|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00505
DEVELOPMENT AND DISEASE |
1 Department of Orthopaedic Surgery, David Geffen School of Medicine at UCLA,
University of California, Los Angeles, CA 90095, USA
2 Department of Molecular, Cell and Developmental Biology, University of
California, Los Angeles, CA 90095, USA
3 Department of Biological Chemistry, David Geffen School of Medicine at UCLA,
University of California, Los Angeles, CA 90095, USA
4 Department of Anatomy and Cell Biology, Temple University School of Medicine,
PA 19140, USA
5 Fibrogen, South San Francisco, CA 94080, USA
* Author for correspondence (e-mail: klyons{at}mednet.ucla.edu)
Accepted 13 March 2003
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: CCN, CTGF, Chondrogenesis, Angiogenesis, Mutant
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Moussad and Brigstock, 2000;
Perbal, 2001). CTGF is a major
inducer of extracellular matrix (ECM) production in fibrotic diseases, which
are characterized by excessive collagen deposition. CTGF is overexpressed in
fibrotic lesions, and the degree of overexpression correlates with severity of
disease (Blom et al., 2001;
Dammeier et al., 1998;
Frazier et al., 1996;
Grotendorst, 1997;
Lasky et al., 1998;
Mori et al., 1999;
Stratton et al., 2001). The
ability of CTGF to induce collagen deposition in pathological conditions
raises the possibility that it may be a mediator of ECM production in tissues
such as cartilage and bone during development. However, nothing is known about
its role in normal tissues.
CTGF may act in part as a mediator of transforming growth factors ß
(TGFßs) and bone morphogenetic proteins (BMPs) during development.
TGFßs play roles in a wide variety of developmental events, and TGFß
induces CTGF expression in many cell types because the CTGF promoter contains
a TGFß response element (Holmes et
al., 2001). Moreover, CTGF contains a von Willebrand type C
domain, which is thought to mediate physical interactions with growth factors
such as TGFß (Wong et al.,
1997). Consistent with this, CTGF binds to BMPs and TGFß,
leading to inhibition of BMP and enhancement of TGFß signaling
(Abreu et al., 2002).
In addition to its potential role in TGFß and BMP pathways, several
lines of evidence indicate that CTGF acts independently of TGFß
superfamily members. For example, CTGF and the related protein Cyr61 have
effects on gene expression that often oppose those of TGFß
(Chen et al., 2001a), and the
induction of CTGF expression occurs through both TGFß-dependent and
-independent pathways (reviewed by Blom et
al., 2002). In addition, a distinguishing feature of CTGF and
other CCN proteins is the presence of several domains that participate in
protein interactions (Bork,
1993). In addition to the von Willebrand type C domain required
for TGFß and BMP binding (Abreu et
al., 2002), CCNs contain a thrombospondin (TSP) module, which
enables TSP to bind to ECM proteins, matrix metalloproteinases (MMPs) and
integrins (Bornstein, 2001;
Lau and Lam, 1999). CTGF
promotes effects on cell survival, adhesion and migration through interactions
with integrins (Babic et al.,
1999; Chen et al.,
2001a; Jedsadayanmata et al.,
1999; Leu et al.,
2002). CTGF also binds to low density lipoprotein receptor-related
protein (LRP), but it is as yet unclear whether this interaction facilitates
CTGF signaling and/or clearance (Babic et
al., 1999; Jedsadayanmata et
al., 1999; Segarini et al.,
2001). In addition, CTGF binds to MMPs, and inactivates VEGF
through direct physical interactions
(Inoki et al., 2002). Finally,
the C-terminal domain of CTGF promotes cell proliferation
(Brigstock, 1997). Although
the constellation of proteins with which CTGF interacts in vivo is not known,
the presence of multiple domains is consistent with a role for CTGF as an
integrator of multiple growth factor-, integrin- and ECM-derived signals.
Because the ECM transduces signals from the microenvironment, and regulates
the release of growth factors, alterations in ECM composition during
development lead to dynamic changes in its signaling properties. ECM
remodeling is achieved by regulating the production and degradation of
specific ECM components. MMPs, which comprise a large family of enzymes with
differential abilities to degrade specific ECM components, play a vital role
in this process (Sternlicht and Werb,
2001). MMPs also cleave growth factors and their binding proteins,
thereby activating or inhibiting specific signaling pathways. Overexpression
of CTGF in fibroblasts leads to increased expression of MMP1, MMP2 and MMP3
(Chen et al., 2001b;
Fan and Karnovsky, 2002),
suggesting that CTGF coordinates ECM production and degradation.
The expression of CTGF in cartilage, and its ability to promote
chondrogenic differentiation in vitro
(Nakanishi et al., 2000), is
consistent with a potential role for CTGF in ECM remodeling during skeletal
development. During chondrogenesis, mesenchymal cells condense into
characteristic shapes. Cells within these condensations subsequently
differentiate into chondrocytes, which secrete ECM components, surrounded by a
layer of perichondrial cells. As development proceeds, cells within the
aggegrates exit the cell cycle and mature, leading to stratified zones of
cells at progressive stages of differentiation (resting, proliferative,
prehypertrophic and hypertrophic). In cartilages destined to be replaced by
bone through endochondral ossification, terminally differentiated hypertrophic
chondrocytes undergo apoptosis as the growth plate is invaded by blood vessels
and osteoblasts. The ability of the growth plate to support angiogenesis is
dependent upon the activity of MMPs, although the targets of MMP action in
hypertrophic chondrocytes are not known
(Vu et al., 1998;
Ensig et al., 2000).
Along with a potential role in the regulation of ECM composition, a role
for CTGF in angiogenesis is likely, as CTGF expression is induced by vascular
endothelial growth factor (VEGF) (Suzuma
et al., 2000), is expressed in endothelial and vascular smooth
muscle cells, and induces neovascularization
(Babic et al., 1999;
Moussad and Brigstock, 2000;
Shimo et al., 1999). Although
these studies imply a positive role for CTGF in angiogenesis, CTGF can bind to
VEGF and inhibit the ability of VEGF to induce angiogenesis
(Hashimoto et al., 2002;
Inoki et al., 2002). These
observations suggest that CTGF may have both positive and negative effects on
angiogenesis.
Despite strong evidence that CTGF promotes ECM production and angiogenesis
in fibrotic disease, nothing is known about its role during development. In
particular, downstream targets of CTGF action in normal tissues have not been
identified. Additional questions include the extent to which CTGF collaborates
with TGFß during development, and whether CTGF and the related molecule,
Cyr61, share overlapping functions, as these proteins have related activities
in vitro, are co-expressed in several tissues, and serve as ligands for the
same set of integrins (Perbal,
2001). To address these issues, we examined the pattern of
Ctgf expression, studied its effects on ECM production, and generated
Ctgf-deficient mice.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). The
Ctgf probe was generated by subcloning a partial mouse cDNA IMAGE
clone (ID 551901) into pBluescript (Stratagene), linearizing with
EcoRI, and reverse transcribing with T7 polymerase. The
TGFß1 probe was obtained from American Type Culture Collection.
The ColII and ColX probes were a generous gift from Vicki
Rosen. A. McMahon kindly provided the Ihh probe.
Gene targeting
Ctgf clones were isolated from a strain 129Sv/J mouse BAC library
(Incyte). The targeting construct was generated by replacing a 500 bp
SmaI fragment containing exon 1, the TATA box and the transcription
start site with the neomycin resistance gene under the control of a PGK
promoter (PGKneopA). The targeting vector was electroporated into RW-4 ES
cells (Incyte) as described
(Ramírez-Solis et al.,
1993). Targeted clones were injected into blastocysts by the UCLA
Transgenic Mouse Facility. Chimeras were bred to Balbc/J females to test for
germline transmission. The mutation has been maintained on a hybrid 129Sv/J
x Balbc/J background. Genotyping was performed by Southern blot analysis
of HindIII-digested genomic DNA using the external probe indicated in
Fig.2A.
|
) and
grown to confluence in DMEM containing 10% FBS. Cells were then grown in
serum-free DMEM containing 50 µg/ml ascorbic acid, with or without 5 ng/ml
TGFß1 (R&D Systems) for 24 hours. RNA was harvested using the
Qiashredder and Rneasy kits (Qiagen). RNA synthesis was performed using
Superscript II (Gibco BRL). RT-PCR was performed using total RNA from EFs
derived from mutant or wild-type neonates. The CTGF primers were 5'
CT-GTCAAGTTTGAGCTTTCTGG 3' and 5' GGACTCAAAGATGT-CATTGTCC
3'. Control primers for GAPDH were 5' ACCCAGAA-GACTGTGGATGG
3' and 5' ATCATACTTGGCAGGTTTCTCC 3'. Long bones at E14.5, or growth plates at later stages from individual genotyped wild-type and mutant littermates were dissected out and total RNA was prepared using TRIzol (Gibco-BRL). Levels of ColII, ColX, Cbfa1 (Runx2 – Mouse Genome Informatics), Vegf (Vegfa – Mouse Genome Informatics) and Mmp9 were examined by semi-quantitative RT-PCR, on oligo (dT)-primed cDNA (Superscript, Gibco-BRL) from growth plate total RNA using the following primers: ColII, 5'-CACACTGGTAAGTGGGGCAAGAC and 3'-GGATTGTGTTGTTTCAGGGTTCGGG; ColX, 5'-CCTGGGTTA-GATGGAAA and 3'-AATCTCATAAATGGGATGGG; Vegf, 5'-GGGTGCACTGGACCCTGGGTTTAC and 3'-CCTGGCTCAC-CGCCTTGGCTTGTC; Cbfa1, 5'-TGACTGCCCCCACCCTCT-TAG, 3'-GGCAGCACGCTATTAAATCCAAA; Mmp9 5'-AACCCT-GTGTGTTCCCGTT and 3'-GGATGCCGTCTATGTCGTCT; and Gapdh 5'-CCCCTTCATTGACCTCAACT and 3'-TTGTCATGGAT-GACCTTGGC. Typical reactions were performed with cycles conditions of 94°C for 1 minute, 60°C for 1 minute, 72°C for 1 minute. The following numbers of cycles were used for each primer pair: Gapdh, 20, 22, 24; ColII, 22, 24, 26; ColX, 26, 30, 24; Mmp9, 26, 28, 30; Runx2, 30, 2, 34; Vegf, 28, 30, 32. RNA samples from five wild-type and five mutant littermates were examined. Each RNA sample was analyzed twice. Quantification of expression relative to Gapdh was performed using NIH image.
Skeletal analysis and histology
Cleared skeletal preparations were made as described
(Yi et al., 2000). For
histology, specimens were fixed with 4% paraformaldehyde or 10% neutral
formalin, decalcified with Immunocal (Decal Chemical) and embedded in
paraffin. Deparaffinized sections (7 µm) were stained with Toluidine Blue
or safranin-o/light green. Plastic sections were fixed in neutral-buffered
formalin, dehydrated and embedded undecalcified in DDK-Plast
methylmethacrylate resin. Sections (4 µm) were stained with von
Kossa/tetrachrome.
Immunostaining was performed on deparaffinized sections with antibodies for link protein and aggrecan (8A4, IC6, Developmental Studies Hybridoma Bank), MMP9 and MMP13 (Chemicon) or type II collagen (Research Diagnostics) at a 1:100 dilution using the Histomouse kit (Zymed). Tissue sections were pretreated with chondroitinase ABC (0.05n u/ml; Sigma) for 8A4 and IC6, or with 2.5% hyaluronidase (Calbiochem) for MMP9, MMP13, and type II collagen. Immunostaining for PECAM (Bectin Dickinson) was carried out on cryosections. Briefly, cryosections were treated with 2.5% hyaluronidase for 30 minutes at room temperature and with 3% hydrogen peroxide/PBS for 10 minutes at room temperature. After washing with PBS and blocking with 2% dry milk, 5% goat serum in PBS, incubation with anti-PECAM antibody (Zymed; 1:100) was carried out overnight at 4°C. After washing with blocking buffer, slides were incubated with rat secondary antibody for 2 hours at room temperature. Color was developed with DAB for MMP9 and PECAM, and with the Zymed kit chromogen for all other antibodies.
For analysis of osteoclasts, sections were stained for tartrate-resistant acid phosphatase (TRAP) positive cells using a TRAP staining kit (Sigma).
Cell proliferation and apoptosis
Cell proliferation was assessed by BrdU incorporation as described
(Yi et al., 2000), and by PCNA
immunostaining. For PCNA, 7 µm decalcified paraffin wax-embedded sections
were used with a 1:100 dilution of anti-PCNA antibody as described above for
PECAM staining. Cell proliferation was assessed as described
(Yi et al., 2000). Cell death
analysis by TUNEL analysis was performed using the Apoptosis Detection System,
Fluorescein kit (Promega).
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
In situ hybridization experiments revealed that Ctgf is highly
expressed in cartilage in midgestation embryos. During skeletogenesis,
Ctgf is first expressed at E12.5 in perichondrium (Fig.
1G,H).
By E13.5, Ctgf persists at high levels in perichondrium and in
adjacent chondrocytes (Fig.
1I). At this stage, Ctgf can also be detected at lower
levels within maturing chondrocytes at the centers of developing long bones
(Fig. 1J). At E14.5,
Ctgf expression persists in chondrocytes adjacent to the
perichondrium, and is upregulated in maturing chondrocytes
(Fig. 1K); at this stage,
Ctgf expression overlaps extensively with that of Indian hedgehog
(Ihh), a marker for prehypertrophic and hypertrophic chondrocytes
(Bitgood and McMahon, 1995)
(Fig. 1L; see also Fig.
5A,B).
At this and subsequent stages, the strongest site of Ctgf expression
is within the most mature population of chondrocytes. For example, by E16.5,
Ctgf is highly expressed in terminally differentiated hypertrophic
chondrocytes, as demonstrated by its overlapping pattern of expression with
that of type X collagen (ColX), a marker for hypertrophic
chondrocytes (Fig.
5F,H).
Ctgf expression persists at this stage in chondrocytes adjacent to
the perichondrium within the prehypertrophic zone (Fig.
5F,G).
The expression of high levels of Ctgf in hypertrophic cells continues
at least until birth (Fig. 1M).
In summary, within developing cartilage, Ctgf is expressed initially
in the perichondrium. At later stages, Ctgf is expressed within
maturing chondrocytes. Transcripts persist in chondrocytes adjacent to the
perichondrium at least until E16.5. However, terminally differentiating
prehypertrophic and hypertrophic chondrocytes are the major sites of
Ctgf expression in developing cartilage.
|
Generalized chondrodysplasia in Ctgf mutants
Ctgf-/- mice die shortly after birth because of
respiratory failure caused by skeletal defects. Within the axial skeleton,
defects are observed along the entire vertebral column. By E14.5, vertebrae in
mutants are broader than in wild-type littermates
(Fig. 3A), and this phenotype
persisted at birth (Fig. 3B).
In newborns, the sterna of Ctgf mutants are short and bent inwards,
and ossified regions of the ribs are kinked (Fig.
3C,D).
The kinks in ossified regions are a consequence of prior defects in
chondrogenesis, as the rib cartilage adjacent to sites of mineralization is
already bent at E14.5 (Fig.
3E). The overall lengths of individual ribs are not significantly
different, but the extent of ossification is reduced in mutants
(Fig. 3F), and the zone of
mineralizing cartilage is expanded (Fig.
3F; arrow in Fig.
3C), suggesting defective replacement of cartilage by bone during
endochondral ossification. In addition, 
10% of mutants exhibit misaligned
sternal fusion (Fig. 3G).
Endochondral defects are also observed throughout the appendicular skeleton.
By E13.5, deformation of the limb cartilage is apparent in Ctgf
mutants (Fig. 3H), leading to
kinks in the radius, ulna, tibia and fibula in Ctgf mutants at birth
(Fig. 3I).
|
We performed a histological analysis to investigate these defects in more detail. At E12.5, when Ctgf mRNA is localized to the perichondrium, the sizes and morphologies of the cartilaginous condensations in Ctgf mutants and wild-type littermates are indistinguishable (Fig. 4A, and data not shown). By E14.5, chondrocytes in the midshaft regions of long bones from wild-type mice are undergoing differentiation into prehypertrophic and hypertrophic cells (Fig. 4B). No histological differences were detected in the proliferative zones of wild-type and mutant littermates at this stage. However, in Ctgf mutants, long bones are already bent near the junction between hypertrophic and nonhypertrophic cells (Fig. 4B). The hypertrophic zones did not differ in length in Ctgf mutants and wild-type littermates at this stage (Fig. 4B, and data not shown). At E16.5, when Ctgf is most highly expressed in hypertrophic chondrocytes, endochondral ossification has commenced in long bones from wild-type and mutant littermates (Fig. 4C). An enlarged and disorganized hypertrophic zone is seen in mutants, and this persists at birth (Fig. 4D).
|
Deficient cell proliferation in Ctgf-/-
chondrocytes
CTGF promotes chondrocyte proliferation in vitro
(Nakanishi et al., 2000), and
Ctgf-/- mice exhibit morphological and histological
features consistent with proliferative defects. Therefore, proliferation was
examined by staining for proliferative cell nuclear antigen (PCNA). These
analyses revealed a proliferative defect in neonatal
Ctgf-/- growth plates
(Fig. 4E). No differences were
noted at E12.5. However, by E14.5, when Ctgf is highly expressed in
prehypertrophic chondrocytes (Fig.
1K,L),
the percentage of proliferating chondrocytes was decreased in mutants. This
proliferative defect was more pronounced at E16.5
(Fig. 4E). Therefore,
Ctgf appears does not regulate cell proliferation at early stages of
chondrogenesis, but appears to be required at later stages.
TUNEL staining was performed to determine whether altered rates of apoptosis might contribute to the cartilage deformations and/or expansion of the hypertrophic zone in mutants. In both wild-type and mutant growth plates, apoptosis is confined to terminal chondrocytes (data not shown). Therefore, apoptosis does not appear to contribute to the defective mechanical properties of Ctgf mutant cartilage, and the expansion of the hypertrophic zone in mutants cannot be attributed to an inability of mutant chondrocytes to undergo apoptosis.
Ctgf is highly expressed in prehypertrophic chondrocytes at E14.5
and promotes chondrocyte proliferation at this stage (Fig.
1K,L,
Fig. 4E). Ihh, which
coordinates the progression of chondrocytes to hypertrophy and promotes cell
proliferation (Long et al.,
2001; St-Jacques et al.,
1999), is expressed in a pattern overlapping that of
Ctgf. Therefore, to determine whether Ctgf might affect
chondrocyte proliferation by regulating Ihh levels, we examined
Ihh expression by in situ hybridization and semi-quantitative RT-PCR.
We also examined the expression of ColX because CTGF promotes
ColX expression in chondrocytes in vitro
(Nakanishi et al., 2000).
Semi-quantitative RT-PCR analysis of growth plates at E14.5 revealed no
apparent differences in levels of Ihh or ColX expression
between Ctgf mutants and wild-type littermates (data not shown). In
situ hybridization studies also indicated that the expression of these markers
is not altered in Ctgf mutants. In wild-type mice at E14.5,
Ihh is expressed in prehypertrophic and hypertrophic chondrocytes,
while ColX expression is restricted to hypertrophic chondrocytes
(Fig. 5A-C). At this stage,
Ctgf expression overlaps with that of Ihh and ColX,
indicating that Ctgf is expressed primarily in hypertrophic
chondrocytes (Fig. 5A-C). In
E14.5 Ctgf mutant littermates, Ihh and ColX are
similarly expressed in prehypertrophic and hypertrophic chondrocytes (Fig.
5D,E).
At E16.5 in wild-type mice, the pattern of Ctgf expression overlaps
extensively with that of ColX in hypertrophic chondrocytes;
Ctgf transcripts persist in chondrocytes adjacent to the
perichondrium in the prehypertrophic zone
(Fig. 5F-H). By E16.5, the
hypertrophic zone is expanded in Ctgf mutants. At this stage,
Ihh and ColX were appropriately expressed in the
prehypertophic and hypertrophic regions, respectively (Fig.
5I,J).
Owing to the distorted shapes of the Ctgf mutant skeletal elements,
we were unable to determine unequivocally whether the zones of expression of
these markers were expanded in mutants. However, RT-PCR analysis revealed no
differences in levels of ColX expression (data not shown). Therefore,
although the hypertrophic zone in Ctgf mutants is enlarged by E16.5,
this is not accompanied by obvious expansions of the domains of Ihh
or ColX expression (Fig.
5G,I).
The basis for these observations is unknown at present. It is possible that
the subtle expansions in the domains of Ihh and/or ColX
expression collectively lead to the expanded growth plates seen in
Ctgf mutants.
In summary, Ctgf is required for normal rates of chondrocyte
proliferation in vivo. Proliferative defects were detected beginning at E14.5,
coincident with the upregulation of Ctgf in prehypertrophic and
hypertrophic chondrocytes. However, the decreased rate of cell proliferation
in Ctgf mutants does not appear to be due to a decrease in
Ihh mRNA levels, indicating that Ctgf acts downstream of
Ihh, and/or by an independent mechanism. Finally, although CTGF
promotes chondrocyte differentiation in vitro
(Nakanishi et al., 2000),
cleared skeletal preparations, histological examination, and analysis of
Ihh and ColX expression revealed no apparent alterations in
chondrocyte progression to hypertrophy in Ctgf mutants.
Defective extracellular matrix production in Ctgf mutants
Cartilage ECM components are the primary determinants of its elastic and
tensile properties. The deformed cartilages seen in Ctgf mutants
suggested that CTGF is required for synthesis of normal levels of cartilage
ECM components. Therefore we examined whether abnormalities in ECM content
might contribute to the defective properties of Ctgf mutant
cartilage. As previously discussed, no clear differences were seen in
ColX mRNA levels in midgestation Ctgf mutants and wild-type
littermates (Fig. 5, and data
not shown). Similar results were obtained when the expression of type II
collagen (ColII), the most abundant collagen present in cartilage,
was examined by semi-quantitative RT-PCR and in situ hybridization from
E12.5-17.5 (data not shown). Examination of neonates also revealed no obvious
differences in the amount or distribution of collagen types II and X in
cartilage matrix in Ctgf mutants (Fig.
6A,B).
Therefore, although CTGF is a major regulator of type I collagen production
during fibrotic responses, and induces the transcription of types II and X
collagens in vitro (Nakanishi et al.,
2000), CTGF does not appear to be a major regulator of their
expression in vivo.
|
). Safranin-o staining, a measure of overall proteoglycan
content, revealed no apparent differences between wild-type and mutant
littermates in the reserve and proliferative zones, but confirmed that the
hypertrophic zone, which does not stain intensely with safranin-o, is expanded
in mutants (Fig. 6C). However,
levels of aggrecan, the main cartilage proteoglycan
(Fig. 6D), and link protein,
which stabilizes aggregates of aggrecan and hyaluronin
(Fig. 6E), are reduced in
Ctgf-/- growth plates, confirming that
Ctgf-deficient growth plate cartilage exhibits defects in ECM
content. Therefore, Ctgf is required for the expression of wild-type
levels of specific cartilage ECM components in vivo, and the inferior
mechanical properties of Ctgf mutant cartilage can be attributed to
the reduced expression of these components.
Defective growth plate angiogenesis and osteopenia in Ctgf
mutants
Histological examination revealed a number of defects in neonatal growth
plates of Ctgf mutants. Consistent with the proliferative defects
detected by PCNA staining, longitudinal columns are disorganized within the
hypertrophic zones in mutants (Fig.
7A). Staining by the von Kossa method revealed apparently normal
mineralization of the hypertrophic cartilage matrix
(Fig. 7A). Mineralized bone
collars, which normally form in the perichondrium adjacent to prehypertrophic
and hypertrophic chondrocytes, are lengthened in Ctgf mutants,
consistent with the expansion of the hypertrophic zone
(Fig. 7B).
|
;
Haigh et al., 2000;
Vu et al., 1998), and
Ctgf mutants exhibit expanded hypertrophic zones, we examined whether
growth plate angiogenesis is defective. In wild-type neonates, abundant
capillaries are seen invading the mineralized hypertrophic cartilage. However,
few intact capillaries are visible in growth plates of mutants
(Fig. 7A). Immunostaining for
PECAM confirmed that growth plate angiogenesis is defective in Ctgf
mutants; the fine network of capillaries, well developed in the ossification
zones of wild-type neonates, is less extensive in Ctgf mutants,
although blood vessels are present within intertrabecular spaces
(Fig. 8A).
|
). Consistent with a defect in growth plate angiogenesis, the
bone collar appears thinner, and less trabecular bone is present in
Ctgf mutants (Fig.
7B). A primary role for CTGF in osteoblast function is also
possible as CTGF is expressed in osteoblasts and promotes their proliferation
and differentiation in vitro (Nishida et
al., 2000; Xu et al.,
2000a). Additional studies will be required to discriminate
between direct and indirect roles for CTGF in osteoblasts.
CTGF regulates the availability of local factors required for growth
plate angiogenesis
Angiogenesis at the growth plate requires localized proteolytic
modification of the ECM to permit invasion by endothelial cells, and MMPs play
essential roles in this process (Vu et
al., 1998; Zhou et al.,
2000). MMP9 is required for growth plate angiogenesis, and is
expressed in osteoclasts/chondroclasts
(Reponen et al., 1994). MMP9
immunostaining in wild-type neonates is most intense at the hypertrophic
cartilage-bone junction. By contrast, MMP9 immunostaining at this junction is
diminished in growth plates of Ctgf mutants
(Fig. 8B). Semi-quantitative
RT-PCR analysis confirmed that Mmp9 mRNA levels are reduced in the
growth plates of mutants (Fig.
8C). To determine whether the decrease in MMP9 levels in mutant
growth plates reflects a generalized loss of osteoclasts, staining for
tartrate-resistant acid phosphatase (TRAP) activity, a marker for cells of the
osteoclast lineage, was performed. In wild-type neonates, TRAP-positive cells
are distributed throughout the bone marrow, and co-localize with
MMP9-expressing cells at the cartilage-bone junction
(Fig. 8D). By contrast, in
Ctgf mutants, although TRAP-positive cells are found at normal levels
in bone marrow (data not shown), few are seen at the cartilage-bone junction
(Fig. 8D). Therefore, CTGF is
important for efficient infiltration of the calcified cartilage matrix by
MMP9-expressing osteoclasts/chondroclasts.
VEGF produced by hypertrophic cartilage promotes angiogenesis, is activated
by MMP-mediated degradation of the cartilage matrix and is chemotactic for
osteoclasts (Gerber et al.,
1999; Haigh et al.,
2000). VEGF protein is expressed at low levels in maturing
chondrocytes at E14.5, and at high levels in hypertrophic chondrocytes of the
neonatal wild-type growth plate (Carlevaro
et al., 2000; Engsig et al.,
2000). By contrast, VEGF immunostaining per cell is diminished in
the expanded hypertrophic zone in newborn Ctgf mutants
(Fig. 9A). This decrease in
VEGF expression is seen only in the hypertrophic cartilage; expression in
osteoblasts (Horner et al.,
2001) is at normal levels (data not shown). We used
semi-quantitative RT-PCR to examine whether the reduced VEGF immunostaining in
Ctgf mutants is due to decreased VEGF mRNA levels (Fig.
9B,C).
At E14.5, when Vegf is expressed at low levels in perichondrium and
maturing chondrocytes (Zelzer et al.,
2002), no differences in levels of Vegf expression can be
detected in long bones of Ctgf mutants and wild-type littermates.
However, by birth, when Vegf mRNA is highly expressed in hypertrophic
chondrocytes, levels of Vegf mRNA are reduced in growth plates of
Ctgf mutants, despite the enlargement of the hypertrophic zone (Fig.
9B,C).
|
). However, no differences in levels of Cbfa1/Runx2
expression were observed in mutant growth plates, suggesting that CTGF acts
downstream of Cbfa1/Runx2, or in an independent pathway to induce
and/or maintain Vegf mRNA expression in hypertrophic chondrocytes
(Fig.
9B,C).
In summary, VEGF is a target of CTGF action in hypertrophic cartilage. Reduced
expression of this factor can account for the expanded zone of hypertrophy,
reduced numbers of MMP9-expressing cells at the growth plate and diminished
angiogenesis observed in Ctgf mutants. |
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Denton and
Abraham, 2001; Xu et al.,
2000b). However, the roles of CCN proteins in normal developmental
processes have received little attention. This study demonstrates that CTGF is
important for multiple aspects of chondrogenesis. CTGF regulates chondrocyte
proliferation, ECM synthesis and angiogenesis.
CTGF stimulates DNA synthesis in chondrocytes in vitro
(Nakanishi et al., 2000), and
chondrocyte proliferation is impaired in Ctgf-/- mice
(Fig. 4E,
Fig. 7A). Interestingly, in
spite of high levels of expression in perichondrium at E12.5, no differences
in rates of proliferation can be detected at this stage. Differences are first
detected at E14.5, when Ctgf expression occurs at the highest levels
in prehypertrophic and hypertrophic chondrocytes. This suggests that
Ctgf acts in a paracrine manner to control chondrocyte
proliferation.
Defects in ECM content in Ctgf mutants confer defective mechanical
properties on mutant cartilage. CTGF induces collagen and proteoglycan
synthesis in chondrocytes in vitro
(Nakanishi et al., 2000).
Interestingly, no differences in types II and X collagen expression were seen
in mutants. Therefore, although CTGF is a potent inducer of collagen synthesis
in chondrocytes in vitro (Nakanishi et
al., 2000), it is not required for collagen synthesis in vivo.
Compensatory pathways may restore types II and X collagen levels in
Ctgf mutants. The related CCN family member Cyr61
(Ccn1) is of particular interest in this regard. Cyr61 is
expressed in chondrocytes and induces the synthesis of collagen and other ECM
components in vitro (Wong et al.,
1997). Therefore, Ctgf and Cyr61 may have
overlapping roles in cartilage.
That CTGF is required in vivo for ECM production is demonstrated by the
severely reduced levels of aggrecan and link protein in the growth plates of
Ctgf mutants (Fig.
6D,E).
Parallels between the phenotypes of Ctgf mutants and mice deficient
in link protein (Crtl1) highlight the essential role played by CTGF
as a regulator of ECM content in cartilage. Link protein is an ECM component,
and is essential for the acquisition of tensile strength in cartilage
(Morgelin et al., 1994).
Crtl1 and Ctgf mutants have similar constellations of
defects: shortened mandibles, enlarged vertebrae, and bends and kinks in the
same subset of long bones. Finally, chondrocyte columns are disorganized and
endochondral ossification is delayed in both strains
(Watanabe and Yamada, 1999).
However, there are important differences between Ctgf and
Crtl1 mutants. Crtl1-/- mice exhibit more severe
reductions in proteoglycan levels, and a greater disorganization of the growth
plate. Moreover, Ctgf mutants exhibit defects in cell proliferation
and enlarged hypertrophic zones not seen in Crtl1 mutant mice.
Therefore, some, but not all, of the defects in Ctgf mutant cartilage
are caused by decreased proteoglycan content.
Our results show that CTGF is important for efficient recruitment of
MMP9-expressing cells to the growth plate
(Fig.8B-D). The crucial role
that MMPs play in ECM remodeling in skeletal tissues is illustrated by the
skeletal phenotypes of MMP-deficient mice
(Vu et al., 1998;
Zhou et al., 2000).
Recruitment of MMP9-expressing chondroclasts/osteoclasts to the growth plate
is dependent on VEGF (Engsig et al.,
2000). The paucity of these cells at the growth plates of
Ctgf mutants is probably due, at least in part, to the decreased
expression of VEGF in Ctgf-/- hypertrophic cartilage.
There are several mechanisms through which the reduced levels of MMP9 seen
in Ctgf mutants can lead to growth plate defects. MMP9 degrades
collagens and proteoglycans expressed in cartilage and is thus required for
ECM remodeling (D'Angelo et al.,
2001; Sternlicht and Werb,
2001). Therefore, loss of MMP expression would impair cartilage
ECM turnover. This is consistent with the suspected role of CTGF as a key
mediator of fibrotic responses, where matrix degradation and synthesis must
occur simultaneously (Martin,
1997). In addition, MMPs control angiogenesis, cell migration and
differentiation by cleaving cell surface molecules, growth factors and their
binding proteins (Sternlicht and Werb,
2001). For example, MMP9 can activate latent TGFß
(D'Angelo et al., 2001;
Yu and Stamenkovic, 2000). The
reduced levels of MMP9 in growth plates of Ctgf mutants is thus
expected to lead to changes in the distribution and activities of growth
factors such as TGFß.
CTGF may control MMP9 expression in several ways. MMP expression can be
induced by integrin-mediated interactions. CTGF, by altering ECM composition,
may alter integrin-induced MMP9 expression. CTGF can bind directly to
integrins to induce MMP transcription
(Chen et al., 2001a). CTGF
could also affect levels of MMP9 post-translationally by altering its
retention and/or degradation. This is especially interesting given that direct
associations occur between CTGF and LRP (low density lipoprotein
receptor-related protein), and between MMP9 and LRP
(Hahn-Dantona et al., 2001;
Segarini et al., 2001),
raising the possibility that CTGF controls clearance of MMPs by altering their
degradation via LRP-mediated endocytosis.
We show that CTGF acts as a cartilage matrix-associated molecule that
couples hypertrophy to growth plate angiogenesis and trabecular bone formation
(Figs 7,
8,
9). CTGF promotes
neovascularization through integrin-mediated signaling
(Babic et al., 1999), and
direct engagement of integrins is therefore one mechanism through which CTGF
may act in the growth plate. CTGF can also regulate angiogenesis by modulating
MMP expression, as MMPs directly activate integrins on endothelial cells to
induce angiogenic responses (Sternlicht
and Werb, 2001).
Our results also show that CTGF plays an important role in VEGF
localization in hypertrophic chondrocytes
(Fig. 9). VEGF is required for
growth plate angiogenesis (Gerber et al.,
1999; Haigh et al.,
2000). The mechanism by which VEGF expression in the growth plate
is controlled is not well understood. The transcription factor CBFA1/RUNX2 is
required for VEGF expression in hypertrophic cartilage
(Zelzer et al., 2001). The
observation that CBFA1/RUNX2 levels are not altered in Ctgf mutants
suggests that CTGF acts downstream of CBFA1/RUNX2, or in an independent
pathway. The transcription factor hypoxia inducible factor 1
(HIF1) is expressed by hypertrophic chondrocytes and is required, but
not sufficient, for VEGF expression
(Schipani et al., 2001).
HIF1-independent pathways are also essential, and one of these may
involve TGFß, as HIF1 and SMAD3 form a complex that
synergistically induces VEGF expression
(Sanchez-Elsner et al., 2001).
CTGF may interact with TGFß to induce VEGF expression, since CTGF binds
directly to TGFß, and enhances the ability of TGFß to interact with
its receptors (Abreu et al.,
2002). CTGF may also act independently of TGFß to induce VEGF
expression. For example, CTGF induces adhesive signaling in fibroblasts
through integrins, leading to activation of p42/44 MAPKs
(Chen et al., 2001a), and the
p42/44 MAPK pathway has been shown to be required for VEGF expression in
fibroblasts (Milanini et al.,
1998). These results raise the possibility that CTGF induces VEGF
expression via activation of p42/44. Whether a similar pathway controls VEGF
expression in hypertrophic chondrocytes is not yet known.
Secreted proteins controlling VEGF expression in the growth plate have not
been previously identified. In endothelial cells, VEGF induces CTGF expression
(Suzuma et al., 2000). Taken
together with our results, CTGF and VEGF may therefore participate in a
positive-feedback loop in hypertrophic chondrocytes. In addition to this
transcriptional control, CTGF appears to act post-translationally by binding
to VEGF, and impairing VEGF-induced angiogenesis
(Inoki et al., 2002). These
findings suggest that, in addition to its role as an inducer of VEGF
transcription, CTGF plays a role in regulating VEGF activity. CTGF may
sequester VEGF in an inactive form in the hypertrophic ECM through direct
physical association, and may regulate the release of active VEGF to induce
maximal angiogenic activity.
In summary, CTGF is important for chondrocyte proliferation, acquisition of
tensile strength by cartilage, ECM remodeling and growth plate angiogenesis. A
role for multiple members of the CCN family in angiogenesis and chondrogenesis
is likely. For example, both CTGF and Cyr61 promote neovascularization and
chondrogenesis in vitro (e.g., Chen et
al., 2001a; Kireeva et al.,
1997). Mice that lack Cyr61 die in midgestation because
of defects in nonsprouting angiogenesis within the placenta
(Mo et al., 2002). Thus, Cyr61
and CTGF have similar activities in vitro and are co-expressed, but regulate
distinct aspects of angiogenesis in vivo.
The related family member WISP3/CCN6 may also share overlapping functions
with CTGF. Although the sites of WISP3 expression and its in vitro activities
are unknown, loss of WISP3 in humans causes progressive pseudorheumatoid
dysplasia, a disease characterized by degeneration of articular cartilage
(Hurvitz et al., 1999).
Therefore, multiple members of the CCN family may be required for angiogenesis
and the formation and maintenance of cartilage. Analysis of double mutants
will provide insights into the roles of these genes in other developmental
processes.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Abbondanzo, S., Gadi, I. and Stewart, C. (1993). Derivation of embryonic stem cell lines. Methods Enzymol. 225,803 -823.[Medline]
Abreu, G., Ketpura, N., Reversade, B. and De Robertis, E. (2002). Connective-tissue growth factor (CTGF) modulates cell signalling by BMP and TGF-ß. Nat. Cell Biol. 4, 599-604.[Medline]
Ayer-Lelievre, C., Brigstock, D., Lau, L., Pennica, D., Perbal,
B. and Yeger, H. (2001). Report and abstracts on the first
international workshop on the CCN family of genes. Mol.
Pathol. 54,105
-120.
Babic, A. M., Chen, C.-C. and Lau, L. (1999).
Fisp12/mouse connective tissue growth factor mediates endothelial cell
adhesion and migration through integrin vß3,
promotes endothelial cell survival, and induces angiogenesis in vivo.
Mol. Cell. Biol. 19,2958
-2966.
Bitgood, M. J. and McMahon, A. P. (1995). Hedgehog and Bmp genes are coexpressed at many diverse sites of cell-cell interaction in the mouse embryo. Dev. Biol. 172,126 -138.[CrossRef][Medline]
Blom, I., van Dijk, A., Wieten, L., Duran, K., Ito, Y., Kleij,
L., deNichilo, M., Rabelink, T., Weening, J., Aten, J. et al.
(2001). In vitro evidence for differential involvement of CTGF,
TGFbeta, and PDGF-BB in mesangial response to injury. Nephrol.
Dial. Transplant. 16,1139
-1148.
Blom, I., Goldschmeding, R. and Leask, A. (2002). Gene regulation of connective tissue growth factor: new targets for antifibrotic therapy. Matrix Biol. 21,473 -482.[CrossRef][Medline]
Bork, P. (1993). The modular architecture of a new family of growth regulators related to connective tissue growth factor. FEBS Lett. 327,125 -130.[CrossRef][Medline]
Bornstein, P. (2001). Thrombospondins as matricellular modulators of cell function. J. Clin. Invest. 107,929 -934.[CrossRef][Medline]
Brigstock, D. R., Steffen, C. L., Kim, G. Y., Vegunta, R. K.,
Diehl, J. R. and Harding, P. A. (1997). Purification and
characterization of novel heparin-binding growth factors in uterine secretory
fluids. J. Biol. Chem.
272,20275
-20282.
Carlevaro, M., Cermelli, S., Cancedda, R. and Descalzi Cancedda, F. (2000). Vascular endothelial growth factor (VEGF) in cartilage neovascularization and chondrocyte differentiation: auto-paracrine role during endochondral bone formation. J. Cell Sci. 113, 59-69.[Abstract]
Chen, C.-C., Chen, N. and Lau, L. (2001a). The
angiogenic factors Cyr61 and connective tissue growth factor induce adhesive
signaling in primary human skin fibroblasts. J. Biol.
Chem. 276,10443
-10452.
Chen, C.-C., Mo, F.-E. and Lau, L. (2001b). The
angiogenic factor Cyr61 activates a genetic program for wound healing in human
skin fibroblasts. J. Biol. Chem.
276,47329
-47337.
D'Angelo, M., Billings, P., Pacifici, M., Leboy, P. and Kirsch,
T. (2001). Authentic matrix vesicles contain active
metalloproteinases (MMP). J. Biol. Chem.
276,11347
-11353.
Dammeier, J., Brauchle, M., Falk, W., Grotendorst, G. and Werner, S. (1998). Connective tissue growth factor: a novel regulator of mucosal repair and fibrosis in inflammatory bowel disease? Int. J. Biochem. Cell Biol. 30,909 -922.[CrossRef][Medline]
Denton, C. and Abraham, D. (2001). Transforming growth factor-beta and connective tissue growth factor: key cytokines in scleroderma pathogenesis. Curr. Opin. Rheumatol. 13,505 -511.[CrossRef][Medline]
Engsig, M., Chen, Q.-J., Vu, T., Pedersen, A.-C., Therkidsen,
B., Lund, L., Henriksen, K., Lenhard, T., Foged, N., Werb, Z. et al.
(2000). Matrix metalloproteinase 9 and vascular endothelial
growth factor are essential for osteoclast recruitment into developing long
bones. J. Cell Biol.
151,879
-889.
Fan, W.-H. and Karnovsky, M. (2002). Increased
MMP-2 expression in connective tissue growth factor over-expression vascular
smooth muscle cells. J. Biol. Chem.
277,9800
-9805.
Frazier, K., Williams, S., Kothapalli, D., Klapper, H. and Grotendorst, G. R. (1996). Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J. Invest. Dermatol. 107,404 -411.[CrossRef][Medline]
Gerber, H.-P., Vu, T., Ryan, A., Kowalski, J., Werb, Z. and Ferrara, N. (1999). VEGF couples hypertrophic cartilage remodeling, ossification and angiogenesis during endochondral bone formation. Nat. Med. 55,623 -628.
Grotendorst, G. (1997). Connective tissue growth factor: a mediator of TGF-ß action on fibroblasts. Cytokine Growth Factor Rev. 8, 171-179.[CrossRef][Medline]
Hahn-Dantona, E., Ruiz, J., Bornstein, P. and Strickland, D.
(2001). The low density lipoprotein receptor-related protein
modulates levels of matrix metalloproteinase 9 (MMP-9_ by mediating its
cellular catabolism. J. Biol. Chem.
276,15498
-15503.
Haigh, J., Gerber, H.-P., Ferrara, N. and Wagner, E. (2000). Conditional inactivation of VEGF-A in areas of collagen2a1 expression results in embryonic lethality in the heterozygous state. Development 127,1445 -1453.[Abstract]
Hashimoto, G., Inoki, I., Fujii, Y., Aoki, T., Ikeda, E. and
Okada, Y. (2002). Matrix metalloproteinases cleave connective
tissue growth factor and reactivate angiogenic activity of vascular
endothelial growth factor 165. J. Biol. Chem.
277,36288
-66295.
Hogan, B. L. M., Beddington, R., Costantini, F. and Lacy, E. (1994). Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Holmes, A., Abraham, D., Sa, S., Shiwen, X., Black, C. and
Leask, A. (2001). CTGF and SMADs, Maintenance of scleroderma
phenotype is independent of SMAD signaling. J. Biol.
Chem. 276,10594
-10601.
Horner, A., Bord, S., Kelsall, A., Coleman, N. and Compston, J. (2001). Tie2 ligands angiopoietin-1 and angiopoietin-2 are coexpressed with vascular endothelial cell growth factor in growing human bone. Bone 28,65 -71.[Medline]
Hurvitz, J., Suwairi, W., Van Hul, W., El-Shanti, H., Superti-Furga, A., Roudier, J., Holdermaum, D., Pauli, R., Herd, J., Van Hul, E. et al. (1999). Mutations in the CCN gene family member WISP3 cause progressive pseudorheumatoid dysplasia. Nat. Genet. 23,94 -98.[CrossRef][Medline]
Inoki, I., Shiomi, T., Hashimoto, G., Enomoto, H., Nakamura, H.,
Makino, K.-i., Ikeda, E., Takata, S., Kobayashi, K. and Okada, Y.
(2002). Connective tissue growth factor binds vascular
endothelial growth factor (VEGF) and inhibits VEGF-induced angiogenesis.
FASEB J. 16,219
-221.
Jedsadayanmata, A., Chen, C.-C., Kireeva, M. L., Lau, L. F. and
Lam, S. (1999). Activation-dependent adhesion of human
platelets to Cyr61 and Fisp12/mouse connective tissue growth factor is
mediated through integrin IIbß3. J. Biol.
Chem. 274,24321
-24327.
Kireeva, M. L., Latinkic, B., Kolesnikova, T. V., Chen, C.-C., Yang, G., Abler, A. and Lau, L. (1997). Cyr61 and Fisp12 are both ECM-associated signaling molecules: activities, metabolism, and localization during development. Exp. Cell Res. 233, 63-77.[CrossRef][Medline]
Lasky, J., Ortiz, L., Tonthat, B., Hoyle, G., Corti, M., Athas, G., Lungarella, G., Brody, A. and M., F. (1998). Connective tissue growth factor mRNA expression is upregulated in bleomycin-induced lung fibrosis. Am. J. Physiol. 275,L365 -L371.
Lau, L. and Lam, S. (1999). The CCN family of angiogenic regulators: the integrin connection. Exp. Cell Res. 248,44 -57.[CrossRef][Medline]
Leu, S.-J., Lam, S.-T. and Lau, L. (2002).
Proangiogenic activities of CYR61 (CCN1) mediated through integrins
vß3 and
6ß1 in human umbilical vein endothelial
cells. J. Biol. Chem.
277,46248
-46250.
Long, F., Zhang, X. M., Karp, S., Yang, Y. and McMahon, A. (2001). Genetic manipulation of hedgehog signaling in the endorchondral skeleton reveals a direct role in the regulation of chondrocyte proliferation. Development 128,5099 -5108.
Martin, P. (1997). Wound healing-aiming for
perfect skin regeneration. Science
276, 75-81.
Milanini, J., Viñals, F., Pouysségur, J. and
Pagés, G. (1998). p42/44 MAP kinase module plays a key
role in the transcriptional regulation of the vascular endothelial growth
factor gene in fibroblasts. J. Biol. Chem.
273,18165
-18172.
Mo, F.-E., Muntean, A., Chen, C.-C., Stolz, D., Watkins, S. and
Lau, L. (2002). CYR61 (CCN1) is essential from placental
development and vascular integrity. Mol. Cell Biol.
22,8709
-8720.
Morgelin, M., Heinegard, D., Engel, J. and Paulsson, M. (1994). The cartilage proteoglycan aggregate: assembly through combined protein-carbohydrate and protein-protein interactions. Biophys. Chem. 50,113 -128.[CrossRef][Medline]
Mori, T., Kawara, S., Shinozaki, M., Hayashi, N., Kakinuma, T., Igarashi, A., Takigawa, M., Nakanishi, T. and Takehara, K. (1999). Role and interaction of connective tissue growth factor with transforming growth factor-beta in persistent fibrosis: A mouse fibrosis model. J. Cell Physiol. 181,153 -159.[CrossRef][Medline]
Moussad, E. E. and Brigstock, D. (2000). Connective Tissue Growth Factor: What's in a Name? Mol. Genet. Metab. 71,276 -292.[CrossRef][Medline]
Nakanishi, T., Nishida, T., Shimo, T., Kobayashi, K., Kubo, T.,
Tamatani, T., Tezuka, K. and Takigawa, M. (2000). Effects of
CTGF/Hcs24, a product of a hypertrophic chondrocyte-specific gene, on the
proliferation and differentiation of chondrocytes in culture.
Endocrinology 141,264
-273.
Nishida, T., Nakanishi, T., Asano, M., Shimo, T. and Takigawa, M. (2000). Effects of CTGF/Hcs24, a hypertrophic chondrocyte-specific gene product, on the proliferation and differentiation of osteoblastic cells in vitro. J. Cell. Physiol. 184,197 -206.[CrossRef][Medline]
Perbal, B. (2001). NOV (nephroblastoma
overexpressed) and the CCN family of genes: structural and functional issues.
Mol. Pathol. 54,57
-79.
Ramírez-Solis, R., Davis, A. C. and Bradley, A. (1993). Gene targeting in embryonic stem cells. In Guide to Techniques in Mouse Development, Vol.225 (ed. P. M. Wassarman and M. L. DePamphilis), pp.855 -878. San Diego: Academic Press.[CrossRef]
Reponen, P., Sahlberg, C., Munaut, C., Thesleff, I. and
Tryggvason, K. (1994). High expression of 92-kD ype IV
collagenase (gelatinase B) in teh osteoclast lineage during mouse development.
J. Cell Biol. 124,1091
-1102.
Sanchez-Elsner, T., Botella, L., Velasco, B., Corbi, A.,
Attisano, L. and Bernabéu, C. (2001). Synergistic
cooperation between hypoxia and transforming growth factor-ß pathways on
human vascular endothelial growth factor gene expression. J. Biol.
Chem. 276,38527
-38535.
Schipani, E., Ryan, E., Didrickson, S., Kobayashi, K., Knight,
M. and Johnson, R. (2001). Hypoxia in cartilage: HIF-1
is essential for chondrocyte growth arrest and survival. Genes
Dev. 15,2865
-2876.
Segarini, P., Nesbitt, J., Li, D., Hayes, L., Yates, J. I. and
Carmichael, D. (2001). The low density lipoprotein
receptor-related protein/alpha 2-macroglobulin receptor is a receptor for
connective tissue growth factor (CTGF). J. Biol. Chem.
276,40659
-40667.
Shimo, T., Nakanishi, T., Nishida, T., Asano, M., Kanyama, M.,
Kuboki, T., Tamatani, T., Tezuka, K., Takemura, M., Matsumma, T. et al.
(1999). Connective tissue growth factor induces the
proliferation, migration, and tube formation of vascular endothelial cells in
vitro, and angiogenesis in vivo. J. Biochem.
126,137
-145.
St-Jacques, B., Hammerschmidt, M. and McMahon, A.
(1999). Indian hedgehog signaling regulates proliferation and
differentiation of chondrocytes and is essential for bone formation.
Genes Dev. 13,2072
-2086.
Sternlicht, M. and Werb, Z. (2001). How matrix metalloproteinases regulate cell behavior. Annu. Rev. Cell Dev. Biol. 17,463 -516.[CrossRef][Medline]
Stratton, R., Shiwen, X., Martini, G., Holmes, A., Leask, A., Haberberger, T., Martin, G., Black, C. and Abraham, D. (2001). Iloprost suppresses connective tissue growth factor production in fibroblasts and in the skin of scleroderma patients. J. Clin. Invest. 108,241 -250.[CrossRef][Medline]
Suzuma, K., Naruse, K., Suzuma, I., Takahara, N., Ueki, K.,
Aiello, L. and King, G. (2000). Vascular endothelial growth
factor induces expression of connective tissue growth factor via KDR, Flt1,
and phosphatidylinositol 3-kinase-Akt-dependent pathways in retinal vascular
cells. J. Biol. Chem.
275,40725
-40731.
Vu, T. H., Shipley, J. M., Bergers, G., Berger, J. E., Helms, J. A., Hanahan, D., Shapiro, S. D., Senior, R. M. and Werb, Z. (1998). MMP-9/Gelatinase B is a key Regulator of Growth Plate Angiogenesis and Apoptosis of Hypertrophic Chondrocytes. Cell 93,411 -422.[CrossRef][Medline]
Watanabe, H. and Yamada, Y. (1999). Mice lacking link protein develop dwarfism and craniofacial abnormalities. Nat. Genet. 21,225 -229.[CrossRef][Medline]
Wong, M., Kireeva, M. L., Kolesnikova, T. V. and Lau, L. F. (1997). Cyr61, product of a growth factor-inducible imediate-early gene regulates chondrogenesis in mouse limb bud mesenchymal cells. Dev. Biol. 192,492 -508.[CrossRef][Medline]
Xu, J., Smock, S., Safadi, F. F., Rosenzweig, A. B., Odgen, P. R., Marks, S. C., Jr, Owen, T. A. and Popoff, S. N. (2000a). Cloning the full length cDNA for rat connective tissue growth factor: implications for skeletal development. J. Cell. Biochem. 77,103 -115.[Medline]
Xu, L., Corcoran, R., Welsh, J., Pennica, D. and Levine, A.
(2000b). WISP1 is a Wnt-1- and ß-catenin-responsive
oncogene. Genes Dev. 14,585
-595.
Yi, S. E., Daluiski, A., Pederson, R., Rosen, V. and Lyons, K. M. (2000). The type I BMP receptor BMPRIB is required for chondrogenesis in the mouse limb. Development 127,621 -630.[Abstract]
Yu, Q. and Stamenkovic, I. (2000). Cell
surface-localized matrix metalloproteinase-9 proteolytically activates
TGF-ß and promotes tumor invasion and angiogenesis. Genes
Dev. 14,163
-176.
Zelzer, E., Glotzer, D., Hartmann, C., Thomas, D., Fukai, N., Soker, S. and Olsen, B. (2001). Tissue specific regulation of VEGF expression during bone development requires Cbfa1/Runx2. Mech. Dev. 106,97 -106.[CrossRef][Medline]
Zelzer, E., McLean, W., Ng, Y.-S., Fukai, N., Reginato, A., Lovejoy, S., D'Amore, P. and Olsen, B. (2002). Skeletal defects in VEGF120/120 mice reveal multiple roles for VEGF in skeletogenesis. Development 129,1893 -1904.
Zhou, Z., Apte, S., Soininen, R., Cao, R., Baaklini, G., Rauser,
R., Wang, J., Cao, Y. and Tryggvason, K. (2000). Impaired
endochondral ossificiation and angiogenesis in mice deficient in membrane-type
matrix metalloporteinase I. Proc. Natl. Acad. Sci. USA
97,4052
-4057.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  T. Vogel, S. Ahrens, N. Buttner, and K. Krieglstein Transforming Growth Factor {beta} Promotes Neuronal Cell Fate of Mouse Cortical and Hippocampal Progenitors In Vitro and In Vivo: Identification of Nedd9 as an Essential Signaling Component Cereb Cortex, July 8, 2009; (2009) bhp134v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Juric, C.-C. Chen, and L. F. Lau Fas-Mediated Apoptosis Is Regulated by the Extracellular Matrix Protein CCN1 (CYR61) In Vitro and In Vivo Mol. Cell. Biol., June 15, 2009; 29(12): 3266 - 3279. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zheng, Y. Chen, B. Pat, L. A. Dell'Italia, M. Tillson, A. R. Dillon, P. C. Powell, K. Shi, N. Shah, T. Denney, et al. Microarray Identifies Extensive Downregulation of Noncollagen Extracellular Matrix and Profibrotic Growth Factor Genes in Chronic Isolated Mitral Regurgitation in the Dog Circulation, April 21, 2009; 119(15): 2086 - 2095. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. N. Retting, B. Song, B. S. Yoon, and K. M. Lyons BMP canonical Smad signaling through Smad1 and Smad5 is required for endochondral bone formation Development, April 1, 2009; 136(7): 1093 - 1104. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. Crawford, M. A. Guney, Y. A. Oh, R. A. DeYoung, D. M. Valenzuela, A. J. Murphy, G. D. Yancopoulos, K. M. Lyons, D. R. Brigstock, A. Economides, et al. Connective Tissue Growth Factor (CTGF) Inactivation Leads to Defects in Islet Cell Lineage Allocation and {beta}-Cell Proliferation during Embryogenesis Mol. Endocrinol., March 1, 2009; 23(3): 324 - 336. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Maeda, T. Nishida, E. Aoyama, S. Kubota, K. M. Lyons, T. Kuboki, and M. Takigawa CCN Family 2/Connective Tissue Growth Factor Modulates BMP Signalling as a Signal Conductor, Which Action Regulates the Proliferation and Differentiation of Chondrocytes J. Biochem., February 1, 2009; 145(2): 207 - 216. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. F. Duisters, A. J. Tijsen, B. Schroen, J. J. Leenders, V. Lentink, I. van der Made, V. Herias, R. E. van Leeuwen, M. W. Schellings, P. Barenbrug, et al. miR-133 and miR-30 Regulate Connective Tissue Growth Factor: Implications for a Role of MicroRNAs in Myocardial Matrix Remodeling Circ. Res., January 30, 2009; 104(2): 170 - 178. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Turgeon and S. Meloche Interpreting Neonatal Lethal Phenotypes in Mouse Mutants: Insights Into Gene Function and Human Diseases Physiol Rev, January 1, 2009; 89(1): 1 - 26. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ota and H. Sasaki Mammalian Tead proteins regulate cell proliferation and contact inhibition as transcriptional mediators of Hippo signaling Development, December 15, 2008; 135(24): 4059 - 4069. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Xiong, R. E. Peterson, and W. Heideman Aryl Hydrocarbon Receptor-Mediated Down-Regulation of Sox9b Causes Jaw Malformation in Zebrafish Embryos Mol. Pharmacol., December 1, 2008; 74(6): 1544 - 1553. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Q. Nguyen, P. Roestenberg, F. A. van Nieuwenhoven, N. Bovenschen, Z. Li, L. Xu, N. Oliver, J. Aten, J. A. Joles, C. Vial, et al. CTGF Inhibits BMP-7 Signaling in Diabetic Nephropathy J. Am. Soc. Nephrol., November 1, 2008; 19(11): 2098 - 2107. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Leask, X. Shi-wen, K. Khan, Y. Chen, A. Holmes, M. Eastwood, C. P. Denton, C. M. Black, and D. J. Abraham Loss of protein kinase C{epsilon} results in impaired cutaneous wound closure and myofibroblast function J. Cell Sci., October 15, 2008; 121(20): 3459 - 3467. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Abraham Connective tissue growth factor: growth factor, matricellular organizer, fibrotic biomarker or molecular target for anti-fibrotic therapy in SSc? Rheumatology, October 1, 2008; 47(suppl_5): v8 - v9. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Smerdel-Ramoya, S. Zanotti, L. Stadmeyer, D. Durant, and E. Canalis Skeletal Overexpression of Connective Tissue Growth Factor Impairs Bone Formation and Causes Osteopenia Endocrinology, September 1, 2008; 149(9): 4374 - 4381. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Smerdel-Ramoya, S. Zanotti, V. Deregowski, and E. Canalis Connective Tissue Growth Factor Enhances Osteoblastogenesis in Vitro J. Biol. Chem., August 15, 2008; 283(33): 22690 - 22699. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. J. Kuiper, R. van Zijderveld, P. Roestenberg, K. M. Lyons, R. Goldschmeding, I. Klaassen, C. J.F. Van Noorden, and R. O. Schlingemann Connective Tissue Growth Factor Is Necessary for Retinal Capillary Basal Lamina Thickening in Diabetic Mice J. Histochem. Cytochem., August 1, 2008; 56(8): 785 - 792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Rimon, B. Chen, A. L. Shanks, D. M. Nelson, and Y. Sadovsky Hypoxia in Human Trophoblasts Stimulates the Expression and Secretion of Connective Tissue Growth Factor Endocrinology, June 1, 2008; 149(6): 2952 - 2958. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. C. Owen, S. J. Roberts, S. F. Ahmed, and C. Farquharson Dexamethasone-induced expression of the glucocorticoid response gene lipocalin 2 in chondrocytes Am J Physiol Endocrinol Metab, June 1, 2008; 294(6): E1023 - E1034. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Pala, M. Kapoor, A. Woods, L. Kennedy, S. Liu, S. Chen, L. Bursell, K. M. Lyons, D. E. Carter, F. Beier, et al. Focal Adhesion Kinase/Src Suppresses Early Chondrogenesis: CENTRAL ROLE OF CCN2 J. Biol. Chem., April 4, 2008; 283(14): 9239 - 9247. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Eguchi, S. Kubota, K. Kawata, Y. Mukudai, J. Uehara, T. Ohgawara, S. Ibaragi, A. Sasaki, T. Kuboki, and M. Takigawa Novel Transcription Factor-Like Function of Human Matrix Metalloproteinase 3 Regulating the CTGF/CCN2 Gene Mol. Cell. Biol., April 1, 2008; 28(7): 2391 - 2413. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Chintalapudi, M. Markiewicz, N. Kose, V. Dammai, K. J. Champion, R. S. Hoda, M. Trojanowska, and T. Hsu Cyr61/CCN1 and CTGF/CCN2 mediate the proangiogenic activity of VHL-mutant renal carcinoma cells Carcinogenesis, April 1, 2008; 29(4): 696 - 703. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Perbal, M. Zuntini, D. Zambelli, M. Serra, M. Sciandra, L. Cantiani, E. Lucarelli, P. Picci, and K. Scotlandi Prognostic Value of CCN3 in Osteosarcoma Clin. Cancer Res., February 1, 2008; 14(3): 701 - 709. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Oka, S. Kubota, S. Kondo, T. Eguchi, C. Kuroda, K. Kawata, S. Minagi, and M. Takigawa Gene Expression and Distribution of Connective Tissue Growth Factor (CCN2/CTGF) During Secondary Ossification Center Formation J. Histochem. Cytochem., December 1, 2007; 55(12): 1245 - 1255. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Pandey, S. M. Umphress, Y. Kang, J. Angdisen, A. Naumova, K. L. Mercer, T. Jacks, and S. B. Jakowlew Modulation of tumor induction and progression of oncogenic K-ras-positive tumors in the presence of TGF- 1 haploinsufficiency Carcinogenesis, December 1, 2007; 28(12): 2589 - 2596. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. J. Kuiper, P. Roestenberg, C. Ehlken, V. Lambert, H. B. van Treslong-de Groot, K. M. Lyons, H.-J. T. Agostini, J.-M. Rakic, I. Klaassen, C. J.F. Van Noorden, et al. Angiogenesis Is Not Impaired in Connective Tissue Growth Factor (CTGF) Knock-out Mice J. Histochem. Cytochem., November 1, 2007; 55(11): 1139 - 1147. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Dai and A.B.M. Rabie VEGF: an Essential Mediator of Both Angiogenesis and Endochondral Ossification Journal of Dental Research, October 1, 2007; 86(10): 937 - 950. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S.P. Ho, K. Y. Tsang, R. L.K. Lo, M. Susic, O. Makitie, T. W.Y. Chan, V. C.W. Ng, D. O. Sillence, R. P. Boot-Handford, G. Gibson, et al. COL10A1 nonsense and frame-shift mutations have a gain-of-function effect on the growth plate in human and mouse metaphyseal chondrodysplasia type Schmid Hum. Mol. Genet., May 15, 2007; 16(10): 1201 - 1215. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Wu, J. Peng, M. R. Duncan, K. Kasisomayajula, G. Grotendorst, and E. Bancalari ALK-5 Mediates Endogenous and TGF-beta1-Induced Expression of Connective Tissue Growth Factor in Embryonic Lung Am. J. Respir. Cell Mol. Biol., May 1, 2007; 36(5): 552 - 561. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kita, Y. Hata, M. Miura, S. Kawahara, S. Nakao, and T. Ishibashi Functional Characteristics of Connective Tissue Growth Factor on Vitreoretinal Cells Diabetes, May 1, 2007; 56(5): 1421 - 1428. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Ruiz-Ortega, J. Rodriguez-Vita, E. Sanchez-Lopez, G. Carvajal, and J. Egido TGF-{beta} signaling in vascular fibrosis Cardiovasc Res, May 1, 2007; 74(2): 196 - 206. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Sala-Torra, H. M. Gundacker, D. L. Stirewalt, P. A. Ladne, E. L. Pogosova-Agadjanyan, M. L. Slovak, C. L. Willman, S. Heimfeld, D. H. Boldt, and J. P. Radich Connective tissue growth factor (CTGF) expression and outcome in adult patients with acute lymphoblastic leukemia Blood, April 1, 2007; 109(7): 3080 - 3083. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Pummila, I. Fliniaux, R. Jaatinen, M. J. James, J. Laurikkala, P. Schneider, I. Thesleff, and M. L. Mikkola Ectodysplasin has a dual role in ectodermal organogenesis: inhibition of Bmp activity and induction of Shh expression Development, January 1, 2007; 134(1): 117 - 125. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Leask and D. J. Abraham All in the CCN family: essential matricellular signaling modulators emerge from the bunker J. Cell Sci., December 1, 2006; 119(23): 4803 - 4810. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Melrose, P. Roughley, S. Knox, S. Smith, M. Lord, and J. Whitelock The Structure, Location, and Function of Perlecan, a Prominent Pericellular Proteoglycan of Fetal, Postnatal, and Mature Hyaline Cartilages J. Biol. Chem., December 1, 2006; 281(48): 36905 - 36914. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F.-E Mo and L. F. Lau The Matricellular Protein CCN1 Is Essential for Cardiac Development Circ. Res., October 27, 2006; 99(9): 961 - 969. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. van der Weyden, L. Wei, J. Luo, X. Yang, D. E. Birk, D. J. Adams, A. Bradley, and Q. Chen Functional Knockout of the Matrilin-3 Gene Causes Premature Chondrocyte Maturation to Hypertrophy and Increases Bone Mineral Density and Osteoarthritis Am. J. Pathol., August 1, 2006; 169(2): 515 - 527. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Mou, B. Jackson, P. Schneider, P. A. Overbeek, and D. J. Headon Generation of the primary hair follicle pattern PNAS, June 13, 2006; 103(24): 9075 - 9080. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Aikawa, J. Gunn, S. M. Spong, S. J. Klaus, and M. Korc Connective tissue growth factor-specific antibody attenuates tumor growth, metastasis, and angiogenesis in an orthotopic mouse model of pancreatic cancer Mol. Cancer Ther., May 1, 2006; 5(5): 1108 - 1116. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Shi-wen, L. A. Stanton, L. Kennedy, D. Pala, Y. Chen, S. L. Howat, E. A. Renzoni, D. E. Carter, G. Bou-Gharios, R. J. Stratton, et al. CCN2 Is Necessary for Adhesive Responses to Transforming Growth Factor-beta1 in Embryonic Fibroblasts J. Biol. Chem., April 21, 2006; 281(16): 10715 - 10726. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z.-Y. Tong and D. R Brigstock Intrinsic biological activity of the thrombospondin structural homology repeat in connective tissue growth factor. J. Endocrinol., March 1, 2006; 188(3): R1 - R8. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. P. Hall, F. R. Westwood, and P. F. Wadsworth Review of the Effects of Anti-Angiogenic Compounds on the Epiphyseal Growth Plate Toxicol Pathol, February 1, 2006; 34(2): 131 - 147. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Sozo, M. J. Wallace, V. A. Zahra, C. E. Filby, and S. B. Hooper Gene expression profiling during increased fetal lung expansion identifies genes likely to regulate development of the distal airways Physiol Genomics, January 12, 2006; 24(2): 105 - 113. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. M. Berquin, Y. Min, R. Wu, H. Wu, and Y. Q. Chen Expression Signature of the Mouse Prostate J. Biol. Chem., October 28, 2005; 280(43): 36442 - 36451. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Gazzerro, V. Deregowski, S. Vaira, and E. Canalis Overexpression of Twisted Gastrulation Inhibits Bone Morphogenetic Protein Action and Prevents Osteoblast Cell Differentiation in Vitro Endocrinology, September 1, 2005; 146(9): 3875 - 3882. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. S. Yoon, D. A. Ovchinnikov, I. Yoshii, Y. Mishina, R. R. Behringer, and K. M. Lyons Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo PNAS, April 5, 2005; 102(14): 5062 - 5067. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. G. Lin, C.-C. Chen, S.-J. Leu, T. M. Grzeszkiewicz, and L. F. Lau Integrin-dependent Functions of the Angiogenic Inducer NOV (CCN3): IMPLICATION IN WOUND HEALING J. Biol. Chem., March 4, 2005; 280(9): 8229 - 8237. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Mukudai, S. Kubota, T. Eguchi, S. Kondo, K. Nakao, and M. Takigawa Regulation of Chicken ccn2 Gene by Interaction between RNA cis-Element and Putative trans-Factor during Differentiation of Chondrocytes J. Biol. Chem., February 4, 2005; 280(5): 3166 - 3177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. E. Kutz, Y. Gong, and M. L. Warman WISP3, the Gene Responsible for the Human Skeletal Disease Progressive Pseudorheumatoid Dysplasia, Is Not Essential for Skeletal Function in Mice Mol. Cell. Biol., January 1, 2005; 25(1): 414 - 421. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. A. van Nieuwenhoven, L. J. N. Jensen, A. Flyvbjerg, and R. Goldschmeding Imbalance of growth factor signalling in diabetic kidney disease: is connective tissue growth factor (CTGF, CCN2) the perfect intervention point? Nephrol. Dial. Transplant., January 1, 2005; 20(1): 6 - 10. [Full Text] [PDF]
|
|
|
|
|
|
Q. Luo, Q. Kang, W. Si, W. Jiang, J. K. Park, Y. Peng, X. Li, H. H. Luu, J. Luo, A. G. Montag, et al. Connective Tissue Growth Factor (CTGF) Is Regulated by Wnt and Bone Morphogenetic Proteins Signaling in Osteoblast Differentiation of Mesenchymal Stem Cells J. Biol. Chem., December 31, 2004; 279(53): 55958 - 55968. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. F. Higgins, M. P. Biju, Y. Akai, A. Wutz, R. S. Johnson, and V. H. Haase Hypoxic induction of Ctgf is directly mediated by Hif-1 Am J Physiol Renal Physiol, December 1, 2004; 287(6): F1223 - F1232. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Chen, D. J. Abraham, X. Shi-wen, J. D. Pearson, C. M. Black, K. M. Lyons, and A. Leask CCN2 (Connective Tissue Growth Factor) Promotes Fibroblast Adhesion to Fibronectin Mol. Biol. Cell, December 1, 2004; 15(12): 5635 - 5646. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Melrose, S. Smith, and J. Whitelock Perlecan Immunolocalizes to Perichondrial Vessels and Canals in Human Fetal Cartilaginous Primordia in Early Vascular and Matrix Remodeling Events Associated with Diarthrodial Joint Development J. Histochem. Cytochem., November 1, 2004; 52(11): 1405 - 1413. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Leu, N. Chen, C.-C. Chen, V. Todorovic, T. Bai, V. Juric, Y. Liu, G. Yan, S. C.-T. Lam, and L. F. Lau Targeted Mutagenesis of the Angiogenic Protein CCN1 (CYR61): SELECTIVE INACTIVATION OF INTEGRIN {alpha}6{beta}1-HEPARAN SULFATE PROTEOGLYCAN CORECEPTOR-MEDIATED CELLULAR FUNCTIONS J. Biol. Chem., October 15, 2004; 279(42): 44177 - 44187. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Yokoi, M. Mukoyama, T. Nagae, K. Mori, T. Suganami, K. Sawai, T. Yoshioka, M. Koshikawa, T. Nishida, M. Takigawa, et al. Reduction in Connective Tissue Growth Factor by Antisense Treatment Ameliorates Renal Tubulointerstitial Fibrosis J. Am. Soc. Nephrol., June 1, 2004; 15(6): 1430 - 1440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Shi-wen, S. L. Howat, E. A. Renzoni, A. Holmes, J. D. Pearson, M. R. Dashwood, G. Bou-Gharios, C. P. Denton, R. M. du Bois, C. M. Black, et al. Endothelin-1 Induces Expression of Matrix-associated Genes in Lung Fibroblasts through MEK/ERK J. Biol. Chem., May 28, 2004; 279(22): 23098 - 23103. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. LEASK and D. J. ABRAHAM TGF-{beta} signaling and the fibrotic response FASEB J, May 1, 2004; 18(7): 816 - 827. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Mercurio, B. Latinkic, N. Itasaki, R. Krumlauf, and J. C. Smith Connective-tissue growth factor modulates WNT signalling and interacts with the WNT receptor complex Development, May 1, 2004; 131(9): 2137 - 2147. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Zelzer, R. Mamluk, N. Ferrara, R. S. Johnson, E. Schipani, and B. R. Olsen VEGFA is necessary for chondrocyte survival during bone development Development, May 1, 2004; 131(9): 2161 - 2171. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Dickmeis, C. Plessy, S. Rastegar, P. Aanstad, R. Herwig, F. Chalmel, N. Fischer, and U. Strahle Expression Profiling and Comparative Genomics Identify a Conserved Regulatory Region Controlling Midline Expression in the Zebrafish Embryo Genome Res., February 1, 2004; 14(2): 228 - 238. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. G. Lin, S.-J. Leu, N. Chen, C. M. Tebeau, S.-X. Lin, C.-Y. Yeung, and L. F. Lau CCN3 (NOV) Is a Novel Angiogenic Regulator of the CCN Protein Family J. Biol. Chem., June 20, 2003; 278(26): 24200 - 24208. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
