|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00461
DEVELOPMENT AND DISEASE |




1 Department of Biology and Biochemistry, University of Bath, Bath BA2 7AY,
UK
2 Department of Biological Structure, University of Washington, Seattle, WA
98195-7420, USA
* Present address: Centre for Developmental Genetics, Department of Biomedical
Science, University of Sheffield, Sheffield S10 2TN, UK
Authors for correspondence (e-mail:
bssrnk{at}bath.ac.uk
and
draible{at}u.washington.edu)
Accepted 26 February 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Zebrafish, Danio rerio, Neural crest, Fate specification, Melanocyte, sox10, colourless, mitf, nacre, Survival, Transcriptional regulation
| INTRODUCTION |
|---|
|
|
|---|
Zebrafish or mice homozygous for mutations in the sox10
transcription factor gene [previously called colourless
(cls) in zebrafish] have severe defects in all the nonectomesenchymal
neural crest cell fates (Dutton et al.,
2001
; Herbarth et al.,
1998
; Kelsh and Eisen,
2000
; Southard-Smith et al.,
1998
). In cls/sox10-/- zebrafish many neural
crest cells undergo apotoptic cell death near the neural tube. They do so
after failing to become specified or migrate
(Dutton et al., 2001
).
Apoptotic death of cells on the neural crest migration pathways has also been
reported in Sox10-/- mouse embryos
(Kapur, 1999
). In
cls/sox10-/- zebrafish and in Sox10-/-
mouse embryos some of the nonectomesenchymal neural crest cell fates such as
melanocytes (also called melanophores in zebrafish) and peripheral glia are
essentially absent whereas others such as the dorsal root ganglia sensory
neurons do form but with fewer and disorganized cells
(Britsch et al., 2001
;
Kelsh and Eisen, 2000
;
Sonnenberg-Riethmacher et al.,
2001
; Southard-Smith et al.,
1998
).
In mammalian systems it has been shown that in the case of the peripheral
glia a major requirement of Sox10 is to directly regulate expression
of terminal differentiation genes such as P0 and
Cx32 (Gjb1 Mouse Genome Informatics)
(Bondurand et al., 2001
;
Peirano et al., 2000
).
Sox10 also regulates expression of the neuregulin receptor gene,
Erbb3 (Britsch et al.,
2001
). Signaling through Erbb3 promotes acquisition of
the glial fate by neural crest cells and is required for peripheral glial cell
migration and survival (Paratore et al.,
2001
). However it is not known whether this Erbb3
regulation by Sox10 is direct.
In the case of melanocytes it is not clear to what extent Sox10 is
required for direct transcriptional regulation of terminal differentiation
genes. One plausible hypothesis is that in the melanocyte lineage
Sox10 is simply required for direct activation of the Mitf
transcription factor gene, which then acts as a master regulator of melanocyte
cell fate. Evidence for the pivotal role of Mitf in melanocyte development has
come from studies with both mammals and zebrafish. In mammalian systems Mitf
transactivates expression of melanogenic enzyme genes such as Tyr and
Trp1 as well as the receptor tyrosine kinase gene Kit. Kit
signaling potentiates Mitf activity in turn and is also required for
melanocyte proliferation and survival in both zebrafish and mice
(Goding, 2000
;
Hemesath et al., 1998
;
Hou et al., 2000
;
Opdecamp et al., 1997
;
Parichy et al., 1999
;
Steel et al., 1992
;
Yasumoto et al., 1997
). In
mammalian systems Mitf also directly regulates expression of the antiapoptotic
factor gene Bcl2 required for melanocyte survival
(McGill et al., 2002
).
Similarly, ectopic mitfa (previously known as nac)
expression in zebrafish embryos causes ectopic expression of the melanogenic
enzyme gene dct (Lister et al.,
1999
). Forced expression of Mitf in cultured mouse
fibroblasts can induce some aspects of melanocyte differentiation and ectopic
nac/mitfa expression in zebrafish embryos causes ectopic abnormal
melanized cells (Lister et al.,
1999
; Tachibana et al.,
1996
).
In cultured mammalian cells, Sox10 can directly activate expression from
the mouse or human Mitf promoter
(Bondurand et al., 2000
;
Lee et al., 2000
;
Potterf et al., 2000
;
Verastegui et al., 2000
).
Sox10-/- zebrafish or mouse embryos lack Mitf
expression and nac/mitfa-/- zebrafish or
Mitf-/- mouse embryos have melanocyte defects at least as
severe as those in Sox10-/- mutant embryos
(Dutton et al., 2001
;
Hodgkinson et al., 1993
;
Lister et al., 1999
;
Potterf et al., 2001
). Thus
loss of mitf expression would be sufficient to account for the
melanocyte defect in sox10-/- mutant embryos.
Although regulation of Mitf expression is clearly part of the
Sox10 requirement in the melanocyte lineage it is also possible that
there are other essential Sox10 functions in this lineage. Unlike
zebrafish, mice show a haploinsufficiency phenotype when heterozygous for
Sox10 mutations (Britsch et al.,
2001
). This phenotype includes a mild melanocyte deficiency.
Melanocytes from these mice show little reduction in Mitf expression
and yet transiently have a severe reduction in expression of the melanogenic
enzyme gene Dct (Potterf et al.,
2001
). In addition, Sox10 can transactivate expression
from a Dct promoter construct in cultured cells
(Britsch et al., 2001
;
Potterf et al., 2001
). These
findings could suggest a requirement for Sox10 in regulating
Dct expression that is not mediated via Mitf. A critical
question is whether any such non-Mitf-mediated effects of
Sox10 have a significant role in melanocyte development.
We show here that the direct regulation of Mitf expression by Sox10 reported in cultured mammalian cells also occurs in developing melanophores in zebrafish embryos. We extend these studies by showing that forced expression of nac/mitfa in the neural crest of cls/sox10-/- mutant zebrafish embryos is sufficient to rescue melanophore development. Furthermore, we show that rescue of melanophores in cls/sox10-/- embryos is quantitatively indistinguishable from rescue in nac/mitfa-/- embryos. Together, these data suggest that regulation of nac/mitfa by cls/sox10 can fully account for the cls/sox10 requirement in the zebrafish melanophore lineage.
| MATERIALS AND METHODS |
|---|
|
|
|---|
PCR genotyping
Embryos were tested for heterozygosity or homozygosity of the nac
mutations by PCR on genomic DNA. The nacw2 test used PCR
primers cattcttgggttcatggatgcaggac and ggcaggcttgaggggcaggag followed by
digestion with DraI which cleaves the mutant allele
(Lister et al., 1999
). The
nacb692 test used PCR primers gcagaagtaagagccctggc and
acggatcatttgacttgggaattaaag followed by digestion with BsrD1 which cleaves the
mutant allele.
Whole-mount in situ hybridization
Embryos were processed for whole-mount in situ hybridization with
nac/mitfa digoxigenin-labeled riboprobe as in Dutton et al.
(Dutton et al., 2001
).
Cell culture and luciferase assays
Promoter truncations were made from plasmid nac>luc
(Dorsky et al., 2000
) using the
restriction sites indicated in Fig.
3. Mutation to the M1 sequence (see
Table 1) was made by replacing
the Spe1-Age1 region with the annealed oligonucleotides
ctagtaaccc-atcgtcggcggtaggcttttgtcgaatcgga and
ccggtccgattcgacaaaagcctacc-gccgacgatgggtta. The QuickChange kit (Stratagene)
was used for mutation to the M2, M3 or M4 sequences (see
Table 1). pCS2sox10 and
pCS2sox10L142Q were constructed by cloning the ClaI/XbaI
fragments from hs>sox10 or hs>sox10L142Q
(Dutton et al., 2001
) into
pCS2+.
|
|
Electrophoretic mobility shift assays
The pCls/Sox10-GST expression plasmid was constructed by cloning a PCR
product amplified from hs>sox10
(Dutton et al., 2001
) (using
primers cgggatcccgatgtcggcggaggagcacag and gcgaattcaggaaccc-ggtttgccgtt)
between the BamH1 and EcoR1 sites of pGEX-3X (Amersham Pharmacia).
Cls/Sox10-GST fusion protein was expressed in E. coli BL21(RIL)
(Stratagene) and affinity purified using glutathione agarose following the
manufacturer's instructions (Amersham Pharmacia). Approximate relative
concentrations of Cls/Sox10-GST protein were estimated by comparison to a
dilution series of bovine serum albumin (BSA) standard using Coomassie-stained
polyacrylamide gel electrophoresis (PAGE). The SpeAge DNA probe was
oligonucleotides ctagtaacccatcgtcaaaga-ggcttttgtcgaatcgga and
ccgattcgacaaaagcctctttgagacgacgatgggttact annealed together, end labeled with
[
_32P] ATP using T4 polynucleotide kinase and native PAGE
purified. For electrophoretic mobility shift assays (EMSA), a 20 µl
reaction mixture (containing Cls/Sox10-GST protein, 2000 c.p.m. of
[32P]DNA, 330 ng poly(dG-dC)poly(dG-dC) (Amersham Pharmacia),
50 mM NaCl, 3% (w/v) Ficol (Amersham Pharmacia), 10 mM HEPES (pH 7.9), 5 mM
MgCl2, 0.5 mM EDTA, 0.1 mM dithiothreitol, 1 mg/ml BSA and
sometimes specific competitor oligonucleotide) was incubated on ice for 20
minutes then electrophoresed on a gel (5% (w/v) polyacrylamide (37:1), 0.5%
TBE) at 120 V, at 4°C, for 3 hours. Dried gels were exposed to Biomax MS
film (Kodak) for autoradiography.
Embryo injections
One- or two-cell stage embryos were injected with plasmids and/or RNA using
standard methods as in Dutton et al.
(Dutton et al., 2001
). RNA was
produced using the mMESSAGE mMACHINE kit (Ambion) from hs>sox10 or
hs>sox10(L142Q) templates
(Dutton et al., 2001
)
linearized with Asp718.
Plasmids nac>GFP and nac>nac were generated as follows: the SV40
promoter of pGL3-Promoter (Promega) was replaced by a fragment of the
mitfa promoter from the plasmid pNP-P+
(Lister et al., 2001
) via
SalI and HindIII sites to make pGL3-NP. The luciferase gene
of pGL3-NP was then excised with HindIII and XbaI and
replaced with GFP (from pCS2-BE-GFP) or mitfa (from pHS-MT3A.1)
(Lister et al., 1999
).
Plasmids nac>GFP and nac>nac were mutated to the M1, M2, M3, M4, M1M3
and M3M4 sequences by replacing the appropriate nac promoter
fragments with those from the corresponding Fspnac>luc constructs (see
above). cls>nac was constructed by PCR amplifying the nac/mitfa
coding sequence with N-terminal myc tags from pHS-MT3A.1
(Lister et al., 1999
) and
cloning the PCR fragment into the Xba1 site of CS26.8. CS26.8 has the Sal1-Xba
CMV promoter fragment of pCS2+ replaced by 6.8 kb of sequence extending
upstream from the cls/sox10 translational start site.
GFP fluorescence was scored in gastrulas using an MZ12 dissecting microscope (Leica). GFP fluorescence was scored in 24 hours-post-fertilization (hpf) embryos using an Axioplan 2 microscope (Zeiss) with the embryos anesthetized using 0.003% MS222 (Sigma) and mounted between bridged coverslips. Melanophore rescue was scored at 48 hpf or at 72 hpf in the case when the cls/sox10-/- iridophore phenotype was also being scored. Melanophores were only scored as rescued if they had wild-type morphology.
Photography
Live embryos were anesthetized with 0.003% MS222 (Sigma), mounted in
methylcellulose or between bridged coverslips and photographed using a Spot
digital camera mounted on an Eclipse E800 microscope (Nikon) or Axioplan 2
microscope (Zeiss) with DIC optics. Embryo whole-mount in situ hybridization
specimens were photographed using a Spot digital camera mounted on a MZ12
microscope (Leica) with epi-illumination. The GFP fluorescent gastrula image
was captured using a LSM510 confocal microscope (Zeiss) with DIC and confocal
fluorescence images superimposed.
| RESULTS |
|---|
|
|
|---|
Intercrossing nac/mitfa+/b692;cls/sox10+/t3 parents gave embryos with three different phenotypes: wild-type (Fig. 1A), embryos with the typical nac/mitfa-/- phenotype of complete loss of all melanophores but no reduction in iridophores (Fig. 1B), and embryos with the typical cls/sox10-/- phenotype of a severe reduction in all pigment types including iridophores but a persistence of tiny melanized spots (Fig. 1C,D). All embryos classified as having a cls phenotype were similar, having at least five tiny melanophores, and importantly we did not observe any embryos with both a complete absence of these tiny melanized cells and loss of iridophores. The numbers of embryos with these specific phenotypes, 168 wild type: 59 nac: 67 cls, fits the ratio of 9:3:4 expected if embryos with the genotype cls-/-;nac-/- exhibit the cls phenotype (p=0.64 by chi-square analysis). We confirmed that some of these embryos were indeed nac/mitfa-/- homozygotes by PCR genotyping. Of the 27 such embryos we tested, four were nac/mitfa-/-;cls/sox10-/- (Fig. 1D), 14 were nac/mitfa+/-;cls/sox10-/- and nine were nac/mitfa+/+;cls/sox10-/-.
|
These results suggest that the less severe melanophore defect observed in cls/sox10-/- embryos as compared to nac/mitfa-/- embryos cannot be attributed to residual nac/mitfa expression in cls/sox10-/- mutant embryos.
Ectopic cls/sox10 expression in the embryo can induce ectopic
nac/mitfa expression
In zebrafish embryos cls/sox10 has been shown to be necessary for
nac/mitfa expression (Dutton et
al., 2001
). In mammalian cells Sox10 has also been
reported to directly activate Mitf expression
(Bondurand et al., 2000
;
Lee et al., 2000
;
Potterf et al., 2000
;
Verastegui et al., 2000
). We
used forced ectopic expression of cls/sox10 to test whether
cls/sox10 was also sufficient to induce nac/mitfa expression
in the zebrafish embryo. Embryos injected with cls/sox10 RNA were
probed for nac/mitfa expression by in situ hybridization.
cls/sox10 RNA injection induced nac/mitfa transcription at 6
hpf (Fig. 2C), 12 hours before
the onset of endogenous nac/mitfa expression
(Lister et al., 1999
). The
induced nac/mitfa expression was unevenly distributed as patches or
spots, with the pattern of expression varying greatly from embryo to embryo.
Ectopic nac/mitfa expression was not seen when embryos were injected
with point mutant cls/sox10L142Q RNA
(Fig. 2B), the mutation in the
clsm618 allele (Dutton
et al., 2001
). These results show that cls/sox10 can
induce nac/mitfa expression in embryonic contexts other than the
neural crest cells where nac/mitfa is normally expressed.
|
Cls/Sox10 binds nac/mitfa promoter sequences in vitro
The 41 b.p. critical region of the nac/mitfa promoter between the
Spe1 and Age1 sites contains a sequence element (site S1)
similar to the consensus sox binding site WWCAAWG
(Mertin et al., 1999
)
(Table 1). We used an in vitro
DNA binding assay to establish whether Cls/Sox10 could be acting by binding to
site S1. An EMSA showed that a Cls/Sox10-GST fusion protein (with Cls/Sox10
residues 1-189) binds to the Spe1-Age1 fragment that
contains site S1 (Fig. 4B).
However, when site S1 is mutated this binding is greatly reduced. Similarly,
binding to the Spe1-Age1 fragment is effectively competed by
a 19 b.p. double-stranded oligonucleotide with the site S1 sequence but not by
an equivalent oligonucleotide with the site S1 mutated
(Fig. 4C).
|
A Cls/Sox10 binding site is needed for the cls/sox10 response of the
nac/mitfa promoter
In order to test whether sox binding sites S1, S2, S3 or S4 could act as
cls/sox10 response elements, we mutated each of them in a luciferase
reporter construct (Fspnac>luc) with a nac/mitfa promoter
truncated to the Fsp1 site (-434 b.p.). The mutations used were the same as
those used to disrupt binding to these sites in vitro (see
Fig. 4;
Table 1). In co-transfection
assays with pCS2Sox10, mutation of site S1 (to make FspM1nac>luc) was found
to reduce the plasmid's response to cls/sox10 in NIH3T3 cells
(Fig. 5). Mutation of sites S2,
S3 or S4 or both S3 and S4 had only a slight effect in this assay
(Fig. 5). Similarly, mutation
of both S1 and S3 did not have more of an effect than mutating S1 alone
(Fig. 5).
|
|
|
Forced nac/mitfa expression rescues the cls/sox10-/-
melanophore phenotype
cls/sox10-/- mutant embryos lack nac/mitfa
expression and nac/mitfa-/- mutant embryos lack
melanophores (Dutton et al.,
2001
; Lister et al.,
1999
). This prompted us to investigate whether activation of
nac/mitfa transcription could account for the required role of
cls/sox10 in the melanophore lineage. We tested this by forcing
nac/mitfa expression in cls/sox10-/- embryos,
thus bypassing the role of cls/sox10 in activating nac/mitfa
expression. Because ectopic expression of mitf can confer some
melanophore characteristics upon other cell types
(Lister et al., 1999
;
Tachibana et al., 1996
), we
wanted to express nac/mitfa specifically in neural crest cells. We
constructed a plasmid with the nac/mitfa cDNA under control of a
cls/sox10 promoter (cls>nac). The cls/sox10 promoter used
had previously been shown to target expression of a GFP reporter plasmid to
the endogenous sites of cls/sox10 expression such as neural crest and
otic vesicle (T.J.C., J. Dutton and R.N.K., unpublished). Injected cls>nac
was able to rescue melanophores with normal morphology and migratory ability
in cls/sox10-/- mutant embryos and in
nac/mitfa-/- mutant embryos
(Fig. 6). In both genotypes,
and in agreement with previous rescue studies of
mitf/nac-/- (Lister et
al., 1999
), only a few melanophores were rescued in each embryo,
presumably because of the highly mosaic distribution of injected DNA typical
for zebrafish injection experiments. These results show that reintroduction of
nac/mitfa expression rescues the differentiation, migration and
survival deficiencies of cls/sox10-/- neural crest cells
in the melanophore lineage. We were also able to rescue melanophores by
expression of nac/mitfa using a hsp70 promoter construct
(Lister et al., 1999
) (data
not shown).
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Role of sox10 in nonectomesenchymal crest fate specification
Several groups have shown that Sox10 can directly activate
Mitf expression in cultured mammalian cells
(Bondurand et al., 2000
;
Lee et al., 2000
;
Potterf et al., 2000
;
Verastegui et al., 2000
). We
found that the zebrafish nac/mitfa promoter is also directly
activated by zebrafish Cls/Sox10 and that this direct regulation is necessary
for expression from the zebrafish nac/mitfa promoter in neural crest
cells in the developing embryo. Most significantly we found that this
activation of nac/mitfa expression can account quantitatively for all
of the cls/sox10 requirement in the melanophore lineage. Studies in
zebrafish and in mice have revealed defects in neural crest cell fate
specification, migration, survival and differentiation in sox10
mutants. We have previously proposed that the complex phenotype of
cls/sox10 mutants might be explained by a primary defect in
specification of nonectomesenchymal crest fates, with defects in migration,
survival and differentiation being secondary consequences of this
(Dutton et al., 2001
;
Kelsh and Raible, 2002
). Our
demonstration here that cls/sox10 directly activates
nac/mitfa, a key gene in melanophore fate specification, and that
this is vital for melanophore rescue in nac/mitfa mutants, is clearly
consistent with our model.
Although not usually interpreted in the same way, the mouse Sox10
mutant phenotype is plainly consistent with the model proposed. For example,
the recent demonstration that Mitf regulates the antiapoptotic gene
Bcl2 provides a molecular explanation for the apoptosis of
melanoblast progenitors in Sox10 mutants
(McGill et al., 2002
).
Furthermore, in mice the regulation of Erbb3 (directly or indirectly)
by Sox10 (Britsch et al.,
2001
) provides evidence that Sox10 regulates glial fate
specification, because neuregulin signaling has been shown to direct neural
crest stem cells to a glial fate (Shah and
Anderson, 1997
; Shah et al.,
1994
).
At first glance, our findings with the melanophore lineage contrast with
the body of work establishing that Sox10 directly activates a variety
of differentiation genes in developing glia. However, these findings are
consistent with the observation that cls/sox10 expression is
downregulated in melanoblasts but retained in developing peripheral glia
(Dutton et al., 2001
), and
suggests that in addition to its roles in nonectomesenchymal fate
specification, sox10 is also required for glial cell
differentiation.
Only a subset of sox10-expressing neural crest cells express
mitfa and become melanophores. Dorsky et al.
(Dorsky et al., 2000
) showed
that wnt signaling also directly activated nac/mitfa expression.
These findings are consistent with a model for cls/sox10 function in
the melanophore lineage in which sox10 is required in conjunction
with Wnt signaling to activate nac/mitfa expression in neural crest
cells (Kelsh and Raible,
2002
). nac/mitfa then in turn specifies the melanophore
fate by activating expression of differentiation genes such as dct
and genes such as spa/kit required for survival and migration. The
NIH3T3 cell transfection work described here was conducted in the absence of
any known Wnt signaling. Furthermore, eliminating the Tcf/Lef binding sites as
described by Dorsky et al. (Dorsky et al.,
2000
) from the nac/mitfa promoter reporter construct did
not prevent the observed cls/sox10 response in NIH3T3 cells (data not
shown). Recently, Saito et al. (Saito et
al., 2002
) have shown that LEF-1 activates transcription from the
MITF promoter in Hela cells much more effectively when bound together
as a complex with the MITF-M protein itself. Future studies using coexpression
of sox10, mitfa and Wnt signaling components could help to reveal how
Wnt signaling and sox10 interact to establish mitfa
expression. Work by others using mammalian systems has also shown that the
transcription factors Pax3, OC-2 and CREB transactivate
Mitf transcription (Bertolotto et
al., 1998
; Jacquemin et al.,
2001
; Potterf et al.,
2000
; Watanabe et al.,
1998
).
SOX10, MITF and human disease
Our demonstration that sox10 function in melanophores may be
limited to regulation of mitfa helps to explain the similar
pigmentation defects of the Waardenburg Syndromes IIa and IV. Waardenburg
Syndromes IIa and IV are associated with human haploinsufficiency for
MITF and SOX10, respectively
(Pingault et al., 1998
;
Tachibana et al., 1994
;
Tassabehji et al., 1994
).
Although zebrafish cls/sox10 mutants have no dominant phenotype, our
results suggest a model for the aetiology of Waardenburg Syndrome IV. We
propose that in heterozygous SOX10 mutant humans, activation of
MITF by SOX10 is less efficient, resulting in specification of fewer
melanoblasts. Consistent with this, in heterozygous Sox10 mutant
mice, which share the dominant pigment defects of human individuals,
Kit-positive melanoblasts are reduced in number
(Potterf et al., 2001
);
although not reported in these studies, we predict that the number of
Mitf-expressing cells would be reduced in these mice compared to
wild-types.
That we can, in zebrafish, account quantitatively for the role of
sox10 in the melanophore lineage by its activation of mitfa
is perhaps surprising in view of the reports that the mouse Dct
promoter can be directly regulated by Sox10
(Britsch et al., 2001
;
Potterf et al., 2001
).
However, these studies used co-transfection assays in cultured cells and thus
leave open the question of whether Dct is regulated directly by Sox10
in the developing neural crest. Our findings strongly suggest that even if
Sox10 does directly regulate dct expression in vivo, this requirement
may be dispensable for melanophore development. Such an interpretation is
consistent with the phenotype in heterozygous Sox10 mutant mice.
Thus, a transient reduction in Dct expression seen in developing
melanoblasts was attributed to an effect of the reduced levels of Sox10
(Potterf et al., 2001
),
although an alternative explanation that sub-wild-type levels of Mitf
expression result in lowered Dct expression cannot be ruled out;
indeed, more recent studies in culture show that MITF interacts with LEF-1 to
directly coactivate the DCT promoter
(Yasumoto et al., 2002
).
However, regardless of the mechanism mediating this reduction in detectable
Dct expression, the Dct phenotype rapidly recovers,
suggesting that in melanophores in which Mitf expression is above a
threshold level, the requirement for Sox10 is only transient and
non-essential. The alternative explanation, that the precise contributions of
Sox10 and Mitf in melanocyte development may not be fully
conserved between zebrafish and mice, is less attractive because of the
striking similarities in the genetic control of melanocyte development already
demonstrated between mouse and zebrafish
(Rawls et al., 2001
).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
These authors contributed equally to this work and are joint first
authors | REFERENCES |
|---|
|
|
|---|
Bertolotto, C., Abbe, P., Hemesath, T. J., Bille, K., Fisher, D.
E., Ortonne, J. P. and Ballotti, R. (1998). Microphthalmia
gene product as a signal transducer in cAMP-induced differentiation of
melanocytes. J. Cell Biol.
142,827
-835.
Bondurand, N., Girard, M., Pingault, V., Lemort, N., Dubourg, O.
and Goossens, M. (2001). Human Connexin 32, a gap junction
protein altered in the X-linked form of Charcot-Marie-Tooth disease, is
directly regulated by the transcription factor SOX10. Hum. Mol.
Genet. 10,2783
-2795.
Bondurand, N., Pingault, V., Goerich, D. E., Lemort, N., Sock,
E., Caignec, C. L., Wegner, M. and Goossens, M. (2000).
Interaction among SOX10, PAX3 and MITF, three genes altered
in Waardenburg syndrome. Hum. Mol. Genet.
9,1907
-1917.
Britsch, S., Goerich, D. E., Riethmacher, D., Peirano, R. I.,
Rossner, M., Nave, K. A., Birchmeier, C. and Wegner, M.
(2001). The transcription factor Sox10 is a key regulator of
peripheral glial development. Genes Dev.
15, 66-78.
Dorsky, R. I., Raible, D. W. and Moon, R. T.
(2000). Direct regulation of nacre, a zebrafish
MITF homolog required for pigment cell formation, by the Wnt pathway.
Genes Dev. 14,158
-162.
Dutton, K. A., Pauliny, A., Lopes, S. S., Elworthy, S., Carney,
T. J., Rauch, J., Geisler, R., Haffter, P. and Kelsh, R. N.
(2001). Zebrafish colourless encodes sox10 and
specifies non-ectomesenchymal neural crest fates.
Development 128,4113
-4125.
Goding, C. R. (2000). Mitf from neural crest to
melanoma: signal transduction and transcription in the melanocyte lineage.
Genes Dev. 14,1712
-1728.
Hemesath, T. J., Price, E. R., Takemoto, C., Badalian, T. and Fisher, D. E. (1998). MAP kinase links the transcription factor Micropthalmia to c-Kit signalling in melanocytes. Nature 391,298 -301.[CrossRef][Medline]
Herbarth, B., Pingault, V., Bondurand, N., Kuhlbrodt, K.,
Hermans-Borgmeyer, I., Puliti, A., Lemort, N., Goossens, M. and Wegner, M.
(1998). Mutation of the Sry-related Sox10 gene in
Dominant megacolon, a mouse model for human Hirschsprung disease.
Proc. Natl. Acad. Sci. USA
95,5161
-5165.
Hodgkinson, C. A., Moore, K. J., Nakayama, A., Steingr'imsson, E., Copeland, N. G., Jenkins, N. A. and Arnheiter, H. (1993). Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic-helix-loop-helix-zipper protein. Cell 74,395 -404.[CrossRef][Medline]
Hou, L., Panthier, J. and Arnheiter, H. (2000). Signaling and transcriptional regulation in the neural crest-derived melanocyte lineage: interactions between KIT and MITF. Development 127,5379 -5389.[Abstract]
Jacquemin, P., Lannoy, V. J., O'Sullivan, J., Read, A., Lemaigre, F. F. and Rousseau, G. G. (2001). The transcription factor Onecut-2 controls the microphthalmia-associated transcription factor gene. Biochem. Biophys. Res. Commun. 285,1200 -1205.[CrossRef][Medline]
Kapur, R. P. (1999). Early death of neural crest cells is responsible for total enteric aganglionosis in Sox10(Dom)/Sox10(Dom) mouse embryos. Pediatr. Dev. Pathol. 2,559 -569.[CrossRef][Medline]
Kelsh, R. N., Brand, M., Jiang, Y. J., Heisenberg, C. P., Lin, S., Haffter, P., Odenthal, J., Mullins, M. C., van Eeden, F. J., Furutani-Seiki, M. et al. (1996). Zebrafish pigmentation mutations and the processes of neural crest development. Development 123,369 -389.[Abstract]
Kelsh, R. N. and Eisen, J. S. (2000). The zebrafish colourless gene regulates development of non-ectomesenchymal neural crest derivatives. Development 127,515 -525.[Abstract]
Kelsh, R. N. and Raible, D. W. (2002). Specification of zebrafish neural crest. In Pattern Formation in Zebrafish (ed. L. Solnicka-Kresel), pp.216 -236. Berlin: Springer-Verlag.
Kelsh, R. N., Schmid, B. and Eisen, J. S. (2000). Genetic analysis of melanophore development in zebrafish embryos. Dev. Biol. 225,277 -293.[CrossRef][Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Le Douarin, N. M. and Kalcheim, C. (1999). The Neural Crest. Cambridge: Cambridge University Press.
Lee, M., Goodall, J., Verastegui, C., Ballotti, R. and Goding,
C. R. (2000). Direct regulation of the microphthalmia
promoter by Sox10 links Waardenburg-Shah syndrome (WS4)-associated
hypopigmentation and deafness to WS2. J. Biol. Chem.
275,37978
-37983.
Lister, J. A., Close, J. and Raible, D. W. (2001). Duplicate mitf genes in zebrafish: complementary expression and conservation of melanogenic potential. Dev. Biol. 237,333 -344.[CrossRef][Medline]
Lister, J. A., Robertson, C. P., Lepage, T., Johnson, S. L. and Raible, D. W. (1999). nacre encodes a zebrafish microphthalmia-related protein that regulates neural-crest-derived pigment cell fate. Development 126,3757 -3767.[Abstract]
McGill, G. G., Horstmann, M., Wildlund, H. R., Du J., Motyckova G., Nishimra E. K., Lin Y., Ramaswamy S., Avery W., Ding H., Jordan S. A. et al. (2002). Bcl2 regulation by the melanocyte master regulator Mitf Modulates lineage survival and melanoma cell viability. Cell 109,707 -718.[CrossRef][Medline]
Mertin, S., McDowall, S. G. and Harley, V. R.
(1999). The DNA-binding specificity of SOX9 and other SOX
proteins. Nucleic Acids Res.
27,1359
-1364.
Opdecamp, K., Nakayama, A., Nguyen, M. T. T., Hodgkinson, C. A., Pavan, W. J. and Arnheiter, H. (1997). Melanocyte development in vivo and in neural crest cell cultures: crucial dependence on the Mitf basic-helix-loop-helix-zipper transcription. Development 124,2377 -2386.[Abstract]
Paratore, C., Goerich, D. E., Suter, U., Wegner, M. and Sommer, L. (2001). Survival and glial fate acquisition of neural crest cells are regulated by an interplay between the transcription factor Sox10 and extrinsic combinatorial signaling. Development 128,3949 -3961.
Parichy, D. M., Rawls, J. F., Pratt, S. J., Whitfield, T. T. and Johnson, S. L. (1999). Zebrafish sparse corresponds to an orthologue of c-kit and is required for the morphogenesis of a subpopulation of melanocytes, but is not essential for hematopoiesis or primordial germ cell development. Development 126,3425 -3436.[Abstract]
Peirano, R. I., Goerich, D. E., Riethmacher, D. and Wegner,
M. (2000). Protein zero gene expression is regulated by the
glial transcription factor Sox10. Mol. Cell. Biol.
20,3198
-3209.
Pingault, V., Bondurand, N., Kuhlbrodt, K., Goerich, D. E., Prehu, M. O., Puliti, A., Herbarth, B., Hermans-Borgmeyer, I., Legius, E., Matthijs, G. et al. (1998). SOX10 mutations in patients with Waardenburg-Hirschsprung disease. Nat. Genet. 18,171 -173.[CrossRef][Medline]
Potterf, S. B., Mollaaghababa, R., Hou, L., Southard-Smith, E. M., Hornyak, T. J., Arnheiter, H. and Pavan, W. J. (2001). Analysis of SOX10 function in neural crest-derived melanocyte development: Sox10-dependent transcriptional control of dopachrome tautomerase. Dev. Biol. 237,245 -257.[CrossRef][Medline]
Potterf, S. B., Furumura, M., Dunn, K. J., Arnheiter, H. and Pavan, W. J. (2000). Transcription factor hierarchy in Waardenburg syndrome: regulation of MITF expression by SOX10 and PAX3. Hum. Genet. 107,1 -6.[CrossRef][Medline]
Rawls, J. F., Mellgren, E. M. and Johnson, S. L. (2001). How the zebrafish gets its stripes. Dev. Biol. 240,301 -314.[CrossRef][Medline]
Saito, H., Yasumoto, K., Takeda, K., Takhashi, K., Fukushima,
A., Orikasa, S. and Shibahara, S. (2002). Melanocyte-specific
microphthalmia-associated transcription factor isoform activates its own gene
promoter through physical interaction with lymphoid-enhancing factor 1.
J. Biol. Chem. 277,28787
-28794.
Shah, N. M. and Anderson, D. J. (1997).
Integration of multiple instructive cues by neural crest stem cells reveals
cell-intrinsic biases in relative growth factor responsiveness.
Proc. Natl. Acad. Sci. USA
94,11369
-11374.
Shah, N. M., Marchionni, M. A., Isaacs, I., Stroobant, P. and Anderson, D. J. (1994). Glial growth-factor restricts mammalian neural crest stem-cells to a glial fate. Cell 77,349 -360.[CrossRef][Medline]
Smith, M., Hickman, A., Amanze, D., Lumsden, A. and Thorogood,
P. (1994). Trunk neural crest origin of caudal fin mesenchyme
in the zebrafish Brachydanio rerio. Proc. R. Soc. Lond.
B 256,137
-145.
Sonnenberg-Riethmacher, E., Miehe, M., Stolt, C. C., Goerich, D. E., Wegner, M. and Riethmacher, D. (2001). Development and degeneration of dorsal root ganglia in the absence of the HMG-domain transcription factor Sox10. Mech. Dev. 109,253 -265.[CrossRef][Medline]
Southard-Smith, E. M., Kos, L. and Pavan, W. J. (1998). Sox10 mutation disrupts neural crest development in Dom Hirschsprung mouse model. Nat. Genet. 18, 60-64.[CrossRef][Medline]
Steel, K. P., Davidson, D. R. and Jackson, I. J. (1992). TRP-2/DT, a new early melanoblast marker, shows that steel growth factor (c-kit ligand) is a survival factor. Development 115,1111 -1119.[Abstract]
Tachibana, M., Perez Jurado, L. A., Nakayama, A., Hodgkinson, C.
A., Li, X., Schneider, M., Miki, T., Fex, J., Francke, U. and Arnheiter,
H. (1994). Cloning of MITF, the human homolog of the
mouse microphthalmia gene and assignment to chromosome 3p14.1-p12.3.
Hum. Mol. Genet. 3,553
-557.
Tachibana, M., Takeda, K., Nobukuni, Y., Urabe, K., Long, J. E., Meyers, K. A., Aaronson, S. A. and Miki, T. (1996). Ectopic expression of MITF, a gene for Waardenburg syndrome type 2, converts fibroblasts to cells with melanocyte characteristics. Nat. Genet. 14,50 -54.[CrossRef][Medline]
Tassabehji, M., Newton, V. E. and Read, A. P. (1994). Waardenburg syndrome type 2 caused by mutations in the human microphthalmia (MITF) gene. Nat. Genet. 8, 251-255.[CrossRef][Medline]
Verastegui, C., Bille, K., Ortonne, J. P. and Ballotti, R.
(2000). Regulation of the microphthalmia-associated transcription
factor gene by the Waardenburg syndrome type 4 gene, SOX10.
J. Biol. Chem. 275,30757
-30760.
Watanabe, A., Takeda, K., Ploplis, B. and Tachibana, M. (1998). Epistatic relationship between Waardenburg syndrome genes MITF and PAX3. Nat. Genet. 18,283 -286.[CrossRef][Medline]
Yasumoto, K., Yokoyama, K., Takahashi, K., Tomita, Y. and
Shibahara, S. (1997). Functional analysis of
microphthalmia-associated transcription factor in pigment cell-specific
transcription of the human tyrosinase family genes. J. Biol.
Chem. 272,503
-509.
Yasumoto, K., Takeda, K., Saito, H., Watanabe, K., Takahashi, K. and Shibahara, S. (2002). Microphthalmia-associated transcription factor interacts with LEF-1, a mediator of Wnt signaling. EMBO J. 21,2703 -2714.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
B. L. Arduini, K. M. Bosse, and P. D. Henion Genetic ablation of neural crest cell diversification Development, June 15, 2009; 136(12): 1987 - 1994. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Thomas and C. A. Erickson FOXD3 regulates the lineage switch between neural crest-derived glial cells and pigment cells by repressing MITF through a non-canonical mechanism Development, June 1, 2009; 136(11): 1849 - 1858. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Mou, A. R. Tapper, and P. D. Gardner The Armadillo Repeat-containing Protein, ARMCX3, Physically and Functionally Interacts with the Developmental Regulatory Factor Sox10 J. Biol. Chem., May 15, 2009; 284(20): 13629 - 13640. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Dutton, L. Abbas, J. Spencer, C. Brannon, C. Mowbray, M. Nikaido, R. N. Kelsh, and T. T. Whitfield A zebrafish model for Waardenburg syndrome type IV reveals diverse roles for Sox10 in the otic vesicle Dis. Model. Mech., January 1, 2009; 2(1-2): 68 - 83. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Stolt, P. Lommes, S. Hillgartner, and M. Wegner The transcription factor Sox5 modulates Sox10 function during melanocyte development Nucleic Acids Res., October 1, 2008; 36(17): 5427 - 5440. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Werner, A. Hammer, M. Wahlbuhl, M. R. Bosl, and M. Wegner Multiple conserved regulatory elements with overlapping functions determine Sox10 expression in mouse embryogenesis Nucleic Acids Res., October 8, 2007; 35(19): 6526 - 6538. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Schreiner, F. Cossais, K. Fischer, S. Scholz, M. R. Bosl, B. Holtmann, M. Sendtner, and M. Wegner Hypomorphic Sox10 alleles reveal novel protein functions and unravel developmental differences in glial lineages Development, September 15, 2007; 134(18): 3271 - 3281. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Carney, K. A. Dutton, E. Greenhill, M. Delfino-Machin, P. Dufourcq, P. Blader, and R. N. Kelsh A direct role for Sox10 in specification of neural crest-derived sensory neurons Development, December 1, 2006; 133(23): 4619 - 4630. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hou, H. Arnheiter, and W. J. Pavan Interspecies difference in the regulation of melanocyte development by SOX10 and MITF PNAS, June 13, 2006; 103(24): 9081 - 9085. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Voigt and N. Papalopulu A dominant-negative form of the E3 ubiquitin ligase Cullin-1 disrupts the correct allocation of cell fate in the neural crest lineage Development, February 1, 2006; 133(3): 559 - 568. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Lewis, J. Bonner, M. Modrell, J. W. Ragland, R. T. Moon, R. I. Dorsky, and D. W. Raible Reiterated Wnt signaling during zebrafish neural crest development Development, March 15, 2004; 131(6): 1299 - 1308. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bejar, Y. Hong, and M. Schartl Mitf expression is sufficient to direct differentiation of medaka blastula derived stem cells to melanocytes Development, December 29, 2003; 130(26): 6545 - 6553. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||