|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00513
1 Department of Anatomy, University of Cambridge, Downing Street, Cambridge, CB2
3DY, UK
2 Department of Zoology, Oxford University, South Parks Rd, Oxford, OX1 3PS,
UK
* Author for correspondence (e-mail: rw108{at}cam.ac.uk)
Accepted 27 March 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila development, Spermatogenesis, Homeodomain, Spermatocyte
| INTRODUCTION |
|---|
|
|
|---|
Consistent with an in vivo role in TGFß/BMP signalling, TGIF has been
identified as one of a small group of genes implicated in the human
developmental disorder holoprosencephaly (HPE)
(Gripp et al., 2000
). This
failure of forebrain formation is a relatively common developmental disorder
affecting 1 in 250 conceptuses and 1 in 16000 live-born infants
(Muenke and Beachy, 2000
).
Loss-of-function mutations in TGFß family members in the mouse and
zebrafish exhibit holoprosencephaly phenotypes
(Conlon et al., 1994
;
Feldman et al., 1998
;
Rebagliati et al., 1998
;
Sampath et al., 1998
). Four
regions in the human genome (HPE 1-4) have been correlated with HPE and HPE 4
has been mapped to a 6 Mb region on chromosome 18 at p11.3, which includes the
TGIF locus. Collections of HPE families have revealed TGIF alleles with
mutations that affect protein function, which provide a plausible case for the
relevance of TGIF to HPE but surprisingly these mutations do not appear to be
more prevalent in the HPE group (Nanni et
al., 2000
). Another potentially relevant gene, twisted
gastrulation has also been recently found to be located at 18p11.3
(Graf et al., 2001
).
TGIF shows strong evolutionary conservation and similar sequences are present in the genomes of chicken, Drosophila, man and mouse. However, there has been no investigation of the in vivo developmental consequences of deleting TGIF from the genome. Here we present an analysis of the effects of deleting TGIF gene function in Drosophila. We show that the major developmental defect arising from loss of TGIF is a failure in spermatogenesis. TGIF mutants are male sterile with an aly-class meiotic arrest phenotype. We show that Drosophila TGIF is required for transcription of many spermatogenic target genes, although not for the expression or normal localisation the other aly-class meiotic arrest proteins Always early (Aly) and Cookie monster (Comr). TGIF represents the first sequence-specific transcription factor to be shown to be required for this spermatogenesis transcription programme.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mutagenesis
The fly strain EP(2)2107 obtained from BDGP was identified as an insertion
in the 5'-UTR of achi and used to generate the
achi1 deletion by standard P-element excision.
P-element induced male recombination
(Preston et al., 1996
) against
the dp b cn bw chromosome was used to generate the
achi2, achi3 and
achi4 alleles. The extents of the deletions were
confirmed by PCR or inverse-PCR sequencing. The
achiZ3922 visZ3922
chromosome was isolated in a large scale EMS mutagenesis for new viable
mutants conducted by Charles Zuker and colleagues (E. Koundakjian, R. Hardy,
D. Cowen and C. Zuker, personal communication). All the lines were tested for
male sterility by Barbara Wakimoto and Dan Lindsley and these were then
re-screened for a meiotic-arrest phenotype in the laboratory of Margaret
Fuller. achiZ3922
visZ3922 has been previously referred to as
zaa.
Sequence analysis
Similarity searches were performed using the tBLASTn, BLASTn and BLASTp
algorithms (Altschul and Lipman,
1990
; Altschul et al.,
1997
) via
www.ncbi.nlm.nih.gov/BLAST/.
Protein sequence alignments were performed using ClustalW
(Thompson et al., 1994
) at
www.ebi.ac.uk/clustalw.
Genomic and EST sequences were obtained from GenBank. The ESTs LD25085,
GM01582, LP02076 and SD01238 were sequenced completely and used to make
intronexon assignations; RT-PCR was used to confirm this. Genomic Southern
blotting was used to confirm the gene duplication (data not shown).
To identify the defect in achiZ3922 visZ3922, PCR primers were designed to amplify all of the predicted ORFs from candidate genes, as sets of overlapping products. The amplified fragments were sequenced from both ends using BigDye terminator cycle sequencing reagent (ABI), reactions were run on an ABI 377 automated DNA sequencing system. Sequence alignments were carried out using Sequencher 3.1 (GeneCodes Corp).
Expression analysis
For achi/vis developmental time course analysis RNA was extracted
from various tissues using the TRIzol reagent (Life Technologies). 1 µg of
this RNA was used for reverse transcription using appropriate primers and
SuperScriptTM II RNAseH Reverse Transcriptase (Life
Technologies). PCR amplification (30 cycles) was performed using Taq DNA
polymerase (Roche) on a Perkin Elmer Gene Amp PCR system 9700. For analysis of
expression in the testis compared with that in the carcass, total RNA was
prepared, using TRIzol reagent, from testes of wild-type and mutant male
flies, the whole bodies of wild-type females and male carcasses (testes were
removed by dissection). Total RNA was treated with DNAse I to remove possible
contamination of genomic DNA. RT-PCR was carried out using Superscript
Preamplification System (Invitrogen) in which a pair of oligo primers
(5'-ATGATCTCGCCGGAACAAGAGGA and 5'-GTCTCCCATGTAAACGAAATCG) was
used to amplify the whole open reading frame of vis and achi
on a Biometra personal thermal cycler.
For in situ hybridisation, single-stranded RNA probes were generated by in
vitro transcription (Roche) and were used to detect achi/vis
transcripts as described in White-Cooper et al.
(White-Cooper et al.,
1998
).
For the analysis of expression in the wild-type and the mutant, equal amounts of RNA (3 µg) from dissected testes was used for reverse transcription with oligo(dT) primers. PCR amplification with appropriate primers was for 28 cycles. Primers used were: TGIF.f1 CCAGGACATGATGCACGAG, TGIF.r3 TCGCTCGGATAGGCGTTATAG, TGIF.f3 AAGTCCTGCTTCCGAAGTGG, TGIF.r2 ACTTGTGCCCTGCGACATAG, aly.1 ATTTTCGGCCGCCTTCATC, aly.2 TACTCGACCAGGTAGTCG, can.1 GGCTTGTGAAGAACTTCCC, can.2 CCGCAAAAACCGAATCCTC, twe.1 CGCCAAGGATTTGGCAATC, twe.2 CTGGGATACATGCTTAGGC, bol.1 AAACGCATCGTATCTGGG, bol.2 TGAAGGTGGGTAGATGGC, cycB.1 AGCGTCTGCCTATCTTCG, cycB.2, GAACTGCAGGTGGACTTC, cycA.1 AGAGCATAATCGGACTCC, cycA.2 TAAGCAGTCGGTGTGCAC, fzo.1 TGGAGGCCATTGCAAAGG, fzo.2 AAACGCACCGACCTACTC, janB.1 CTTTGCAACTGCTCGCAC, janB.2 AGTGGTCCACGCTTGAAG, dj.1 AGGAAGCCGATGACCTTC, dj.2 TAAAGCCGCGTTGAACAG, gdl.1 GGGCAGCCAAACTGATTG, gdl.2 AATGTGGCGCAACTCCTC, esc.1 AGTCGCGGCCTAATTTGG, esc.2 ACAATGCGATCTCCACGC, hay.1 TCGAGAAAGGATCGCAGC, hay.2 TGCTGTGACACCCACTAG, taf24.1 ACAATGGCTTCCGATGGC, taf24.2 ACGAAGTACTGCGGCTTG.
Microscopy and immunolabelling
Testis squashes were performed as described previously
(Cenci et al., 1994
).
Immunolabelling was as described by Jiang and White-Cooper
(Jiang and White-Cooper,
2003
). Primary antibodies used were anti-histone (1:1000 dilution,
Chemicon), anti-Esc mAb E53.1 used at 1:5 dilution
(Gutjahr et al., 1995
),
anti-Aly at 1:1000 dilution (White-Cooper
et al., 2000
) and anti-Comr at 1:1000 dilution
(Jiang and White-Cooper,
2003
). Secondary antibodies used were Alexa488-conjugated
anti-mouse antibody (Molecular Probes) or FITC-conjugated anti-rabbit Ig
(Jackson). Testes were counterstained with DAPI (1 µg/ml; Molecular probes)
or propidium iodide (1 µg/ml; Sigma) and mounted in CitiFluor (Agar
Scientific). Samples were analysed on a Leica TCS confocal microscope or a
Bio-Rad Radiance Plus confocal microscope. Paraffin wax sections of mouse
testes were labelled using anti-TGIF (I:10 dilution; Santa Cruz Biotech).
| RESULTS |
|---|
|
|
|---|
A comparison of the protein encoded by this locus with vertebrate TGIF
sequences reveals that the sequence similarity exists both within the
homeodomain (including RYN as the TALE amino acids characteristic of the TGIF
family) and for about 30 amino acids on the carboxy-terminal side of the
homeodomain (Fig. 1). Such a
C-terminal domain is also found in the yeast TALE protein MATalpha2 and
members of the PBC family, where these residues fold into additional helices
required for the proper functioning of the homeodomain
(Phillips et al., 1994
;
Sprules et al., 2000
). The
complete genome sequence of the mosquito Anopheles gambiae has
recently been published and also reveals the presence of a TGIF homologue
(AgCG54405). This gene encodes a protein (AgCP3385) with 63% similarity to
Achi/Vis (Fig. 1). In addition
to the sequence conservation in the homeodomain and C domain there are
additional blocks of homology between these invertebrate sequences.
|
|
|
|
Labelling the DNA with DAPI provides an easy way to visualise the stages of spermatogenesis. In wild-type whole mounts, cells at the apical tip of the testis label strongly, but during the primary spermatocyte stage the intensity decreases correlating with chromosomal reorganisation and increasing cell size (Fig. 5A). An expanded zone of high DAPI labelling was observed in Df(2R)achi1 mutant testes (Fig.5B). This experiment was repeated using confocal microscopy with anti-histone labelling to study the chromatin morphology (Fig. 5C,D). The expanded zone of cells with higher DAPI labelling correspond to an expanded population of small primary spermatocytes with diffuse chromatin surrounding a prominent nucleolus (Fig. 5D).
|
|
Achi/vis are members of the aly-class of
meiotic arrest genes
The control pathway underlying spermatogenesis is, as yet, poorly defined
but a few `meiotic-arrest' mutants have been identified. All the meiotic
arrest mutants have a similar phenotype; mature primary spermatocytes arrest
development, and fail to enter either the meiotic divisions or spermatid
differentiation. The currently identified meiotic arrest genes have been
subdivided into two classes. The aly-class genes (aly and
comr) appear to be higher in the control hierarchy and regulate
transcription of some genes involved in entry into meiosis (boule, twine,
Cyclin B) and also of many spermiogenesis genes (e.g. fuzzy onions,
janus B, don juan, gonadal) required for the differentiation of
functional sperm. In contrast, can-class meiotic arrest genes
(including cannonball, meiosis 1 arrest (mia) and spermatocyte
arrest) do not affect transcription of the meiosis cell-cycle genes but
are required for spermiogenesis gene transcriptional activation
(White-Cooper et al., 1998
;
Jiang and White-Cooper,
2003
).
To place achi/vis within this scheme we examined the expression of a set of meiosis-related genes and a selected set of spermiogenesis genes in Df(2R)achi1 homozygous mutant testes by RT-PCR analysis, and in homozygous mutant males by in situ hybridisation (Fig. 7 and data not shown). Both the set of spermiogenesis genes tested (fuzzy onions, janus B, don juan, gonadal) and the meiosis-related cell-cycle genes (boule, twine, Cyclin B) showed strongly reduced expression in the mutant, placing achi/vis in the aly class of meiotic arrest genes. Transcription of other genes (RP49, polo and Cyclin A) was not affected in the mutants. To determine whether Drosophila TGIF is required upstream in the pathway for transcription of other meiotic arrest genes, we examined the expression of aly and comr in achi/vis mutant testes. In situ hybridisation on achiZ3922 visZ3922 mutant testes revealed aly and comr transcripts at similar levels to wild type, and RT-PCR analysis on Df(2R)achi1 demonstrated robust expression of aly and can transcripts. In the RT-PCR analysis the levels of aly and can actually appeared somewhat higher than wild type. We do not, however, interpret this as indicative of a regulatory interaction but rather as a reflection of the altered cellular composition of the mutant testes. Similarly, aly and comr are not required for the expression of achi/vis as normal levels of achi/vis transcripts were found, by RT-PCR, in aly and comr homozygous mutant testes (data not shown).
|
Drosophila TGIF is not required for the normal subcellular
localisation of Aly or Comr
The normal chromatin association of Aly and Comr proteins is essential for
their function, and the localisation of these two proteins is mutually
dependent, i.e. in an aly mutant Comr protein remains cytoplasmic,
and vice versa. In contrast, both Comr and Aly proteins localise to chromatin
in testes mutant for the downstream, can-class, genes. To determine
whether TGIF plays a role in the production or localisation of the other
aly-class proteins, we examined the levels and localisation of Aly
and Comr proteins in achiZ3922
visZ3922 mutant testes. Both Aly and Comr
proteins were detected by western blotting in
achiZ3922 visZ3922
mutant testes (data not shown). Immunofluorescent staining revealed that Aly
and Comr proteins were nuclear in achiZ3922
visZ3922 testes
(Fig. 6H-L). This places TGIF
downstream of, or parallel to, comr and aly.
Drosophila TGIF: evidence for repressor function?
TGIF has been extensively characterised as a transcriptional repressor in
vertebrates, yet in Drosophila the predominant effect we see in
achi/vis mutants is failure to activate a testis-specific
developmentally regulated transcriptional programme. In Drosophila,
TGIF must be acting either directly as a transcriptional activator, or
indirectly, as a repressor of a repressor. To investigate the transcriptional
effects of lack of achi/vis in more detail we undertook RNA
expression profiling looking particularly for genes whose expression was
increased in the mutants. This system is well suited to expression analysis as
a viable infertile phenotype allows the easy generation of mutant tissue for
comparison with wild type. Our preliminary microarray analysis, comparing RNA
from Df(2R)achi1 mutant testes to wild-type,
demonstrated, as expected, a large number of transcripts (including the
spermiogenesis genes) showing decreased expression relative to wild-type.
However, we also observed many transcripts with increased levels in the
mutant. Comprehensive analysis will be presented elsewhere, however we were
particularly intrigued by the strongly increased transcripts of extra sex
combs (esc), in the Df(2R)achi1 mutant
testis and we further investigated esc as a possible candidate for
repression by TGIF. The microarray result was supported by RT-PCR comparison
of esc transcript in wild type and
Df(2R)achi1
(Fig. 8A). Esc is a component
of the transcription silencing machinery
(Struhl, 1981
;
Gutjahr et al., 1995
;
Jones et al., 1998
;
Tie et al., 2001
) and hence
provided a possible link between Drosophila TGIF and gene repression.
If TGIF normally represses esc transcription in primary spermatocytes
this might allow the activation of the spermatogenesis transcription
programme. According to this model TGIF mutants would overexpress esc
and this would prevent the programme activation.
|
In the achi/vis mutant testes the overall expression levels of Esc protein were similar to wild type (Fig. 8C). How then do we explain the increase in esc transcript level? Esc protein level appears highest in early primary spermatocytes and this cell population is markedly expanded in achi/vis mutants. Our interpretation is that expansion of cells with the highest level of esc is the likely cause of the observed increase in esc transcript abundance.
Despite no change in the apparent level of Esc protein in mutant cells, the Esc localization was strikingly altered in Df(2R)achi1 mutant testes (Fig. 8C). Although in achi/vis mutants the primary spermatocytes apparently differentiate to the final primary spermatocyte stage, the concomitant accumulation of Esc in nuclear spots failed to occur. It appears achi/vis function is required for assembly of the Esc complexes.
TGIF in mouse spermatogenesis
As achi/vis mutants in Drosophila primarily
affect spermatogenesis we were interested in examining the potential for a
similar role of vertebrate TGIF. The expression profile of TGIF in the mouse
indicates widespread expression including strong expression in the testes
(Bertolino et al., 1996
). We
used an antibody raised against human TGIF to examine the protein localisation
of TGIF in the mouse testis (Fig.
9). In the mouse seminiferous tubules the spermatogonial stem
cells and mitotic spermatogonial cells are found at the periphery of the
tubules. Older cells are displaced towards the centre of the tubule so that a
transect across the tubule gives a time-line of development with more mature
meiotic stages towards the centre. TGIF was most prominently expressed in
cells in more peripheral regions of the tubules, including spermatogonia and
primary spermatocytes, and the labelling was restricted to cell nuclei.
Therefore TGIF is available in the mouse in appropriate cells for the
activation of the spermatogenesis transcriptional programme, as in the
fly.
|
| DISCUSSION |
|---|
|
|
|---|
The relatively small number of these meiotic arrest genes currently
identified presents the beguiling prospect that the transcriptional programme
of spermiogenesis may be controlled by an ancient simple mechanism.
Interestingly, two of the can-class meiotic arrest genes
(cannonball and no hitter) encode testis-specific components
of the general transcription factor TFIID suggesting that the genes activated
during the primary spermatocyte stage may share a distinct core promoter type
(Aoyagi and Wassarman, 2000
;
Aoyagi and Wassarman, 2001
;
Hiller et al., 2001
). The
homology of aly to a C. elegans gene implicated in a pathway
leading to chromatin remodelling factors suggests that aly may have a
role in chromatin reorganisation to allow access for specific transcription
factors and the testis specific TFIID to target promoters
(Beitel et al., 2000
;
White-Cooper et al., 2000
).
Our characterisation of Drosophila TGIF is the first description of a
sequence-specific transcription factor implicated in this pathway. We show
here that achi and vis are tandemly duplicated genes with
close sequence similarity to the vertebrate TALE-class homeodomain
transcription factor TGIF. Combined mutations in achi and
vis or deletion of both genes lead to a recessive male sterile
meiotic arrest phenotype. We found markedly decreased expression of both the
spermiogenesis genes and also of CycB and twine, required
for entry into meiosis, placing achi/vis into the aly-class
of meiotic arrest mutants. Drosophila TGIF does not appear to be
required for the transcriptional activation of other meiotic arrest genes as
aly, comr and cannonball are all expressed in
achi/vis mutants. Similarly function of other meiotic arrest
genes is not required for transcription of achi/vis.
Although the gross transcriptional consequences of loss of either
achi/vis or aly appear similar, the mutant
phenotypes are distinct. Both show effects on early primary spermatocytes with
an expansion of this cell type presumably due to a slowing of the progress of
differentiation through this stage. All the aly-class mutants,
aly, comr and achi/vis exhibit defects in chromatin
organisation but whereas the aly and comr mutant
spermatocytes arrest with `fuzzy' chromatin condensation
(Lin et al., 1996
), in
achi/vis mutants the chromatin rounds up in condensed
`blobs' which are reminiscent of meiotic pro-metaphase. This difference in the
phenotype is consistent with our finding that Drosophila TGIF is not
required for the normal localisation of Aly and Comr proteins, and suggests
that TGIF is also not required for the chromatin remodelling mediated by Aly
and Comr. This raises the question of whether the aly-class genes all
act together as components of a simple transcription activation switch or
whether they may be a somewhat heterogeneous collection with more diverse
roles within the spermatogenesis transcriptional programme.
Is Drosophila TGIF a transcriptional repressor or
activator?
Although we have shown that achi/vis are required for the
activation of both the spermiogenesis and meiosis genes in
Drosophila, vertebrate TGIFs have been extensively characterised in
vitro as repressors of transcription
(Wotton et al., 1999a
;
Wotton et al., 1999b
;
Wotton and Massague, 2001
).
Human TGIF has been shown to bind 5'-TGTCA-3' and repress
activation of retinoic acid responsive genes by competing for this binding
site with the retinoic acid receptor
(Bertolino et al., 1995
). TGIF
and TGIF2 are both able to bind to the TGFß-responsive Smad transcription
factors, and act in competition with co-activators such as CBP/p300. TGIF
recruits the co-repressor mSin3, and TGIF, but not TGIF2, interacts with the
co-repressor CtBP. Additionally both TGIF and TGIF2 have been shown to bind
histone deacetylase1 and thereby repress transcription by directing histone
deacetylase activity to particular chromosomal regions. Apart from the CtBP
interaction site (Melhuish and Wotton,
2000
), the corepressor interaction sites have not been precisely
defined but they have been mapped outside the region that is clearly conserved
between Drosophila and vertebrates. The comparison between
Drosophila and mosquito sequences revealed conserved regions outside
the homeodomain and C-terminal extension but these were not obviously related
to the vertebrate sequences. We do not know whether Achi/Vis acts directly as
a transcriptional activator, or as a repressor of a repressor, to regulate
transcriptional activity in primary spermatocytes. Clearly our data are more
simply interpreted if Drosophila TGIF acts as a transcriptional
activator, and we have, as yet, no evidence to support a model of TGIF as a
transcriptional repressor in Drosophila.
Our investigation of TGIF function led us to examine Esc expression in
spermatogenesis and revealed a potential link between
achi/vis and gene repression. Esc has been shown to play a
key role in the establishment of silencing complexes in the embryo as a
component of a repressor complex with histone H3 methyl transferase activity
that marks chromosomal sites for silencing
(Cao et al., 2002
;
Czermin et al., 2002
;
Muller et al., 2002
). In wild
type, Esc protein underwent a profound change in sub-cellular localisation
during the primary spermatocyte stage. Initially Esc was rather evenly
distributed throughout the nucleus but absent from the nucleolus, however, as
the primary spermatocytes differentiated, Esc progressively accumulated in
nuclear spots. Similar nuclear spots have been reported in a variety of cell
types for components of the gene silencing machinery
(Messmer et al., 1992
;
Alkema et al., 1997
;
Satijn et al., 1997
;
Saurin et al., 1998
).
Interestingly, in achi/vis mutants the accumulation of Esc
in these complexes failed to occur. This does not appear to be simply because
the mutant primary spermatocytes arrest prior to the appearance of the Esc
nuclear spots; these complexes are visible in the wild type at about stage 3
of primary spermatocyte differentiation whereas in achi/vis
mutants the primary spermatocytes attain the size and several characteristics
of the final stage 6 primary spermatocyte. The activation of TGIF expression
precedes the relocalisation of Esc, consistent with a link between
achi/vis function and the formation of Esc silencing
complexes. This may be a very indirect link but it is interesting that
vertebrate TGIF has been proposed to provide the specific DNA binding protein
to enable the co-repressors CtBP and HDAC to initiate silencing complexes at
specific sites (Melhuish and Wotton,
2000
). Clearly much work remains to be done to investigate this
link and it will be interesting to see whether mutants in other meiotic arrest
genes also show the same effect on Esc localisation. Whilst Esc relocalisation
may be an important downstream event it is not an essential intermediary in
achi/vis function as the activation of several achi/vis
target genes (e.g. Cyclin B) precedes the formation of Esc
complexes.
TGIF in spermatogenesis
Achi/Vis are the only TGIF homologues in Drosophila and thus
deletions of achi/vis completely remove TGIF-homologous
function. achi/vis deletion primarily affects
spermatogenesis and this may have implications for the role of TGIF in
vertebrates and the conservation of the mechanism of regulation of
spermatogenesis. The picture is complicated by the presence of several
TGIF-like genes in vertebrates. The expression of the original TGIF gene has
been studied in adult mouse and it was found to be highly expressed in liver,
kidney and testis (Bertolino et al.,
1996
). The distribution of human TGIF2, which shares 77% identity
with TGIF in the homeodomain but only 49% similarity elsewhere, has been
examined and it is expressed at highest levels in the heart, kidney and testis
(Imoto et al., 2000
). Recently
the testis-specific expression of two TGIF-like genes has been reported in
humans (Blanco-Arias et al.,
2002
) and a more distant relative in the mouse, Tex1, has
been described, which shares 50% identity in the homeodomain with mouse TGIF
and which is exclusively expressed in testis germline cells
(Lai et al., 2002
). We have
observed immunolabelling of spermatogonia in the mouse testis using an
antibody raised against a human TGIF peptide. Altogether the expression of
TGIF and its family members points to a strong connection between vertebrate
TGIF and spermatogenesis. Neither human nor mouse infertility has yet been
associated with TGIF family genes. However meiosis1 maturation arrest, the
most common cause of human idiopathic male infertility, shows striking
similarities to the Drosophila meiotic arrest phenotype
(Meyer et al., 1992
;
Lin et al., 1996
). Vertebrate
and Drosophila spermatogenesis follow a similar pathway of cellular
differentiation and it seems likely that many aspects of underlying regulatory
mechanisms are conserved. Indeed, molecular conservation has been found for
boule/DAZL, a regulator of twine/cdc25 translation required
for meiotic entry (Eberhart et al.,
1996
; Ruggiu et al.,
1997
; Maines and Wasserman,
1999
). We anticipate that the TGIF family will play a role in the
activation of the vertebrate spermatogenesis transcription programme.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alkema, M. J., Jacobs, J., Voncken, J. W., Jenkins, N. A., Copeland, N. G., Satijn, D. P., Otte, A. P., Berns, A. and van Lohuizen, M. (1997). MPc2, a new murine homolog of the Drosophila polycomb protein is a member of the mouse polycomb transcriptional repressor complex. J. Mol. Biol. 273,993 -1003.[CrossRef][Medline]
Altschul, S. F. and Lipman, D. J. (1990).
Protein database searches for multiple alignments. Proc. Natl.
Acad. Sci. USA 87,5509
-5513.
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J.,
Zhang, Z., Miller, W. and Lipman, D. J. (1997). Gapped BLAST
and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res. 25,3389
-3402.
Aoyagi, N. and Wassarman, D. A. (2000). Genes encoding Drosophila melanogaster RNA polymerase II general transcription factors: diversity in TFIIA and TFIID components contributes to gene-specific transcriptional regulation. J. Cell Biol. 150,F45 -F49.
Aoyagi, N. and Wassarman, D. A. (2001).
Developmental and transcriptional consequences of mutations in
Drosophila TAF(II)60. Mol. Cell Biol.
21,6808
-6819.
Ayyar, S. and White, R. A. H. (2001). achintya and vismay: two novel, tandem-repeated TALE-class homeobox genes. A. Dros. Res. Conf. 42,504C .
Beitel, G. J., Lambie, E. J. and Horvitz, H. R. (2000). The C. elegans gene lin-9, which acts in an Rb-related pathway, is required for gonadal sheath cell development and encodes a novel protein. Gene 254,253 -263.[CrossRef][Medline]
Bertolino, E., Reimund, B., Wildt-Perinic, D. and Clerc, R.
G. (1995). A novel homeobox protein which recognizes a TGT
core and functionally interferes with a retinoid-responsive motif.
J. Biol. Chem. 270,31178
-31188.
Bertolino, E., Wildt, S., Richards, G. and Clerc, R. G. (1996). Expression of a novel murine homeobox gene in the developing cerebellar external granular layer during its proliferation. Dev. Dyn. 205,410 -420.[CrossRef][Medline]
Blanco-Arias, P., Sargent, C. A. and Affara, N. A. (2002). The human-specific Yp11.2/Xq21.3 homology block encodes a potentially functional testis-specific TGIF-like retroposon. Mamm. Genome 13,463 -468.[CrossRef][Medline]
Burglin, T. R. (1997). Analysis of TALE
superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel
domain conserved between plants and animals. Nucleic Acids
Res. 25,4173
-4180.
Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P., Jones, R. S. and Zhang, Y. (2002). Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 26,1039 -1043.
Cenci, G., Bonaccorsi, S., Pisano, C., Verni, F. and Gatti, M. (1994). Chromatin and microtubule organization during premeiotic, meiotic and early postmeiotic stages of Drosophila melanogaster spermatogenesis. J. Cell Sci. 107,3521 -3534.[Abstract]
Conlon, F. L., Lyons, K. M., Takaesu, N., Barth, K. S., Kispert, A., Herrmann, B. and Robertson, E. J. (1994). A primary requirement for nodal in the formation and maintenance of the primitive streak in the mouse. Development 120,1919 -1928.[Abstract]
Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A. and Pirrotta, V. (2002). Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell 111,185 -196.[CrossRef][Medline]
Eberhart, C. G., Maines, J. Z. and Wasserman, S. A. (1996). Meiotic cell cycle requirement for a fly homologue of human Deleted in Azoospermia. Nature 381,783 -785.[CrossRef][Medline]
Feldman, B., Gates, M. A., Egan, E. S., Dougan, S. T., Rennebeck, G., Sirotkin, H. I., Schier, A. F. and Talbot, W. S. (1998). Zebrafish organizer development and germ-layer formation require nodal-related signals. Nature 395,181 -185.[CrossRef][Medline]
FlyBase (1999). The FlyBase database of the
Drosophila genome projects and community literature.
Nucleic Acids Res. 27,85
-88.
Fuller, M. T. (1993). Spermatogenesis. In The Development of Drosophila, vol.1 (ed. M. Bate and A. Martinez-Arias), pp.71 -147. Cold Spring Harbor, New York: Cold Spring Harbor Press.
Fuller, M. T. (1998). Genetic control of cell proliferation and differentiation in Drosophila spermatogenesis. Semin. Cell. Dev. Biol. 9, 433-444.[CrossRef][Medline]
Graf, D., Timmons, P. M., Hitchins, M., Episkopou, V., Moore, G., Ito, T., Fujiyama, A., Fisher, A. G. and Merkenschlager, M. (2001). Evolutionary conservation, developmental expression, and genomic mapping of mammalian Twisted gastrulation. Mamm. Genome 12,554 -560.[Medline]
Gripp, K. W., Wotton, D., Edwards, M. C., Roessler, E., Ades, L., Meinecke, P., Richieri-Costa, A., Zackai, E. H., Massague, J., Muenke, M. et al. (2000). Mutations in TGIF cause holoprosencephaly and link NODAL signalling to human neural axis determination. Nat. Genet. 25,205 -208.[CrossRef][Medline]
Gutjahr, T., Frei, E., Spicer, C., Baumgartner, S., White, R. A. and Noll, M. (1995). The Polycomb-group gene, extra sex combs, encodes a nuclear member of the WD-40 repeat family. EMBO J. 14,4296 -4306.[Medline]
Hiller, M. A., Lin, T. Y., Wood, C. and Fuller, M. T.
(2001). Developmental regulation of transcription by a
tissue-specific TAF homolog. Genes Dev.
15,1021
-1030.
Imoto, I., Pimkhaokham, A., Watanabe, T., Saito-Ohara, F., Soeda, E. and Inazawa, J. (2000). Amplification and overexpression of TGIF2, a novel homeobox gene of the TALE superclass, in ovarian cancer cell lines. Biochem. Biophys. Res. Commun. 276,264 -270.[CrossRef][Medline]
Jiang, J. and White-Cooper, H. (2003).
Transcriptional activation in Drosophila spermatogenesis involves the
mutually dependent function of aly and a novel meiotic arrest gene cookie
monster. Development
130,563
-573.
Jones, C. A., Ng, J., Peterson, A. J., Morgan, K., Simon, J. and
Jones, R. S. (1998). The Drosophila esc and E(z)
proteins are direct partners in Polycomb group-mediated repression.
Mol. Cell. Biol. 18,2825
-2834.
Lai, Y. L., Li, H., Chiang, H. S. and Hsieh-Li, H. M. (2002). Expression of a novel TGIF subclass homeobox gene, Tex1, in the spermatids of mouse testis during spermatogenesis. Mech. Dev. 113,185 -187.[CrossRef][Medline]
Lin, T. Y., Viswanathan, S., Wood, C., Wilson, P. G., Wolf, N. and Fuller, M. T. (1996). Coordinate developmental control of the meiotic cell cycle and spermatid differentiation in Drosophila males. Development 122,1331 -1341.[Abstract]
Maines, J. Z. and Wasserman, S. A. (1999). Post-transcriptional regulation of the meiotic Cdc25 protein Twine by the Dazl orthologue Boule. Nat. Cell Biol. 1, 171-174.[CrossRef][Medline]
Mann, R. S. and Affolter, M. (1998). Hox proteins meet more partners. Curr. Opin. Genet. Dev. 8, 423-429.[CrossRef][Medline]
Melhuish, T. A. and Wotton, D. (2000). The
interaction of C-terminal binding protein with the Smad corepressor
TG-interacting factor is disrupted by a holoprosencephaly mutation in TGIF.
J. Biol. Chem. 275,39762
-39766.
Messmer, S., Franke, A. and Paro, R. (1992).
Analysis of the functional role of the Polycomb chromo domain in
Drosophila melanogaster. Genes Dev.
6,1241
-1254.
Meyer, J. M., Maetz, J. L. and Rumpler, Y. (1992). Cellular relationship impairment in maturation arrest of human spermatogenesis: an ultrastructural study. Histopathology 21,25 -33.[Medline]
Muenke, M. and Beachy, P. A. (2000). Genetics of ventral forebrain development and holoprosencephaly. Curr. Opin. Genet. Dev 10,262 -269.[CrossRef][Medline]
Muller, J., Hart, C. M., Francis, N. J., Vargas, M. L., Sengupta, A., Wild, B., Miller, E. L., O'Connor, M. B., Kingston, R. E. and Simon, J. A. (2002). Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111,197 -208.[CrossRef][Medline]
Nanni, L., Croen, L. A., Lammer, E. J. and Muenke, M. (2000). Holoprosencephaly: molecular study of a California population. Am. J. Med. Genet. 90,315 -319.[CrossRef][Medline]
Olivieri, G. and Olivieri, A. (1965). Autoradiographic study of nucleic acid synthesis during spermatogenesis in Drosophila melanogaster. Mutat. Res. 2, 366-380.[Medline]
Phillips, C. L., Stark, M. R., Johnson, A. D. and Dahlquist, F. W. (1994). Heterodimerization of the yeast homeodomain transcriptional regulators alpha 2 and a1 induces an interfacial helix in alpha 2. Biochemistry 33,9294 -9302.[CrossRef][Medline]
Preston, C. R., Sved, J. A. and Engels, W. R. (1996). Flanking duplications and deletions associated with P-induced male recombination in Drosophila. Genetics 144,1623 -1638.[Abstract]
Rebagliati, M. R., Toyama, R., Haffter, P. and Dawid, I. B.
(1998). cyclops encodes a nodal-related factor involved in
midline signaling. Proc. Natl. Acad. Sci. USA
95,9932
-9937.
Ruggiu, M., Speed, R., Taggart, M., McKay, S. J., Kilanowski, F., Saunders, P. and Cooke, H. J. (1997). The mouse Dazla gene encodes a cytoplasmic protein essential for gametogenesis. Nature 389,73 -77.[CrossRef][Medline]
Sampath, K., Rubinstein, A. L., Cheng, A. M., Liang, J. O., Fekany, K., Solnica-Krezel, L., Korzh, V., Halpern, M. E. and Wright, C. V. (1998). Induction of the zebrafish ventral brain and floorplate requires cyclops/nodal signalling. Nature 395,185 -189.[CrossRef][Medline]
Satijn, D. P., Gunster, M. J., van der Vlag, J., Hamer, K. M., Schul, W., Alkema, M. J., Saurin, A. J., Freemont, P. S., van Driel, R. and Otte, A. P. (1997). RING1 is associated with the polycomb group protein complex and acts as a transcriptional repressor. Mol. Cell Biol. 17,4105 -4113.[Abstract]
Saurin, A. J., Shiels, C., Williamson, J., Satijn, D. P., Otte,
A. P., Sheer, D. and Freemont, P. S. (1998). The human
polycomb group complex associates with pericentromeric heterochromatin to form
a novel nuclear domain. J. Cell Biol.
142,887
-898.
Schäfer, M., Nayernia, K., Engel, W. and Schäfer, U. (1995). Translational control in spermatogenesis. Dev. Biol. 172,344 -352.[CrossRef][Medline]
Sprules, T., Green, N., Featherstone, M. and Gehring, K. (2000). Conformational changes in the PBX homeodomain and C-terminal extension upon binding DNA and HOX-derived YPWM peptides. Biochemistry 39,9943 -9950.[CrossRef][Medline]
Struhl, G. (1981). A gene product required for correct initiation of segmental determination in Drosophila.Nature 293,36 -41.[CrossRef][Medline]
Thompson, J. D., Higgins, D. G. and Gibson, T. J.
(1994). CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Res.
22,4673
-4680.
Tie, F., Furuyama, T., Prasad-Sinha, J., Jane, E. and Harte, P. J. (2001). The Drosophila Polycomb group proteins ESC and E(Z) are present in a complex containing the histone-binding protein p55 and the histone deacetylase RPD3. Development 128,275 -286.[Abstract]
White-Cooper, H., Leroy, D., MacQueen, A. and Fuller, M. T. (2000). Transcription of meiotic cell cycle and terminal differentiation genes depends on a conserved chromatin associated protein, whose nuclear localisation is regulated. Development 127,5463 -5473.[Abstract]
White-Cooper, H., Schafer, M. A., Alphey, L. S. and Fuller, M. T. (1998). Transcriptional and post-transcriptional control mechanisms coordinate the onset of spermatid differentiation with meiosis I in Drosophila. Development 125,125 -134.[Abstract]
Wotton, D., Knoepfler, P. S., Laherty, C. D., Eisenman, R. N. and Massague, J. (2001). The Smad transcriptional corepressor TGIF recruits mSin3. Cell Growth Differ. 12,4574 -4563.
Wotton, D., Lo, R. S., Lee, S. and Massague, J. (1999a). A Smad transcriptional corepressor. Cell 97,29 -39.[CrossRef][Medline]
Wotton, D., Lo, R. S., Swaby, L. A. and Massague, J.
(1999b). Multiple modes of repression by the Smad transcriptional
corepressor TGIF. J. Biol. Chem.
274,37105
-37110.
Wotton, D. and Massague, J. (2001). Smad transcriptional corepressors in TGF beta family signaling. Curr. Top. Microbiol. Immunol. 254,145 -164.[Medline]
Yang, Y., Hwang, C. K., D'Souza, U. M., Lee, S. H., Junn, E. and
Mouradian, M. M. (2000). Three-amino acid extension loop
homeodomain proteins Meis2 and TGIF differentially regulate transcription.
J. Biol. Chem. 275,20734
-20741.
This article has been cited by other articles:
![]() |
T. M. Franklin-Dumont, C. Chatterjee, S. A. Wasserman, and S. DiNardo A novel eIF4G homolog, Off-schedule, couples translational control to meiosis and differentiation in Drosophila spermatocytes Development, August 1, 2007; 134(15): 2851 - 2861. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jiang, E. Benson, N. Bausek, K. Doggett, and H. White-Cooper Tombola, a tesmin/TSO1-family protein, regulates transcriptional activation in the Drosophila male germline and physically interacts with Always early Development, April 15, 2007; 134(8): 1549 - 1559. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Mikhaylova, A. M. Boutanaev, and D. I. Nurminsky Transcriptional regulation by Modulo integrates meiosis and spermatid differentiation in male germ line PNAS, August 8, 2006; 103(32): 11975 - 11980. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Mar and P. A. Hoodless Embryonic fibroblasts from mice lacking tgif were defective in cell cycling. Mol. Cell. Biol., June 1, 2006; 26(11): 4302 - 4310. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Leonard, D. Rendic, C. Rabouille, I. B. H. Wilson, T. Preat, and F. Altmann The Drosophila fused lobes Gene Encodes an N-Acetylglucosaminidase Involved in N-Glycan Processing J. Biol. Chem., February 24, 2006; 281(8): 4867 - 4875. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shen and C. A. Walsh Targeted Disruption of Tgif, the Mouse Ortholog of a Human Holoprosencephaly Gene, Does Not Result in Holoprosencephaly in Mice Mol. Cell. Biol., May 1, 2005; 25(9): 3639 - 3647. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hiller, X. Chen, M. J. Pringle, M. Suchorolski, Y. Sancak, S. Viswanathan, B. Bolival, T.-Y. Lin, S. Marino, and M. T. Fuller Testis-specific TAF homologs collaborate to control a tissue-specific transcription program Development, November 1, 2004; 131(21): 5297 - 5308. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Perezgasga, J. Jiang, B. Bolival Jr, M. Hiller, E. Benson, M. T. Fuller, and H. White-Cooper Regulation of transcription of meiotic cell cycle and terminal differentiation genes by the testis-specific Zn-finger protein matotopetli Development, April 15, 2004; 131(8): 1691 - 1702. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||