11 mutant vulval
cells cdh-3::GFP expression in the presumptive vulC and vulD is
abolished (Fig. 3;
Table 1). Cadherins are known
to regulate epithelial morphogenesis by mediating adhesions between cell-cell
and cell-extracellular matrix (Gumbiner,
1996
). However, the function of cdh-3 in vulval
development is not essential, perhaps owing to redundancy.
The early expression of lin-11 is polarized and confers identity
on cells to give rise to progeny (vulC and vulD) that invaginate during L4
stage (see Fig. 1). This
conclusion is also supported by the roles of lin-17 (a
frizzled family member) (Sawa et
al., 1996
) and lin-11 during vulval development
(Gupta and Sternberg, 2002
).
In lin-17 mutant animals, lin-11 expression in P7.p lineage
cells is often reversed, i.e. LL lineage cells begin to express
lin-11 instead of the wild-type NT lineage cells. This reversal in
the polarity of lin-11 expression correlates with the opposite
orientation of invagination of the P7.p lineage cells. A similar role for
lin-11 has also been demonstrated in the specification of the ASG and
AWA neurons (Sarafi-Reinach et al.,
2001
). Although during embryonic stages both neurons express
lin-11, expression in AWA is lost by the L1 larval stage and persists
only in the ASG neuron. This later stage expression of lin-11 in ASG
is necessary for its wild-type development. If lin-11 is ectopically
expressed in AWA during post-L1 larval stages, the AWA adopts partial ASG-like
features. Similar functions of other LIM homeobox genes in determining
polarity or asymmetric cell fates have also been demonstrated. C. elegans
lim-6, another LIM homeobox gene, generates functional differences in the
chemosensory behavior between a pair of neurons ASEL/R
(Pierce-Shimomura et al.,
2001
). In mouse embryonic axis formation, the role of
lim1 in anterior-posterior polarity is also suggestive of such a
biological function (Perea-Gomez et al.,
1999
). In this case, lim1 expression in the anterior
region cells of the visceral endoderm confers anterior identity and makes them
different from the posterior cells. Thus, the role of the LIM homeobox genes
in generating cellular asymmetry appears to be a conserved biological
function.
Functional specificity of LIN-11 during vulval development
How does lin-11 play different roles at different stages of vulval
development? One possibility could be that LIN-11 interacts with stage- and
cell-type specific factors to bring about the different outcomes. The LIM
domains of the LIM homeodomain proteins are known to serve as protein-protein
interacting interface that promote the formation of multimeric complexes and
influence DNA-binding affinity of the homeodomain
(Dawid et al., 1998
). Many
studies have revealed the presence of LIM domain-binding proteins
(Dawid et al., 1998
;
Bach, 2000
;
Hobert and Westphal, 2000
).
Although a majority of them belong to the NLI/Ldb1/CLIM2 family, others such
as POU homeodomain factor Pit1 (Bach et
al., 1995
), WD40 repeat containing factor SLB
(Howard and Maurer, 2000
) and
bHLH factor E47 (German et al.,
1992
) have also been identified.
The C. elegans LIM-binding protein LDB-1 was previously shown to
be required for the wild-type functioning of several neurons
(Cassata et al., 2000
). We find
that ldb-1 is expressed in both the 1° as well as 2° lineage
vulval cells, a pattern that overlaps with lin-11 expression.
Analysis of the ldb-1 vulval expression has revealed some differences
from lin-11. During Pn.pxx stage, lin-11::GFP shows
alternating low and high pattern of expression in P5.p and P7.p lineage cells
(LLHH-HHLL, respectively, from anterior to posterior; L, low; H, high).
ldb-1::GFP, however, shows no such pattern and is detected at uniform
level in all 1° and 2° lineage cells. In addition, ldb-1::GFP
continues to be expressed at high levels in 1° vulval progeny during L4
and young adult stages, whereas lin-11::GFP expression in 1°
lineage cells is significantly weaker compared with the 2° lineage cells.
Hence, LDB-1 may regulate only a subset of the LIN-11 functions. Consistent
with this, ldb-1 RNAi animals did not show defects in vulval
invagination but in vulval morphology (Figs
7,
9). However, it is possible
that ldb-1 RNAi effect is weak because of the partial elimination of
gene activity. Our findings that LIN-11 and LDB-1 physically interact support
the hypothesis that LIN-11 and LDB-1 function together to regulate vulval
differentiation. Furthermore, these results suggest that lin-11 may
use other mechanisms during earlier stages of vulval development.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ambros, V. (1999). Cell cycle-dependent sequencing of cell fate decisions in Caenorhabditis elegans vulva precursor cells. Development 126,1947 -1956.[Abstract]
Avery, L. and Horvitz, H. R. (1987). A cell that dies during wild-type C. elegans development can function as a neuron in a ced-3 mutant. Cell 51,1071 -1078.[CrossRef][Medline]
Bach, I., Rhodes, S. J., Pearse, R. V., II, Heinzel, T., Gloss,
B., Scully, K. M., Sawchenko, P. E. and Rosenfeld, M. G.
(1995). P-Lim, a LIM homeodomain factor, is expressed during
pituitary organ and cell commitment and synergizes with Pit-1.
Proc. Natl. Acad. Sci. USA
92,2720
-2724.
Bach, I. (2000). The LIM domain: regulation by association. Mech. Dev. 91, 5-17.[CrossRef][Medline]
Baird, S. E., Fitch, D. H. A., Kassem, I. A. A. and Emmons, S. W. (1991). Pattern formation in the nematode epidermis: determination of the arrangement of peripheral sense organs in the C. elegans male tail. Development 113,515 -526.[Abstract]
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Burdine, R. D., Branda, C. S. and Stern, M. J. (1998). EGL-17(FGF) expression coordinates the attraction of the migrating sex myoblasts with vulval induction in C. elegans. Development 125,1083 -1093.[Abstract]
Cassata, G., Röhrig, S., Kuhn, F., Hauri, H.-P., Baumeister, R. and Bürglin, T. R. (2000). The Caenorhabditis elegans Ldb/NLI/Clim orthologue ldb-1 is required for neuronal function. Dev. Biol. 226, 45-56.[CrossRef][Medline]
Chow, K. L. and Emmons, S. W. (1994). HOM-C/HOX
genes and four interacting loci determine the morphogenetic properties of
single cells in the nematode male tail. Development
120,2579
-2593.
Cohen, B., McGuffin, M. E., Pfeifle, C., Segal, D. and Cohen,
S. (1992). apterous, a gene required for imaginal
disc development in Drosophila encodes a member of the LIM family of
developmental regulatory proteins. Genes Dev.
6, 715-729.
Costa, M., Raich, W., Agbunag, C., Leung, B., Hardin, J. and
Priess, J. R. (1998). A putative catenin-cadherin system
mediates morphogenesis of the Caenorhabditis elegans embryo.
J. Cell Biol. 141,297
-308.
Dawid, I. B., Breen, J. J. and Toyama, R. (1998). LIM domains: multiple roles as adaptors and functional modifiers in protein interactions. Trends Genet 14,156 -162.[CrossRef][Medline]
Diaz-Benjumea, F. J. and Cohen, S. M. (1993). Interaction between dorsal and ventral cells in the imaginal discs directs wing development in Drosophila. Cell 75,741 -752.[CrossRef][Medline]
Dreyer, S. D., Zhou, G., Baldini, A., Winterpacht, A., Zabel, B., Cole, W., Johnson, R. L. and Lee, B. (1998). Mutations in LMX1B cause abnormal skeletal patterning and renal dysplasia in nail patella syndrome. Nat. Genet. 19, 47-50.[CrossRef][Medline]
Ferguson, E. L. and Horvitz, H. R. (1985).
Identification and characterization of 22 genes that affect the vulval cell
lineages of the nematode Caenorhabditis elegans.
Genetics 110,17
-72.
Ferguson, E. L., Sternberg, P. W. and Horvitz, H. R. (1987). A genetic pathway for the specification of the vulval cell lineages of Caenorhabditis elegans. Nature 326,259 -267.[CrossRef][Medline]
Fields, S. and Song, O.-K. (1989). A novel genetic system to detect protein-protein interactions. Nature 340,245 -246.[CrossRef][Medline]
Freyd, G., Kim, S. K. and Horvitz, H. R. (1990). Novel cystein-rich motif and homeodomain in the product of the Caenorhabditis elegans cell lineage gene lin-11. Nature 344,876 -879.[CrossRef][Medline]
German, M. S., Wang, J., Chadwick, R. B. and Rutter, W. J.
(1992). Synergistic activation of the insulin gene by a
LIM-homeodomain protein and a basic helix-loop-helix protein, building a
functional insulin minienhancer complex. Genes Dev.
6,2165
-2176.
Greenwald, I. (1997). Development of the vulva. In C. elegans II (ed. D. Riddle, T. Blumenthal, B. Meyer and J. Priess), pp. 519-541. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Gumbiner, B. M. (1996). Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell 84,345 -357.[CrossRef][Medline]
Gupta, B. P. and Sternberg, P. W. (2002). Tissue-specific regulation of the LIM homeobox gene lin-11 during development of the Caenorhabditis elegans egg-laying system. Dev. Biol. 247,102 -115.[CrossRef][Medline]
Hill, E., Broadbent, I. D., Chothia, C. and Pettitt, J. (2001). Cadherin superfamily proteins in Caenorhabditis elegans and Drosophila melanogaster. J. Mol. Biol. 305,1011 -1024.[CrossRef][Medline]
Hobert, O. and Westphal, H. (2000). Functions of LIM-homeobox genes. Trends Genet. 16, 75-83.[CrossRef][Medline]
Hobert, O., DíAlberti, T., Liu, Y. and Ruvkun, G.
(1998). Control of neural development and function in a
thermoregulatory network by the LIM homeobox gene lin-11.
J. Neurosci. 18,2084
-2096.
Howard, P. W. and Maurer, R. A. (2000).
Identification of a conserved protein that interacts with specific LIM
homeodomain transcription factors. J. Biol. Chem.
275,13336
-13342.
Inoue, T., Sherwood, D. R., Aspock, G., Butler, J. A., Gupta, B. P., Kirouac, M., Wang, M., Lee, P. Y., Kramer, J. M., Hope, I. et al. (2002). Gene expression markers for C. elegans vulval cells. Mech. Dev. Gene Exp. Patt. 2, 235-241.
Karlsson, O., Thor, S., Norberg, T., Ohlsson, H. and Edlund, T. (1990). Insulin gene enhancer binding protein Isl-1 is a member of a novel class of proteins containing both a homeo- and a Cys-His domain. Nature 344,879 -882.[CrossRef][Medline]
Mello, C. and Fire, A. (1995). DNA transformation. In Caenorhabditis elegans, Modern biological analysis of an organism (Methods in Cell Biology). Vol.48 (ed. H. F. Epstein and D. C. Shakes), pp.451 -482. New York: Academic Press.
Mello, C. C., Kramer, J. M., Stinchcomb, D. and Ambros, V. (1991). Efficient gene transfer in C. elegans after microinjection of DNA into germline cytoplasm: Recombination drives the assembly of heritable transgenic structures. EMBO J. 10,3959 -3970.[Medline]
Milan, M. and Cohen, S. M. (2000). Temporal regulation of Apterous activity during development of the Drosophila wing. Development 127,3069 -3078.[Abstract]
Mohler, W. A., Simske, J. S., Williams-Masson, E. M., Hardin, J. D. and White, J. G. (1998). Dynamics and ultrastructure of developmental cell fusions in the Caenorhabditis elegans hypodermis. Curr. Biol. 8,1087 -1090.[CrossRef][Medline]
Newman, A. P., Acton, G. Z., Hartwieg, E., Horvitz, H. R. and Sternberg, P. W. (1999). The lin-11 LIM domain transcription factor is necessary for morphogenesis of C. elegans uterine cells. Development 126,5319 -5326.[Abstract]
Perea-Gomez, A., Shawlot, W., Sasaki, H., Behringer, R. R. and Ang, S.-L. (1999). HNF3b and Lim1 interact in the visceral endoderm to regulate primitive streak formation and anterior-posterior polarity in the mouse embryo. Development 126,4499 -4511.[Abstract]
Pettitt, J., Wood, W. B. and Plasterk, R. H. A. (1996). cdh-3, a gene encoding a member of the cadherin superfamily, functions in epithelial cell morphogenesis in Caenorhabditis elegans. Development 122,4149 -4157.[Abstract]
Pfaff, S. L., Mendelsohn, M., Stewart, C. L., Edlund, T. and Jessell, T. M. (1996). Requirement for LIM homeobox gene Isl1 in motor neuron generation reveals a motor neuron-dependent step in interneuron differentiation. Cell 84,309 -320.[CrossRef][Medline]
Pierce-Shimomura, J. T., Faumont, S., Gaston, M. R., Pearson, B. J. and Lockery, S. R.