|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
doi: 10.1242/10.1242/dev.00510
Department of Biochemistry and Molecular Biophysics, Columbia University, 701 West 168th Street, HHSC 1104, New York, NY 10032, USA
Accepted 21 March 2003
| SUMMARY |
|---|
|
|
|---|
Key words: Spermatogenesis, Meiosis, Homeobox genes, TGIF, TALE genes, Drosophila melanogaster
| INTRODUCTION |
|---|
|
|
|---|
Homeodomain proteins are classified into different groups depending upon
the sequence of the homeodomain and immediately flanking amino acids, and the
presence of other protein domains elsewhere in the protein
(Gehring et al., 1994
). One
group of homeodomain proteins, called the TALE (for three amino acid loop
extension) group, has an additional three amino acids separating the first and
second alpha helices, resulting in a 63, instead of the more typical 60, amino
acid homeodomain (Burglin,
1997
). The TALE group is noteworthy for several reasons. Two TALE
subgroups, MEIS and PBC, function as cofactors for the Hox homeodomain
proteins (Mann and Affolter,
1998
). At least for the regulation of some Hox target genes, a
Hox/PBC/MEIS trimer is critical (Ferretti
et al., 2000
; Jacobs et al.,
1999
; Ryoo et al.,
1999
). In the PBC subgroup, the TALE-specific amino acids are Leu
Ser Asn, which form part of a hydrophobic pocket that is directly contacted by
the peptide Tyr-Pro-Trp-Met present in many Hox proteins
(Passner et al., 1999
;
Piper et al., 1999
). In
addition to their role as Hox cofactors, the MEIS and PBC genes
homothorax (hth) and extradenticle (exd)
carry out several additional functions during Drosophila development.
These genes are important for eye and antennal development and help to form
the proximodistal axis in the thoracic appendages
(Abu-Shaar and Mann, 1998
;
Bessa et al., 2002
;
Casares and Mann, 1998
;
Gonzalez-Crespo and Morata,
1996
; Pai et al.,
1998
; Wu and Cohen,
1999
). The Iroquois genes, which constitute a third TALE subgroup,
are also important for patterning the appendages, as well as in neural and
organ development (Cavodeassi et al.,
2001
).
The TG interacting factors (TGIF) make up another interesting TALE
subgroup. The founding member of this subgroup, TGIF, can be recruited to DNA
directly, by binding to its target site, or indirectly, by virtue of its
interaction with Smad proteins, which are key transcription factors that are
activated by TGFß signaling (Bertolino
et al., 1995
; Sharma and Sun,
2001
; Wotton et al.,
2001
; Wotton et al.,
1999a
; Wotton et al.,
1999b
; Wotton and Massague,
2001
). In humans, mutations in TGIF cause holoprosencephaly (HPE),
a severe genetic disorder affecting craniofacial development
(Gripp et al., 2000
;
Wallis and Muenke, 2000
). HPE
is also caused by mutations in the Nodal pathway, which is related to
TGFß, thus linking TGIF with Nodal signaling in vivo
(Gripp et al., 2000
;
Wallis and Muenke, 2000
). TGIF
appears to be a transcriptional repressor protein with at least two repressor
domains that recruit either histone deacetylases (HDACs) or C-terminal binding
protein (CtBP), a general corepressor
(Sharma and Sun, 2001
;
Wotton et al., 2001
;
Wotton et al., 1999a
;
Wotton et al., 1999b
;
Wotton and Massague,
2001
).
The genome sequence of the fruit fly, Drosophila melanogaster,
predicts the existence of eight TALE genes: exd (a PBC gene),
hth (a MEIS gene), three linked Iroquois genes (mirror,
araucan and caupolican), two tightly linked TGIF-like genes,
vismay (vis) and achintya (achi), and one
predicted gene, CG11617 (Adams et al.,
2000
; Misra et al.,
2002
). Of these, only CG11617 and the two TGIF-like genes have not
yet been characterized. To analyze a potential role for the TGIF-like genes in
Drosophila development, we generated a deficiency that uncovers both
vis and achi. Surprisingly, flies homozygous for this
deletion are viable, suggesting that these genes play no essential role in
embryonic or larval development. However, homozygous males are sterile.
Further analysis shows that in the absence of vis and achi,
spermatogenesis is blocked prior to the meiotic divisions with no signs of
differentiation, placing these genes in the category known as male meiotic
arrest genes. Genomic rescue and epistasis experiments suggest that Vis and
Achi are redundant transcription factors that function at the same step in
spermatogenesis as two other meiotic arrest genes, always early
(aly) and cookie monster (comr)
(Jiang and White-Cooper, 2003
;
White-Cooper et al., 2000
).
Moreover, Aly and Comr co-immunoprecipitate with Vis and/or Achi, suggesting
that these proteins may function together as a complex to control normal male
meiosis and spermatid differentiation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
To generate a deletion of vis and achi, we employed a
P-element-mediated male recombination strategy
(Preston et al., 1996
). We
screened for recombination between a proximal marker (hook or
aristaless) and EP(2)2107, which is marked by the mini white
gene. Out of six recombinant lines, one deleted vis and
achi. Because of its resulting male sterile phenotype, we named this
deficiency Df(2R)pingpong (Fig.
1C), and refer to it here simply as pingpong. The other
recombinants did not disrupt vis or achi as determined by
PCR mapping, and they are homozygous viable and fertile. Other potential
lethals on the Df(2R)pingpong chromosome were removed by meiotic
recombination.
In the pingpong deficiency the original EP insertion is still present. We therefore mapped the deletion molecularly by P-element-mediated plasmid rescue. The sequence at the deletion junction is as follows: GTAAGTGTATGTGTGTGTGGAAGCCCTGATTCATGATGAAATAACATAAGGTGGTCCCGT (genomic sequences are in normal type and P-element sequences are in bold type).
Approximately 40 kb was deleted (Fig. 1C). The absence of vis, achi, CG8824, CG30044 and CG12370 was verified by Southern analysis and PCR mapping (data not shown).
Rescue constructs
Genomic DNA fragments containing either vis or achi were
generated by PCR using a BAC clone (24H9, Research Genetics/BDGP) as the
template. The primers used to generate the genomic rescue fragments of
vis or achi are:
P{vis} contains a 4.7 kb fragment extending from 362 bp upstream of the first exon to 1563 bp downstream of the last exon of vis. P{achi} contains a 4.8 kb fragment ranging from 900 bp upstream of the first exon to 700 bp downstream of the last exon of achi. These PCR products were cloned into a shuttle vector and sequenced for verification. Finally, vis or achi rescue fragments were cloned into the pP{W8} vector (FlyBase) and transgenic flies were generated by standard methods. Although P{achi} and, to some extent, P{vis} rescue the infertility of Df(2R)pingpong males, Df(2R)pingpong; P{achi} and Df(2R)pingpong; P{vis} flies are not as healthy as wild type.
tub-AchiS2 and tub-AchiL were constructed by cloning the
EcoRI/XbaI fragments of LD25085 and LP02076 (from BDGP EST
collection), respectively, into an
1-tubulin (tub;
Tub84B FlyBase) cassette described previously
(Chen and Struhl, 1996
;
Zecca et al., 1995
).
Antibodies and immunofluorescence
A polyclonal antibody was raised against 6xHis-AchiS (full length) in
guinea pigs (Cocalico Biologicals, Inc., Reamstown, PA). No staining above
background was observed in Df(2R)pingpong embryos, imaginal discs or
germline tissues. In contrast, testes from either Df(2R)pingpong;
P{vis} or Df(2R)pingpong; P{achi} males showed a
normal expression pattern, demonstrating that this antibody recognizes both
Vis and Achi proteins (data not shown). We therefore refer to the
immunoreactivity as Vis/Achi when both genes are present. Rabbit anti-Aly and
rabbit anti-Comr antibodies were generously provided by Helen White-Cooper.
Rabbit antibodies against Cyclin A or Cyclin B were gifts from Christian
Lehner and David Glover. Mouse monoclonal antibody against Polo was a gift
from Claudio Sunkel. All secondary antibodies were purchased from Jackson
ImmunoReseach Laboratories.
Embryos and ovaries were fixed and immunostained according to published
protocols (Patel, 1994
;
Verheyen and Cooley, 1994
).
Third instar larval discs were dissected in PBS and fixed in 4% formaldehyde.
Adult testes were dissected in PBS, frozen in liquid nitrogen before being
fixed by either the methanol/acetone method or in 4% paraformaldehyde
(Bonaccorsi et al., 2000
).
Using the paraformaldehyde fixation we observed Vis/Achi throughout the
testes, including in mitotic cells at the apical tip (shown in
Fig. 3); the methanol/acetone
fixation revealed a more limited Vis/Achi pattern in which only the primary
spermatocytes were labeled. Anti-Achi antibody was used at 1:1000, Aly
antibody at 1:2000, Comr antibody at 1:1000, Cyclin A antibody at 1:600,
Cyclin B antibody at 1:2000 and Polo antibody at 1:40 dilutions. All secondary
antibodies were diluted to 1:400. To stain DNA with propidium iodide
(Molecular Probes), 100 µg/ml of RNAse A was included in the secondary
antibody incubation.
|
BrdU labeling
Testes were dissected in Ringer's solution and bathed in 100 mg/ml BrdU
(Sigma) in Ringer's. After labeling for 60 minutes, testes were washed 3 times
in PBT (PBS + 0.1% Triton X-100) and subsequently fixed in 4% formaldehyde/PBT
for 30 minutes. To make labeled DNA more accessible to immunodetection, fixed
testes were treated with 50 U/ml DNAseI (Roche) for 60 minute at 25°C
(Gonczy and DiNardo, 1996
).
BrdU incorporation was detected by 1:100 mouse anti-BrdU (Becton Dickinson)
and followed by FITC-conjugated secondary antibody.
Western analysis
Whole-testes lysates were prepared by putting dissected testes directly
into 2x SDS sample buffer then vortexing vigorously. Adult carcasses
were saved and ground in 2 xSDS sample buffer. Primary antibodies were
used at 1:7,500-10,000 for AchiS, at 1:10,000 for Aly, and at 1:5,000 for
Comr. Signals were detected by a secondary antibody conjugated to peroxidase
followed by the ECL reaction (Amersham). After antibody probing, the blot was
stained with GelCode Blue (Pierce) to reveal the loading profile. For these
experiments, wild-type extracts were generated from flies in which the
original EP insertion was precisely excised, which is genetically most similar
to the Df(2R)pingpong stock.
Co-immunoprecipitation
20-30 testes of each genotype were ground up in 100 µl RIPA buffer (50
mM Tris pH 7.5, 150 mM NaCl, 20 mM MgCl2, 0.5% NP40, and 1 mM PMSF)
containing a protease inhibitor cocktail (Roche) and 2.5 mM
Na3VO4 (Sigma). Testes extracts and
-Achi
antibody at 1:500 dilution were mixed and incubated at 4°C overnight. 10
µl of proteinA/G-agarose beads (Santa Cruz Biotechnology) was added and
incubated for an additional 3 hours. Samples were then washed three times and
all bound proteins were eluted with 2x SDS sample buffer.
| RESULTS |
|---|
|
|
|---|
Blast and ClustalW analyses also reveal that the mammalian proteins most
similar to Vis and Achi are human TGIF and TGIF2
(Fig. 1A). The similarity to
TGIF and TGIF2 is most obvious in the homeodomain (TGIF is
78% identical
to Achi), but the identity extends to residues C-terminal to the homeodomain.
A protein predicted from the genome sequence of the mosquito, Anopheles
gambiae, shows several additional regions with similarity to Vis and
Achi. Other members of the TGIF subgroup have homology to Vis and Achi
primarily within the homeodomain (Fig.
1A).
vis and achi are required for male fertility
vis and achi are located on the right arm of chromosome 2
in the Drosophila genome, in cytological position 49A. Starting with
a P element (EP(2)2107) inserted close to the 5' end of achi,
we used P element-mediated male recombination to generate a
40 kilobase
deletion that removes both vis and achi
(Fig. 1C). Because this
deficiency deletes two nearly identical genes and results in male sterility,
we named it Df(2R)pingpong and refer to it here simply as
pingpong. In addition to deleting vis and achi,
pingpong also removes four additional genes
(Fig. 1C). However, homozygous
flies carrying this deficiency are viable, suggesting that none of these genes
are required for embryonic or larval development. Moreover, pingpong
homozygous females are fertile and can give rise to viable pingpong
progeny, eliminating the possibility that any of these genes have an essential
maternal function. The only highly penetrant phenotype observed in
pingpong homozygous flies is male sterility which can be rescued by
transgenes carrying genomic regions for either vis (P{vis})
or achi (P{achi}) (Fig.
1C and see below). Thus, we conclude that vis and
achi encode redundant functions required for male fertility.
We quantitated the role of vis and achi in male fertility by comparing the fertility of pingpong males with pingpong; P{vis} and pingpong; P{achi} males. We crossed individual males to wild-type females and counted the number of progeny after 15 days. In this assay wild-type (yw) males yielded an average of 132 progeny/male (n=2). pingpong males were completely infertile (0 progeny; n=26). In contrast, pingpong; P{achi} males were nearly as fertile as wild type (100.5 progeny/male; n=10) and pingpong; P{vis} males were partially rescued (27.8 progeny/male; n=16). Although both P{vis} and P{achi} appear to generate a wild-type Vis/Achi expression pattern in the male germline (see below and data not shown) these results suggest that achi is better able to rescue the mutant phenotype than vis.
Vis and Achi are widely expressed during development
To analyze the vis and achi expression patterns we
generated a polyclonal antibody against AchiS. Using this antibody, we
detected nuclear expression in nearly all cells and stages of development,
including cells in the testes (Fig.
2). The specificity of this antibody was confirmed by observing
only background staining in the pingpong deficiency
(Fig. 2B and data not shown).
Moreover, a wild-type testes staining pattern is generated by either the
P{vis} or P{achi} transgenes (data not shown and see below)
demonstrating that this antibody recognizes both Vis and Achi proteins.
|
25-fold over a period of
3.5 days, remain in meiotic prophase, a specialized stage of the meiotic
cell cycle that precedes the meiotic divisions. Like Aly
(White-Cooper et al., 2000
|
Spermatogenesis in Df(2R)pingpong males arrests before the
first meiotic division
The male sterile phenotype, together with its strong nuclear expression in
primary spermatocytes, suggested that vis or achi may be
required for meiosis. We therefore examined pingpong and
pingpong; P{achi} testes by phase contrast microscopy and by
staining the chromosomes with propidium iodide. In contrast to wild type,
pingpong mutant testes are much smaller and are blocked before the
first meiotic division (Fig.
4). Specifically, no evidence of any elongated or onion stage
spermatids are observed in the pingpong mutant
(Fig. 4A-D). Instead, the
testes are filled with cells that appear to remain at the primary spermatocyte
stage. 16-cell cysts are still present, suggesting that the four mitotic
divisions proceed normally in this mutant. However, the cells are smaller and
not as round as in wild type (Fig.
4C,D). Far from the apical tip of the testes cells appear to
degenerate. In addition, some of the chromosomes fail to fully condense in the
absence of Vis and Achi (Fig.
4F,H). Typically, we observe three spots of DNA per cell, but the
appearance of these spots ranges from diffuse (partially decondensed) to fully
condensed (Fig. 4H). This
phenotype indicates that the normally synchronized events leading to
chromosome condensation fail in the pingpong mutant. Furthermore,
these results suggest that although the pingpong mutant initiates
meiosis in the male, meiosis is blocked before the first meiotic division,
probably prior to the G2 to M transition. In addition to being
blocked in meiosis, pingpong testes do not show any signs of
spermatid differentiation, such as the distinctive onion stage cysts or
spermatid elongation.
We also used bromodeoxyuridine (BrdU) labeling to determine if the 16-cell cysts in pinpong testes undergo DNA synthesis before arresting. As seen (Fig. 4I,J), BrdU-labeled 16-cell cysts were observed in both wild-type and pingpong testes. Thus, the block in meiosis occurs after DNA synthesis but before the first meiotic division.
vis and achi act in parallel with aly and
comr
The genetic analysis of spermatogenesis in Drosophila has
identified several genes that are required for the normal progression through
meiosis in males (Fuller,
1998
). Two of these genes, aly and cookie
monster (comr) can be distinguished from the others because they
are required for the expression of twine, which encodes a cdc25-like
phosphatase, and boule, an ortholog of the human gene Deleted in
Azoospermia (Alphey et al.,
1992
; Eberhart et al.,
1996
; Jiang and White-Cooper,
2003
; White-Cooper et al.,
2000
; White-Cooper et al.,
1998
). In contrast, the gene cannonball (can) is
also required for meiosis in males, but is not required for the expression of
twine or boule mRNAs
(Hiller et al., 2001
;
White-Cooper et al., 1998
). To
gain additional insight into the pingpong mutant phenotype we stained
mutant testes for several markers known to be expressed in testes, including
twine and boule. Like aly and comr, but
unlike can mutant testes, the pingpong mutant does not
express twine or boule mRNAs
(Fig. 5A-D). Also like
aly and comr mutants, pingpong testes do not
express mst87F, a gene that is required for spermatid differentiation
(Kuhn et al., 1988
)
(Fig. 5E,F). These results
suggest that vis and achi function at a similar step as
aly and comr.
|
The expression of cell cycle regulators in pingpong
mutant
The lack of twine expression in pingpong mutant testes is
consistent with it causing a meiotic arrest phenotype
(Courtot et al., 1992
). In
addition to twine, meiosis is also controlled by the availability of
Cyclins A and B, which are required to activate Cyclin dependent kinase 1
(Cdk1) (Knoblich and Lehner,
1993
; Lehner and O'Farrell,
1990
; Sigrist et al.,
1995
). Both Cyclins A and B are normally expressed during male
spermatogenesis, at high levels in the mitotically dividing cells at the
apical tip of the testes, at lower levels during the primary spermatocyte
stage, and at higher levels in 16-cell cysts just prior to the G2
to M transition (Fig. 6A,C).
The cyclins are rapidly degraded at the end of metaphase
(Lin et al., 1996
;
White-Cooper et al., 1998
). We
therefore examined cyclin levels in pingpong mutant testes
(Fig. 6A-D). Although there is
some variation between individual testes, in general we observed intermediate
levels of both Cyclin A and Cyclin B throughout pingpong testes
(Fig. 6A-D). Cyclin A and B
levels persisted, although at lower levels, up to the point when the cells
appear to degenerate. In addition, although there is a transient nuclear
localization of both Cyclins prior to cell division in the wild type, both
Cyclins were predominantly observed in the cytoplasm in the pingpong
mutant. Therefore, unlike in the wild type, Cyclin levels are not modulated in
the pingpong mutant, consistent with a block prior to the
G2/M transition. In addition, the levels of Polo, a protein kinase
required for cytokinesis during meiosis
(Herrmann et al., 1998
),
indicate that in pingpong testes the block occurs prior to the first
meiotic division (Fig.
6E,F).
|
60 kDa and
80 kDa were
detected in whole lysates of wild-type testes
(Fig. 7A). In contrast, only a
60 kDa band was detected in wild-type ovaries. Neither band was detected
in the testes or ovaries from the pingpong mutant, suggesting that
both are derived from vis and achi
(Fig. 7A). Furthermore, based
on the sizes of proteins observed in pingpong; P{vis} or
pingpong; P{achi} flies we deduce that VisL and AchiL both
migrate at
80 kDa and both VisS and AchiS migrate at
60 kDa
(Fig. 7B). This assignment was
confirmed by expressing the AchiL or AchiS cDNAs under the control of the
1-tubulin promoter in Df(2R)pingpong flies
(Fig. 7B and data not shown).
Furthermore, in wild-type flies the slower migrating forms (AchiL and VisL)
are testes specific because only the
60 kDa species was observed in male
or female somatic tissues (Fig.
7A). Although additional bands were observed in wild-type
extracts, they were still present in extracts derived from
Df(2R)pingpong flies, suggesting that they are not encoded by
vis or achi (data not shown).
|
Vis/Achi, Aly and Comr exist in a complex in wild-type testes
Many of the phenotypes we observe in the pingpong deficiency are
also observed in aly and comr mutants
(Jiang and White-Cooper, 2003
;
White-Cooper et al., 2000
;
White-Cooper et al., 1998
). In
addition, immunolocalization studies suggest that Vis, Achi, Aly and Comr
proteins are co-expressed in the nuclei of primary spermatocytes. These
observations prompted us to test if these proteins may be present as a complex
in wild-type testes. We tested this by carrying out immunoprecipitation (IP)
experiments with the anti-Achi antibody and determining if either Aly or Comr
is co-immunoprecipitated. Interestingly, both Aly and Comr can be
co-immunoprecipitated with Vis/Achi from wild type, but not from
pingpong testes (Fig.
8). These results suggest that Vis and Achi proteins are present
in a complex with Aly and Comr during wild-type testes development.
|
| DISCUSSION |
|---|
|
|
|---|
vis and achi encode homeodomain proteins required
for male meiosis in Drosophila
Previous work has identified a handful of meiotic arrest genes that are
required for the completion of meiosis in males
(Fuller, 1998
;
Hiller et al., 2001
;
Jiang and White-Cooper, 2003
;
Lin et al., 1996
;
White-Cooper et al., 2000
;
White-Cooper et al., 1998
).
Some of these genes, including aly and comr, have been
proposed to work at an early step in spermatogenesis because they are required
for both meiosis and spermatid differentiation. In contrast, other meiotic
arrest genes, such as boule, twine and polo, block only some
aspects of the spermatogenesis program
(Eberhart et al., 1996
;
Fuller, 1998
;
Herrmann et al., 1998
;
Hiller et al., 2001
;
Lin et al., 1996
). Our
analysis of the Df(2R)pingpong mutant phenotype suggests that
vis and achi act at the same or earlier step as aly
and comr. Most significantly, we found that, like aly and
comr, the expression of boule, twine and mst87f
mRNAs is absent in the pingpong mutant. In addition, the mutant
phenotype is more consistent with an early block in spermatocyte development
because no sign of spermatid differentiation can be observed in the
Df(2R)pingpong mutant. Also like aly and comr, the
Df(2R)pingpong mutant arrests prior to the G2 to M
transition of meiosis I. Moreover, based on our ability to label 16-cell cysts
in the Df(2R)pingpong mutant with BrdU, the block in meiosis
apparently occurs after DNA synthesis.
Despite the many similarities to aly and comr, our
results also suggest that vis and achi play a role in
spermatogenesis that is different from these genes. First, unlike Aly or Comr,
the Vis and Achi proteins are homeodomain-containing proteins of the TGIF
subclass, making it likely that they have the ability to bind DNA in a
sequence-specific manner. In contrast, aly encodes a
chromatin-associated protein that is related to the C. elegans lin-9
gene and comr encodes a novel nuclear protein
(Jiang and White-Cooper, 2003
;
White-Cooper et al., 2000
).
Thus, of the known meiotic arrest genes, vis and achi are
the best candidates for encoding sequence-specific transcription factors
necessary for the regulation of specific genes during Drosophila
spermatogenesis.
Our results further suggest, however, that there are additional transcription factors required for male meiosis in Drosophila that have yet to be identified. First, we found that vis and achi are not required for the expression of aly or comr, indicating that there are other factors that activate the expression of these genes in the testes. Second, vis and achi are widely expressed during development. Thus, the expression of these genes cannot be sufficient to trigger the male meiosis program. Instead, these results suggest that Vis and Achi must work together with other factors during testes development. Two of these factors are likely to be Aly and Comr, an idea that is supported by our ability to co-immunoprecipitate Vis/Achi, Aly, and Comr with an anti-Achi antibody. However, it is probable that there are additional, currently unknown factors that activate aly and comr expression and that work with Vis/Achi in primary spermatocytes.
Similarities and differences to mammalian TGIFs
Mammalian TGIF is known to interact with three co-repressors, CtBP, Sin3
and HDAC1, and TGIF2 interacts with HDAC1
(Melhuish et al., 2001
;
Wotton et al., 2001
;
Wotton et al., 1999a
;
Wotton et al., 1999b
;
Wotton and Massague, 2001
).
These interactions, together with the ability of TGIF to antagonize
TGFß-mediated gene activation, strongly suggest that both TGIF and TGIF2
are transcriptional repressors. However, the sequences in TGIF and TGIF2
required for the interactions with these co-repressors map to sequences that
are poorly, if at all, conserved in Vis or Achi. Thus, it is unclear at
present if Vis/Achi recruit these or other co-repressors. However, we have
shown that Vis/Achi proteins interact with Aly in vivo. Interestingly, an
aly homolog in C. elegans, lin-9, has been genetically
linked to components of the NURD complex, which is a chromatin remodeling
complex with both ATPase and HDAC activities
(Solari and Ahringer, 2000
;
Unhavaithaya et al., 2002
;
von Zelewsky et al., 2000
;
Xue et al., 1998
). Moreover,
the NURD complex has been implicated in gene repression. Thus, for some
targets Vis/Achi may repress transcription indirectly, by helping to recruit
Aly or stabilize its association with chromatin. Aly, in turn, may be able to
recruit or activate a NURD-like complex, resulting in repression.
We observe a loss of expression of specific target genes in the Df(2R)pingpong mutant, suggesting that Vis/Achi directly or indirectly activate these genes. However, as yet, none of the TGIF family members have been shown to activate transcription. Thus, it remains an open question whether Vis/Achi play a direct role in the activation of genes such as boule and twine or, alternatively, if it acts indirectly by repressing the expression of a repressor of these genes.
Another well characterized feature of the mammalian TGIF protein is its
ability to directly interact with Smad2, a transcription factor that is
activated by TGFß signaling (Wotton
et al., 1999a
). The interaction between TGIF and Smad2 is thought
to modulate the response to TGFß from gene activation to repression.
Interestingly, Drosophila spermatogenesis requires TGFß
signaling (Matunis et al.,
1997
). However, this pathway, which utilizes the receptor encoded
by punt and the transcription factor encoded by schnurri, is
active in the somatic cyst cells that surround the germline spermatocytes.
Once this pathway is activated, the somatic cyst cells are thought to release
a second, unknown signal that limits the proliferation of the underlying
germline cells (Matunis et al.,
1997
). At present, there is no known TGFß-like pathway
activated in primary spermatocytes, where Vis/Achi are maximally expressed.
However, the available data do not rule out that a TGFß-like pathway,
which functions independently of punt and schnurri, may be
active in these cells.
There are also connections between TGIF factors and epidermal growth factor
(EGF) signaling. Specifically, TGIF and TGIF2 have consensus MAPK
phosphorylation sites that are phosphorylated in response to EGF signaling,
and phosphorylation appears to stabilize these proteins
(Lo et al., 2001
;
Melhuish et al., 2001
).
Although the same phosphorylation sites do not appear to be conserved in
Vis/Achi, it will nevertheless be interesting to determine if the activity
and/or stability of Vis/Achi are modulated by a Ras/MAPK pathway that may be
activated in primary spermatocytes.
Potential role of mammalian TGIFs in spermatogenesis
In summary, our results demonstrate that vis and achi
play a critical role in spermatogenesis in Drosophila, but that they
are dispensable for other aspects of fly development. The highly restricted
role for these homeobox genes contrasts with the widespread roles for the
other TALE group homeobox genes in the fly, including exd, hth and
the Iro-C genes. It also contrasts with the apparently important role that the
TGIF genes play in TGFß and Nodal signaling in vertebrates. It is
possible that the original function of this gene family was in male meiosis
but that they duplicated in vertebrates, allowing some family members to
evolve into modulators of TGFß signaling. Consistent with this idea,
there are two TGIF family members, Tex-1 and TGIFLX (TGIF-like on X) that have
recently been found to be specifically expressed in mouse or human testes
(Blanco-Arias et al., 2002
;
Lai et al., 2002
). Given the
many other similarities between fly and mammalian spermatogenesis
(Fuller, 1998
;
Zhao and Garbers, 2002
), it is
plausible that these genes play an analogous role in mammalian spermatogenesis
as the vis and achi genes play in Drosophila.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abate-Shen, C. (2002). Deregulated homeobox gene expression in cancer: cause or consequence? Nat. Rev. Cancer 2,777 -785.[CrossRef][Medline]
Abu-Shaar, M. and Mann, R. S. (1998). Generation of multiple antagonistic domains along the proximodistal axis during Drosophila leg development. Development 125,3821 -3830.[Abstract]
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A.,
Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins,
R. A., Galle, R. F. et al. (2000). The genome sequence of
Drosophila melanogaster. Science
287,2185
-2195.
Alphey, L., Jimenez, J., White-Cooper, H., Dawson, I., Nurse, P. and Glover, D. M. (1992). twine, a cdc25 homolog that functions in the male and female germline of Drosophila. Cell 69,977 -988.[CrossRef][Medline]
Banerjee-Basu, S., Ferlanti, E. S., Ryan, J. F. and Baxevanis,
A. D. (1999). The Homeodomain Resource: sequences, structures
and genomic information. Nucleic Acids Res.
27,336
-337.
Banerjee-Basu, S., Ryan, J. F. and Baxevanis, A. D.
(2000). The homeodomain resource: a prototype database for a
large protein family. Nucleic Acids Res.
28,329
-330.
Bertolino, E., Reimund, B., Wildt-Perinic, D. and Clerc, R.
G. (1995). A novel homeobox protein which recognizes a TGT
core and functionally interferes with a retinoid-responsive motif.
J. Biol. Chem. 270,31178
-31188.
Bessa, J., Gebelein, B., Pichaud, F., Casares, F. and Mann, R.
S. (2002). Combinatorial control of Drosophila eye
development by eyeless, homothorax, and teashirt. Genes
Dev. 16,2415
-2427.
Blanco-Arias, P., Sargent, C. A. and Affara, N. A. (2002). The human-specific Yp11.2/Xq21.3 homology block encodes a potentially functional testis-specific TGIF-like retroposon. Mamm. Genome 13,463 -468.[CrossRef][Medline]
Bonaccorsi, S., Giansanti, M. G., Cenci, G. and Gatti, M. (2000). Cytological analysis of spermatocyte growth and male meiosis in Drosophila melanogaster. In Drosophila Protocols (ed. W. Sullivan M. Ashburner and R. S. Hawley). Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Burglin, T. R. (1997). Analysis of TALE
superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel
domain conserved between plants and animals. Nucleic Acids
Res. 25,4173
-4180.
Buske, C. and Humphries, R. K. (2000). Homeobox genes in leukemogenesis. Int. J. Hematol. 71,301 -308.[Medline]
Casares, F. and Mann, R. S. (1998). Control of antennal versus leg development in Drosophila. Nature 392, 723-726.
Cavodeassi, F., Modolell, J. and Gomez-Skarmeta, J. L.
(2001). The Iroquois family of genes: from body building to
neural patterning. Development
128,2847
-2855.
Chen, Y. and Struhl, G. (1996). Dual roles for patched in sequestering and transducing Hedgehog. Cell 87,553 -563.[CrossRef][Medline]
Courtot, C., Fankhauser, C., Simanis, V. and Lehner, C. F. (1992). The Drosophila cdc25 homolog twine is required for meiosis. Development 116,405 -416.[Medline]
Eberhart, C. G., Maines, J. Z. and Wasserman, S. A. (1996). Meiotic cell cycle requirement for a fly homologue of human Deleted in Azoospermia. Nature 381,783 -785.[CrossRef][Medline]
Ferretti, E., Marshall, H., Popperl, H., Maconochie, M., Krumlauf, R. and Blasi, F. (2000). Segmental expression of Hoxb2 in r4 requires two separate sites that integrate cooperative interactions between Prep1, Pbx and Hox proteins. Development 127,155 -166.[Abstract]
Fuller, M. T. (1998). Genetic control of cell proliferation and differentiation in Drosophila spermatogenesis. Semin. Cell Dev. Biol. 9, 433-444.[CrossRef][Medline]
Gehring, W. J., Affolter, M. and Burglin, T. (1994). Homeodomain proteins. Annu. Rev. Biochem. 63,487 -526.[CrossRef][Medline]
Gonczy, P. and DiNardo, S. (1996). The germ line regulates somatic cyst cell proliferation and fate during Drosophila spermatogenesis. Development 122,2437 -2447.[Abstract]
Gonczy, P., Viswanathan, S. and DiNardo, S. (1992). Probing spermatogenesis in Drosophila with P-element enhancer detectors. Development 114, 89-98.[Abstract]
Gonzalez-Crespo, S. and Morata, G. (1996). Genetic evidence for the subdivision of the arthropod limb into coxopodite and telopodite. Development 122,3921 -3928.[Abstract]
Goodman, F. R. and Scambler, P. J. (2001). Human HOX gene mutations. Clin. Genet. 59, 1-11.[CrossRef][Medline]
Gripp, K. W., Wotton, D., Edwards, M. C., Roessler, E., Ades, L., Meinecke, P., Richieri-Costa, A., Zackai, E. H., Massague, J., Muenke, M. et al. (2000). Mutations in TGIF cause holoprosencephaly and link NODAL signalling to human neural axis determination. Nat. Genet. 25,205 -208.[CrossRef][Medline]
Herrmann, S., Amorim, I. and Sunkel, C. E. (1998). The POLO kinase is required at multiple stages during spermatogenesis in Drosophila melanogaster. Chromosoma 107,440 -451.[Medline]
Hiller, M. A., Lin, T. Y., Wood, C. and Fuller, M. T.
(2001). Developmental regulation of transcription by a
tissue-specific TAF homolog. Genes Dev
15,1021
-1030.
Hobert, O. and Westphal, H. (2000). Functions of LIM-homeobox genes. Trends Genet. 16, 75-83.[CrossRef][Medline]
Jacobs, Y., Schnabel, C. A. and Cleary, M. L.
(1999). Trimeric association of Hox and TALE homeodomain proteins
mediates Hoxb2 hindbrain enhancer activity. Mol. Cell.
Biol. 19,5134
-5142.
Jiang, J. and White-Cooper, H. (2003).
Transcriptional activation in Drosophila spermatogenesis involves the mutually
dependent function of aly and a novel meiotic arrest gene cookie monster.
Development 130,563
-573.
Knoblich, J. A. and Lehner, C. F. (1993). Synergistic action of Drosophila cyclins A and B during the G2-M transition. EMBO J. 12,65 -74.[Medline]
Kuhn, R., Schafer, U. and Schafer, M. (1988). Cis-acting regions sufficient for spermatocyte-specific transcriptional and spermatid-specific translational control of the Drosophila melanogaster gene mst(3)gl-9. EMBO J. 7,447 -454.[Medline]
Lai, Y. L., Li, H., Chiang, H. S. and Hsieh-Li, H. M. (2002). Expression of a novel TGIF subclass homeobox gene, Tex1, in the spermatids of mouse testis during spermatogenesis. Mech. Dev. 113,185 -187.[CrossRef][Medline]
Lawrence, P. A. and Morata, G. (1994). Homeobox genes: their function in Drosophila segmentation and pattern formation. Cell 78,181 -189.[CrossRef][Medline]
Lehner, C. F. and O'Farrell, P. H. (1990). The roles of Drosophila cyclins A and B in mitotic control. Cell 61,535 -547.[CrossRef][Medline]
Lin, T. Y., Viswanathan, S., Wood, C., Wilson, P. G., Wolf, N. and Fuller, M. T. (1996). Coordinate developmental control of the meiotic cell cycle and spermatid differentiation in Drosophila males. Development 122,1331 -1341.[Abstract]
Lo, R. S., Wotton, D. and Massague, J. (2001). Epidermal growth factor signaling via Ras controls the Smad transcriptional co-repressor TGIF. EMBO J. 20,128 -136.[CrossRef][Medline]
Mann, R. S. and Affolter, M. (1998). Hox proteins meet more partners. Curr. Opin. Genet. Dev. 8, 423-429.[CrossRef][Medline]
Mann, R. S. and Carroll, S. B. (2002). Molecular mechanisms of selector gene function and evolution. Curr. Opin. Genet. Dev. 12,592 -600.[CrossRef][Medline]
Matunis, E., Tran, J., Gonczy, P., Caldwell, K. and DiNardo, S. (1997). punt and schnurri regulate a somatically derived signal that restricts proliferation of committed progenitors in the germline. Development 124,4383 -4391.[Abstract]
McGinnis, W. and Krumlauf, R. (1992). Homeobox genes and axial patterning. Cell 68,283 -302.[CrossRef][Medline]
Melhuish, T. A., Gallo, C. M. and Wotton, D.
(2001). TGIF2 interacts with histone deacetylase 1 and represses
transcription. J. Biol. Chem.
276,32109
-32114.
Misra, S., Crosby, M. A., Mungall, C. J., Matthews, B. B., Campbell, K. S., Hradecky, P., Huang, Y., Kaminker, J. S., Millburn, G. H., Prochnik, S. E. et al. (2002). Annotation of the Drosophila melanogaster euchromatic genome: a systematic review. Genome Biol. (in press).
Pai, C.-Y., Kuo, T., Jaw, T., Kurant, E., Chen, C., Bessarab,
D., Salzberg, A. and Sun, Y. (1998). The Homothorax
homeoprotein activates the nuclear localization of another homeoprotein,
extradenticle, and suppresses eye development in Drosophila. Genes
Dev. 12,435
-446.
Panganiban, G. and Rubenstein, J. L. (2002).
Developmental functions of the Distal-less/Dlx homeobox genes.
Development 129,4371
-4386.
Passner, J. M., Ryoo, H. D., Shen, L., Mann, R. S. and Aggarwal, A. K. (1999). Structure of a DNA-bound Ultrabithorax-Extradenticle homeodomain complex. Nature 397,714 -719.[CrossRef][Medline]
Patel, N. H. (1994). Imaging neuronal subset and other cell types in whole-mount drosophila embryos and larvae using antibody probes. In Drosophila melanogaster: Practical Uses in Cell and Molecular Biology, vol. 44 (ed. L. S. B. Goldstein and E. A. Fyrberg). San Diego, California: Academic Press.
Piper, D. E., Batchelor, A. H., Chang, C. P., Cleary, M. L. and Wolberger, C. (1999). Structure of a HoxB1-Pbx1 heterodimer bound to DNA: role of the hexapeptide and a fourth homeodomain helix in complex formation. Cell 96,587 -597.[CrossRef][Medline]
Preston, C. R., Sved, J. A. and Engels, W. R. (1996). Flanking duplications and deletions associated with P-induced male recombination in Drosophila. Genetics 144,1623 -1638.[Abstract]
Ryoo, H. D., Marty, T., Casares, F., Affolter, M. and Mann, R. S. (1999). Regulation of Hox target genes by a DNA bound Homothorax/Hox/Extradenticle complex. Development 126,5137 -5148.[Abstract]
Sharma, M. and Sun, Z. (2001).
5'TG3' interacting factor interacts with Sin3A and represses
AR-mediated transcription. Mol. Endocrinol.
15,1918
-1928.
Sigrist, S., Ried, G. and Lehner, C. F. (1995). Dmcdc2 kinase is required for both meiotic divisions during Drosophila spermatogenesis and is activated by the Twine/cdc25 phosphatase. Mech. Dev. 53,247 -260.[CrossRef][Medline]
Solari, F. and Ahringer, J. (2000). NURD-complex genes antagonise Ras-induced vulval development in Caenorhabditis elegans. Curr. Biol. 10,223 -226.[CrossRef][Medline]
Trainor, P. A. and Krumlauf, R. (2001). Hox genes, neural crest cells and branchial arch patterning. Curr. Opin. Cell Biol. 13,698 -705.[CrossRef][Medline]
Unhavaithaya, Y., Shin, T. H., Miliaras, N., Lee, J., Oyama, T. and Mello, C. C. (2002). MEP-1 and a homolog of the NURD complex component Mi-2 act together to maintain germline-soma distinctions in C. elegans. Cell 111,991 -1002.[CrossRef][Medline]
Verheyen, E. and Cooley, L. (1994). Looking at oogenesis. In Drosophila melanogaster: Practical Uses in Cell and Molecular Biology, vol. 44 (ed. L. S. B. Goldstein and E. A. Fyrberg). San Diego, California: Academic Press.
Vervoort, M. (2002). Functional evolution of Hox proteins in arthropods. BioEssays 24,775 -779.[CrossRef][Medline]
von Zelewsky, T., Palladino, F., Brunschwig, K., Tobler, H., Hajnal, A. and Muller, F. (2000). The C. elegans Mi-2 chromatin-remodelling proteins function in vulval cell fate determination. Development 127,5277 -5284.[Abstract]
Wallis, D. and Muenke, M. (2000). Mutations in holoprosencephaly. Hum. Mutat. 16, 99-108.[CrossRef][Medline]
White-Cooper, H., Leroy, D., MacQueen, A. and Fuller, M. T. (2000). Transcription of meiotic cell cycle and terminal differentiation genes depends on a conserved chromatin associated protein, whose nuclear localisation is regulated. Development 127,5463 -5473.[Abstract]
White-Cooper, H., Schafer, M. A., Alphey, L. S. and Fuller, M. T. (1998). Transcriptional and post-transcriptional control mechanisms coordinate the onset of spermatid differentiation with meiosis I in Drosophila. Development 125,125 -134.[Abstract]
Wotton, D., Knoepfler, P. S., Laherty, C. D., Eisenman, R. N.
and Massague, J. (2001). The Smad transcriptional
corepressor TGIF recruits mSin3. Cell Growth Differ.
12,457
-463.
Wotton, D., Lo, R. S., Lee, S. and Massague, J. (1999a). A Smad transcriptional corepressor. Cell 97,29 -39.[CrossRef][Medline]
Wotton, D., Lo, R. S., Swaby, L. A. and Massague, J.
(1999b). Multiple modes of repression by the Smad transcriptional
corepressor TGIF. J. Biol. Chem.
274,37105
-37110.
Wotton, D. and Massague, J. (2001). Smad transcriptional corepressors in TGF beta family signaling. Curr. Top. Microbiol. Immunol. 254,145 -164.[Medline]
Wu, J. and Cohen, S. M. (1999). Proximodistal axis formation in the Drosophila leg: subdivision into proximal and distal domains by Homothorax and Distal-less. Development 126,109 -117.[Abstract]
Xue, Y., Wong, J., Moreno, G. T., Young, M. K., Cote, J. and Wang, W. (1998). NURD, a novel complex with both ATP-dependent chromatin-remodeling and histone deacetylase activities. Mol. Cell 2,851 -861.[CrossRef][Medline]
Zecca, M., Basler, K. and Struhl, G. (1995). Sequential organizing activities of engrailed, hedgehog and decapentaplegic in the Drosophila wing. Development 121,2265 -2278.[Abstract]
Zhao, G. Q. and Garbers, D. L. (2002). Male germ cell specification and differentiation. Dev. Cell 2, 537-547.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
E. L. Beall, P. W. Lewis, M. Bell, M. Rocha, D. L. Jones, and M. R. Botchan Discovery of tMAC: a Drosophila testis-specific meiotic arrest complex paralogous to Myb-Muv B Genes & Dev., April 15, 2007; 21(8): 904 - 919. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jiang, E. Benson, N. Bausek, K. Doggett, and H. White-Cooper Tombola, a tesmin/TSO1-family protein, regulates transcriptional activation in the Drosophila male germline and physically interacts with Always early Development, April 15, 2007; 134(8): 1549 - 1559. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Mikhaylova, A. M. Boutanaev, and D. I. Nurminsky Transcriptional regulation by Modulo integrates meiosis and spermatid differentiation in male germ line PNAS, August 8, 2006; 103(32): 11975 - 11980. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Mar and P. A. Hoodless Embryonic fibroblasts from mice lacking tgif were defective in cell cycling. Mol. Cell. Biol., June 1, 2006; 26(11): 4302 - 4310. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shen and C. A. Walsh Targeted Disruption of Tgif, the Mouse Ortholog of a Human Holoprosencephaly Gene, Does Not Result in Holoprosencephaly in Mice Mol. Cell. Biol., May 1, 2005; 25(9): 3639 - 3647. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hiller, X. Chen, M. J. Pringle, M. Suchorolski, Y. Sancak, S. Viswanathan, B. Bolival, T.-Y. Lin, S. Marino, and M. T. Fuller Testis-specific TAF homologs collaborate to control a tissue-specific transcription program Development, November 1, 2004; 131(21): 5297 - 5308. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Perezgasga, J. Jiang, B. Bolival Jr, M. Hiller, E. Benson, M. T. Fuller, and H. White-Cooper Regulation of transcription of meiotic cell cycle and terminal differentiation genes by the testis-specific Zn-finger protein matotopetli Development, April 15, 2004; 131(8): 1691 - 1702. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||